Starting /dee2/code/volunteer_pipeline.sh SRR14639613 current disk space = 3058880323584 free memory = 1250135544 SRR14639613 SRAfilesize 4bd7b6069f34c2a3f56e13cbc66badf2 SRR14639613.sra SRR14639613.sra file validated SRR14639613 is paired end SRR14639613 is conventional basespace SRR14639613 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14639613_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.66875 32.0 32.0 32.0 32.0 32.0 2 31.4975 32.0 32.0 32.0 32.0 32.0 3 35.20875 37.0 32.0 37.0 32.0 37.0 4 36.15 37.0 37.0 37.0 32.0 37.0 5 36.2025 37.0 37.0 37.0 37.0 37.0 6 39.817 41.0 41.0 41.0 37.0 41.0 7 39.8165 41.0 41.0 41.0 37.0 41.0 8 40.04025 41.0 41.0 41.0 37.0 41.0 9 40.138 41.0 41.0 41.0 37.0 41.0 10-14 40.186350000000004 41.0 41.0 41.0 37.8 41.0 15-19 40.16345 41.0 41.0 41.0 37.0 41.0 20-24 40.18135 41.0 41.0 41.0 37.0 41.0 25-29 40.1156 41.0 41.0 41.0 37.0 41.0 30-34 40.08585000000001 41.0 41.0 41.0 38.6 41.0 35-39 40.04635 41.0 41.0 41.0 37.0 41.0 40-44 39.9889 41.0 41.0 41.0 37.0 41.0 45-49 39.9388 41.0 41.0 41.0 37.0 41.0 50-54 39.86575 41.0 41.0 41.0 37.0 41.0 55-59 39.84085 41.0 41.0 41.0 37.0 41.0 60-64 39.79915 41.0 41.0 41.0 37.0 41.0 65-69 39.62495 41.0 41.0 41.0 37.0 41.0 70-74 39.4385 41.0 41.0 41.0 37.0 41.0 75-79 39.062650000000005 41.0 40.2 41.0 36.0 41.0 80-84 39.4961 41.0 41.0 41.0 37.0 41.0 85-89 39.4418 41.0 41.0 41.0 37.0 41.0 90-94 39.4041 41.0 41.0 41.0 37.0 41.0 95-99 39.29665 41.0 41.0 41.0 37.0 41.0 100-104 39.220150000000004 41.0 41.0 41.0 37.0 41.0 105-109 39.159099999999995 41.0 41.0 41.0 37.0 41.0 110-114 39.0912 41.0 41.0 41.0 37.0 41.0 115-119 39.020050000000005 41.0 41.0 41.0 36.0 41.0 120-124 38.97755 41.0 41.0 41.0 36.0 41.0 125-129 39.0118 41.0 41.0 41.0 37.0 41.0 130-134 38.7247 41.0 41.0 41.0 32.0 41.0 135-139 38.46025 41.0 41.0 41.0 32.0 41.0 140-144 38.266149999999996 41.0 38.6 41.0 32.0 41.0 145-149 37.99815 41.0 37.0 41.0 32.0 41.0 150 37.87425 41.0 37.0 41.0 32.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 3.0 22 2.0 23 3.0 24 5.0 25 6.0 26 10.0 27 12.0 28 18.0 29 24.0 30 25.0 31 42.0 32 41.0 33 53.0 34 50.0 35 94.0 36 109.0 37 165.0 38 274.0 39 525.0 40 2539.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.70917729432358 13.4783695923981 14.153538384596148 35.65891472868217 2 15.875 11.825 41.0 31.3 3 14.875 19.075 31.75 34.300000000000004 4 21.425 26.224999999999998 26.125 26.224999999999998 5 21.425 33.425 26.950000000000003 18.2 6 15.45 32.824999999999996 30.599999999999998 21.125 7 14.975 25.275 40.475 19.275000000000002 8 14.025000000000002 23.474999999999998 38.35 24.15 9 14.924999999999999 27.575 34.875 22.625 10-14 18.625 29.21 29.04 23.125 15-19 18.4 29.26 28.275 24.065 20-24 19.05 28.665000000000003 28.715000000000003 23.57 25-29 18.95 28.675 28.98 23.395 30-34 19.11 30.18 27.815 22.895 35-39 19.405 28.34 28.555000000000003 23.7 40-44 19.384999999999998 28.939999999999998 27.794999999999998 23.880000000000003 45-49 19.31 28.29 28.615000000000002 23.785 50-54 18.834999999999997 29.64 28.095 23.43 55-59 19.235 28.52 28.439999999999998 23.805 60-64 19.650000000000002 28.79 27.725 23.835 65-69 19.685 28.67 27.82 23.825 70-74 19.57 28.27 28.475 23.685000000000002 75-79 19.89 28.07 28.105000000000004 23.935000000000002 80-84 19.665 29.07 27.700000000000003 23.565 85-89 19.715 28.88 28.1 23.305 90-94 19.93 28.535 27.884999999999998 23.65 95-99 19.355 28.64 28.189999999999998 23.815 100-104 19.175 28.665000000000003 28.000000000000004 24.16 105-109 19.63794569185378 28.26924038605791 27.809171375706356 24.283642546381955 110-114 19.79 28.449999999999996 28.050000000000004 23.71 115-119 19.785 28.199999999999996 28.389999999999997 23.625 120-124 20.09 28.485 27.97 23.455000000000002 125-129 19.695 28.775000000000002 27.694999999999997 23.835 130-134 19.919999999999998 28.7 28.044999999999998 23.335 135-139 19.99 28.084999999999997 28.405 23.52 140-144 20.335083770942735 28.077019254813703 27.916979244811202 23.670917729432357 145-149 20.45 28.12 27.805000000000003 23.625 150 20.175 27.975 27.675 24.175 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 1.5 3 1.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 1.0 13 1.0 14 0.0 15 0.0 16 0.5 17 2.0 18 1.5 19 0.5 20 1.0 21 2.5 22 3.0 23 3.0 24 3.0 25 7.5 26 12.0 27 13.0 28 16.0 29 26.0 30 27.5 31 30.5 32 39.5 33 47.5 34 65.5 35 88.0 36 102.0 37 124.0 38 152.5 39 170.0 40 203.5 41 232.5 42 249.5 43 280.0 44 287.0 45 265.0 46 256.0 47 241.5 48 215.5 49 181.0 50 135.0 51 102.5 52 93.5 53 77.0 54 55.0 55 44.5 56 31.0 57 23.5 58 19.5 59 15.5 60 15.0 61 10.0 62 6.5 63 4.5 64 2.0 65 1.5 66 0.5 67 0.5 68 1.5 69 1.5 70 0.5 71 0.0 72 0.0 73 0.0 74 1.0 75 1.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.015 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.025 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.325 #Duplication Level Percentage of deduplicated Percentage of total 1 95.3842119066352 90.925 2 4.3797534749541045 8.35 3 0.1835824809861002 0.525 4 0.05245213742460005 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.0625 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.075 0.0 0.0 0.0 0.0 102-103 0.075 0.0 0.0 0.0 0.0 104-105 0.075 0.0 0.0 0.0 0.0 106-107 0.075 0.0 0.0 0.0 0.0 108-109 0.1 0.0 0.0 0.0 0.0 110-111 0.1 0.0 0.0 0.0 0.0 112-113 0.1125 0.0 0.0 0.0 0.0 114-115 0.125 0.0 0.0 0.0 0.0 116-117 0.125 0.0 0.0 0.0 0.0 118-119 0.125 0.0 0.0 0.0 0.0 120-121 0.1375 0.0 0.0 0.0 0.0 122-123 0.1875 0.0 0.0 0.0 0.0 124-125 0.2 0.0 0.0 0.0 0.0 126-127 0.225 0.0 0.0 0.0 0.0 128-129 0.225 0.0 0.0 0.0 0.0 130-131 0.225 0.0 0.0 0.0 0.0 132-133 0.225 0.0 0.0 0.0 0.0 134-135 0.225 0.0 0.0 0.0 0.0 136-137 0.2375 0.0 0.0 0.0 0.0 138 0.275 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCATTGT 10 0.006973645 144.0 5 >>END_MODULE SRR14639613 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14639613_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.75875 32.0 32.0 32.0 32.0 32.0 2 30.52625 32.0 32.0 32.0 27.0 32.0 3 33.59875 37.0 32.0 37.0 27.0 37.0 4 34.57875 37.0 37.0 37.0 32.0 37.0 5 34.98 37.0 37.0 37.0 32.0 37.0 6 37.885 41.0 37.0 41.0 32.0 41.0 7 37.7035 41.0 37.0 41.0 32.0 41.0 8 37.729 41.0 37.0 41.0 27.0 41.0 9 38.1835 41.0 41.0 41.0 32.0 41.0 10-14 38.1335 41.0 41.0 41.0 31.0 41.0 15-19 37.952450000000006 41.0 40.2 41.0 29.0 41.0 20-24 37.854 41.0 39.4 41.0 27.0 41.0 25-29 37.4741 41.0 37.0 41.0 26.0 41.0 30-34 37.46705 41.0 37.0 41.0 27.0 41.0 35-39 37.34765 41.0 37.0 41.0 27.0 41.0 40-44 37.129949999999994 41.0 37.0 41.0 27.0 41.0 45-49 37.12695 41.0 37.0 41.0 27.0 41.0 50-54 36.9265 41.0 37.0 41.0 25.0 41.0 55-59 36.888999999999996 41.0 37.0 41.0 25.0 41.0 60-64 36.7828 41.0 37.0 41.0 25.0 41.0 65-69 36.62375 41.0 37.0 41.0 24.0 41.0 70-74 36.33045 41.0 37.0 41.0 22.0 41.0 75-79 35.48325 40.2 34.0 41.0 22.0 41.0 80-84 36.34915 41.0 37.0 41.0 22.0 41.0 85-89 36.439949999999996 41.0 37.0 41.0 22.0 41.0 90-94 36.1583 41.0 37.0 41.0 22.0 41.0 95-99 36.2157 41.0 37.0 41.0 22.0 41.0 100-104 35.921549999999996 41.0 35.0 41.0 20.0 41.0 105-109 35.95355 41.0 37.0 41.0 22.0 41.0 110-114 35.88275 41.0 36.0 41.0 22.0 41.0 115-119 35.48095 41.0 32.0 41.0 20.0 41.0 120-124 35.5561 41.0 32.0 41.0 22.0 41.0 125-129 35.1548 41.0 33.0 41.0 20.0 41.0 130-134 35.15185 41.0 32.0 41.0 18.0 41.0 135-139 34.6029 41.0 32.0 41.0 14.0 41.0 140-144 34.3932 41.0 32.0 41.0 12.0 41.0 145-149 34.102599999999995 40.2 31.0 41.0 12.0 41.0 150 33.74575 37.0 32.0 41.0 12.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 2.0 15 10.0 16 13.0 17 24.0 18 26.0 19 31.0 20 32.0 21 39.0 22 35.0 23 50.0 24 46.0 25 51.0 26 55.0 27 60.0 28 68.0 29 67.0 30 83.0 31 88.0 32 89.0 33 120.0 34 140.0 35 122.0 36 186.0 37 246.0 38 336.0 39 534.0 40 1447.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.2496866382552 26.372524442216093 11.28102281273502 26.096766106793684 2 18.55 26.674999999999997 39.074999999999996 15.7 3 16.950000000000003 27.474999999999998 34.525 21.05 4 22.175 34.225 24.425 19.175 5 22.25 38.85 23.400000000000002 15.5 6 17.25 35.975 27.3 19.475 7 20.7 20.825 37.724999999999994 20.75 8 15.8 24.25 34.175 25.775 9 19.55 25.05 31.55 23.849999999999998 10-14 22.915 28.255000000000003 27.065 21.765 15-19 21.965 27.87 28.685 21.48 20-24 22.759999999999998 27.634999999999998 27.88 21.725 25-29 22.12 28.065 28.799999999999997 21.015 30-34 21.4 29.060000000000002 28.08 21.46 35-39 21.765 28.185 28.4 21.65 40-44 22.445 28.01 28.425 21.12 45-49 22.245 27.639999999999997 28.860000000000003 21.255 50-54 22.405 28.065 28.09 21.44 55-59 22.43 27.865000000000002 28.615000000000002 21.09 60-64 23.07 28.175 27.905 20.849999999999998 65-69 22.335 28.615000000000002 27.415 21.634999999999998 70-74 22.830000000000002 27.935 27.884999999999998 21.349999999999998 75-79 22.66 27.584999999999997 28.155 21.6 80-84 22.755 28.235 27.415 21.595 85-89 23.275000000000002 27.755000000000003 28.04 20.93 90-94 23.765 27.810000000000002 27.455000000000002 20.97 95-99 23.76 27.87 27.625 20.745 100-104 23.395 27.894999999999996 27.555000000000003 21.154999999999998 105-109 23.685000000000002 28.64 27.229999999999997 20.445 110-114 23.805 28.194999999999997 27.515 20.485 115-119 23.59 27.700000000000003 27.675 21.035 120-124 23.695 28.07 27.615000000000002 20.62 125-129 22.91 28.139999999999997 27.85 21.099999999999998 130-134 23.93 28.67 27.075 20.325 135-139 23.080000000000002 27.71 27.889999999999997 21.32 140-144 23.724999999999998 27.595 27.755000000000003 20.925 145-149 23.185 27.73 28.060000000000002 21.025 150 21.775 28.65 28.7 20.875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.5 15 1.0 16 0.5 17 0.0 18 1.5 19 2.5 20 2.0 21 1.0 22 0.5 23 1.0 24 1.5 25 2.5 26 6.0 27 9.0 28 11.5 29 15.5 30 22.5 31 25.0 32 30.5 33 50.5 34 66.0 35 76.0 36 87.0 37 121.0 38 157.0 39 186.0 40 210.5 41 217.0 42 238.5 43 266.0 44 275.5 45 264.5 46 255.5 47 239.0 48 210.0 49 187.5 50 161.5 51 132.5 52 101.0 53 74.0 54 62.0 55 53.5 56 39.5 57 28.5 58 23.5 59 17.5 60 12.5 61 10.0 62 6.0 63 4.0 64 6.0 65 5.5 66 4.0 67 4.0 68 2.5 69 2.0 70 1.0 71 0.0 72 1.0 73 1.5 74 1.0 75 0.5 76 0.0 77 0.5 78 0.5 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.27499999999999997 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.25 #Duplication Level Percentage of deduplicated Percentage of total 1 96.28571428571429 92.675 2 3.5844155844155843 6.9 3 0.07792207792207792 0.22499999999999998 4 0.05194805194805195 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.025 0.0 26-27 0.0 0.0 0.0 0.025 0.0 28-29 0.025 0.0 0.0 0.025 0.0 30-31 0.025 0.0 0.0 0.025 0.0 32-33 0.025 0.0 0.0 0.025 0.0 34-35 0.025 0.0 0.0 0.025 0.0 36-37 0.025 0.0 0.0 0.025 0.0 38-39 0.025 0.0 0.0 0.025 0.0 40-41 0.025 0.0 0.0 0.025 0.0 42-43 0.025 0.0 0.0 0.025 0.0 44-45 0.025 0.0 0.0 0.025 0.0 46-47 0.025 0.0 0.0 0.025 0.0 48-49 0.025 0.0 0.0 0.025 0.0 50-51 0.025 0.0 0.0 0.025 0.0 52-53 0.025 0.0 0.0 0.025 0.0 54-55 0.025 0.0 0.0 0.025 0.0 56-57 0.025 0.0 0.0 0.025 0.0 58-59 0.025 0.0 0.0 0.025 0.0 60-61 0.037500000000000006 0.0 0.0 0.025 0.0 62-63 0.05 0.0 0.0 0.025 0.0 64-65 0.05 0.0 0.0 0.025 0.0 66-67 0.05 0.0 0.0 0.025 0.0 68-69 0.05 0.0 0.0 0.025 0.0 70-71 0.05 0.0 0.0 0.025 0.0 72-73 0.05 0.0 0.0 0.025 0.0 74-75 0.05 0.0 0.0 0.025 0.0 76-77 0.05 0.0 0.0 0.025 0.0 78-79 0.05 0.0 0.0 0.025 0.0 80-81 0.05 0.0 0.0 0.025 0.0 82-83 0.05 0.0 0.0 0.025 0.0 84-85 0.05 0.0 0.0 0.025 0.0 86-87 0.05 0.0 0.0 0.025 0.0 88-89 0.0625 0.0 0.0 0.025 0.0 90-91 0.125 0.0 0.0 0.025 0.0 92-93 0.125 0.0 0.0 0.025 0.0 94-95 0.125 0.0 0.0 0.025 0.0 96-97 0.1375 0.0 0.0 0.025 0.0 98-99 0.15 0.0 0.0 0.025 0.0 100-101 0.175 0.0 0.0 0.025 0.0 102-103 0.2 0.0 0.0 0.025 0.0 104-105 0.2 0.0 0.0 0.025 0.0 106-107 0.2 0.0 0.0 0.025 0.0 108-109 0.225 0.0 0.0 0.025 0.0 110-111 0.225 0.0 0.0 0.025 0.0 112-113 0.2625 0.0 0.0 0.025 0.0 114-115 0.275 0.0 0.0 0.025 0.0 116-117 0.275 0.0 0.0 0.025 0.0 118-119 0.275 0.0 0.0 0.025 0.0 120-121 0.275 0.0 0.0 0.025 0.0 122-123 0.3 0.0 0.0 0.025 0.0 124-125 0.3 0.0 0.0 0.025 0.0 126-127 0.3 0.0 0.0 0.025 0.0 128-129 0.325 0.0 0.0 0.025 0.0 130-131 0.325 0.0 0.0 0.025 0.0 132-133 0.325 0.0 0.0 0.025 0.0 134-135 0.325 0.0 0.0 0.025 0.0 136-137 0.3375 0.0 0.0 0.025 0.0 138 0.375 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1176550 spots for SRR14639613.sra Written 1176550 spots for SRR14639613.sra Read 1176550 spots for SRR14639613.sra Written 1176550 spots for SRR14639613.sra Read 1176550 spots for SRR14639613.sra Written 1176550 spots for SRR14639613.sra Read 1176550 spots for SRR14639613.sra Written 1176550 spots for SRR14639613.sra Read 1176550 spots for SRR14639613.sra Written 1176550 spots for SRR14639613.sra Read 1176550 spots for SRR14639613.sra Written 1176550 spots for SRR14639613.sra Read 1176550 spots for SRR14639613.sra Written 1176550 spots for SRR14639613.sra Read 1176550 spots for SRR14639613.sra Written 1176550 spots for SRR14639613.sra Read 1176550 spots for SRR14639613.sra Written 1176550 spots for SRR14639613.sra Read 1176550 spots for SRR14639613.sra Written 1176550 spots for SRR14639613.sra Read 1176550 spots for SRR14639613.sra Written 1176550 spots for SRR14639613.sra Read 1176550 spots for SRR14639613.sra Written 1176550 spots for SRR14639613.sra Read 1176550 spots for SRR14639613.sra Written 1176550 spots for SRR14639613.sra Read 1176550 spots for SRR14639613.sra Written 1176550 spots for SRR14639613.sra Read 1176550 spots for SRR14639613.sra Written 1176550 spots for SRR14639613.sra Read 1176550 spots for SRR14639613.sra Written 1176550 spots for SRR14639613.sra Read 1176550 spots for SRR14639613.sra Written 1176550 spots for SRR14639613.sra Read 1176550 spots for SRR14639613.sra Written 1176550 spots for SRR14639613.sra Read 1176553 spots for SRR14639613.sra Written 1176553 spots for SRR14639613.sra Read 1176550 spots for SRR14639613.sra Written 1176550 spots for SRR14639613.sra SRR ids: ['SRR14639613.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_9f9t9u6k SRR14639613.sra spots: 23531003 blocks: [[1, 1176550], [1176551, 2353100], [2353101, 3529650], [3529651, 4706200], [4706201, 5882750], [5882751, 7059300], [7059301, 8235850], [8235851, 9412400], [9412401, 10588950], [10588951, 11765500], [11765501, 12942050], [12942051, 14118600], [14118601, 15295150], [15295151, 16471700], [16471701, 17648250], [17648251, 18824800], [18824801, 20001350], [20001351, 21177900], [21177901, 22354450], [22354451, 23531003]] SRR14639613 file size 8710616 SRR14639613 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR14639613 SRR14639613_1.fastq SRR14639613_2.fastq Input file: SRR14639613_1.fastq Paired file: SRR14639613_2.fastq trimmed: SRR14639613-trimmed-pair1.fastq, SRR14639613-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 13:17:14 2025 >> started Mon Feb 10 13:17:53 2025 >> done (38.963s) 23531003 read pairs processed; of these: 76 ( 0.00%) short read pairs filtered out after trimming by size control 124 ( 0.00%) empty read pairs filtered out after trimming by size control 23530803 (100.00%) read pairs available; of these: 573029 ( 2.44%) trimmed read pairs available after processing 22957774 (97.56%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 14 0.00% 19 12 0.00% 20 12 0.00% 21 17 0.00% 22 19 0.00% 23 17 0.00% 24 24 0.00% 25 33 0.00% 26 24 0.00% 27 25 0.00% 28 31 0.00% 29 32 0.00% 30 29 0.00% 31 35 0.00% 32 31 0.00% 33 47 0.00% 34 42 0.00% 35 36 0.00% 36 54 0.00% 37 46 0.00% 38 75 0.00% 39 36 0.00% 40 58 0.00% 41 54 0.00% 42 66 0.00% 43 65 0.00% 44 60 0.00% 45 61 0.00% 46 74 0.00% 47 70 0.00% 48 91 0.00% 49 115 0.00% 50 107 0.00% 51 99 0.00% 52 96 0.00% 53 113 0.00% 54 122 0.00% 55 122 0.00% 56 131 0.00% 57 131 0.00% 58 137 0.00% 59 128 0.00% 60 153 0.00% 61 153 0.00% 62 172 0.00% 63 157 0.00% 64 155 0.00% 65 159 0.00% 66 193 0.00% 67 204 0.00% 68 227 0.00% 69 208 0.00% 70 217 0.00% 71 232 0.00% 72 232 0.00% 73 257 0.00% 74 262 0.00% 75 251 0.00% 76 280 0.00% 77 314 0.00% 78 337 0.00% 79 363 0.00% 80 339 0.00% 81 415 0.00% 82 400 0.00% 83 450 0.00% 84 442 0.00% 85 468 0.00% 86 447 0.00% 87 496 0.00% 88 530 0.00% 89 608 0.00% 90 550 0.00% 91 620 0.00% 92 639 0.00% 93 681 0.00% 94 787 0.00% 95 765 0.00% 96 771 0.00% 97 853 0.00% 98 877 0.00% 99 913 0.00% 100 966 0.00% 101 951 0.00% 102 1067 0.00% 103 1123 0.00% 104 1147 0.00% 105 1248 0.01% 106 1333 0.01% 107 1416 0.01% 108 1404 0.01% 109 1450 0.01% 110 1605 0.01% 111 1680 0.01% 112 1718 0.01% 113 1783 0.01% 114 1932 0.01% 115 2022 0.01% 116 2022 0.01% 117 2171 0.01% 118 2288 0.01% 119 2535 0.01% 120 2528 0.01% 121 2669 0.01% 122 2764 0.01% 123 2863 0.01% 124 3108 0.01% 125 3226 0.01% 126 3416 0.01% 127 3493 0.01% 128 3639 0.02% 129 3841 0.02% 130 3927 0.02% 131 4073 0.02% 132 4206 0.02% 133 4368 0.02% 134 4483 0.02% 135 4764 0.02% 136 4850 0.02% 137 5083 0.02% 138 5416 0.02% 139 5485 0.02% 140 5799 0.02% 141 6133 0.03% 142 6347 0.03% 143 6492 0.03% 144 6598 0.03% 145 7213 0.03% 146 7937 0.03% 147 11285 0.05% 148 29893 0.13% 149 356101 1.51% 150 22957774 97.56% 23530803 reads passed initial QC criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=3.80 fanout-score-rank=14 prefix-density=0.31 prefix-fanout=3.1 sequence=GTTTTCTCATTTGCA criterion=fanout-score sequence-density=0.08 sequence-density-rank=19 fanout-score=18.40 fanout-score-rank=1 prefix-density=0.53 prefix-fanout=2.7 sequence=TTCTCAGCACCGAAGTCCATCTCAGACC criterion=sequence-density sequence-density=0.36 sequence-density-rank=1 fanout-score=4.77 fanout-score-rank=13 prefix-density=0.49 prefix-fanout=3.5 sequence=CTGCAAATGTGG criterion=fanout-score sequence-density=0.09 sequence-density-rank=19 fanout-score=76.91 fanout-score-rank=1 prefix-density=0.33 prefix-fanout=20.7 sequence=TCAAGAAAATGG SRR14639613 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 13:18:44 Started mapping on | Feb 10 13:18:44 Finished on | Feb 10 13:23:02 Mapping speed, Million of reads per hour | 328.34 Number of input reads | 23530803 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 20896687 Uniquely mapped reads % | 88.81% Average mapped length | 296.89 Number of splices: Total | 18149379 Number of splices: Annotated (sjdb) | 17756161 Number of splices: GT/AG | 17844419 Number of splices: GC/AG | 230105 Number of splices: AT/AC | 16347 Number of splices: Non-canonical | 58508 Mismatch rate per base, % | 0.60% Deletion rate per base | 0.03% Deletion average length | 3.01 Insertion rate per base | 0.02% Insertion average length | 2.60 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 604261 % of reads mapped to multiple loci | 2.57% Number of reads mapped to too many loci | 39934 % of reads mapped to too many loci | 0.17% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 8.33% % of reads unmapped: other | 0.13% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2029855 2029855 2029855 N_multimapping 604261 604261 604261 N_noFeature 713089 20711250 793702 N_ambiguous 258104 1280 152605 UnstrandedReadsAssigned:19925494 PositiveStrandReadsAssigned:184157 NegativeStrandReadsAssigned:19950380 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR14639613 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR14639613-trimmed-pair1.fastq SRR14639613-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,530,803 reads, 20,501,661 reads pseudoaligned [quant] estimated average fragment length: 362.781 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,135 rounds 52401 SRR14639613.ke.tsv 34699 SRR14639613.se.tsv 87100 total ==> SRR14639613.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1656.22 3842 103.776 Potri.005G024800.1.v4.1 1035 673.219 501 33.2919 Potri.004G059700.1.v4.1 961 599.929 175 13.0496 Potri.007G009000.2.v4.1 1416 1054.22 0 0 Potri.003G141000.2.v4.1 2943 2581.22 1146.46 19.8698 Potri.016G087400.1.v4.1 270 52.5063 1152.73 982.141 Potri.015G069301.1.v4.1 564 238.71 0 0 Potri.010G195200.1.v4.1 1773 1411.22 102 3.23343 Potri.012G127500.1.v4.1 977 615.604 2425 176.225 ==> SRR14639613.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 105 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 312 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 13 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 381 SRR14639613 completed mapping pipeline successfully