Starting /dee2/code/volunteer_pipeline.sh SRR14639614 current disk space = 3058899664896 free memory = 1216712392 SRR14639614 SRAfilesize 1815677d1de63081ce901fab3f3cd6d2 SRR14639614.sra SRR14639614.sra file validated SRR14639614 is paired end SRR14639614 is conventional basespace SRR14639614 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14639614_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.6225 32.0 32.0 32.0 32.0 32.0 2 31.4775 32.0 32.0 32.0 32.0 32.0 3 35.1325 37.0 32.0 37.0 32.0 37.0 4 36.11 37.0 37.0 37.0 32.0 37.0 5 36.305 37.0 37.0 37.0 37.0 37.0 6 39.78225 41.0 41.0 41.0 37.0 41.0 7 39.7655 41.0 41.0 41.0 37.0 41.0 8 39.95275 41.0 41.0 41.0 37.0 41.0 9 40.0635 41.0 41.0 41.0 37.0 41.0 10-14 40.117599999999996 41.0 41.0 41.0 37.0 41.0 15-19 40.133799999999994 41.0 41.0 41.0 37.0 41.0 20-24 40.1707 41.0 41.0 41.0 37.0 41.0 25-29 40.09094999999999 41.0 41.0 41.0 37.0 41.0 30-34 40.075450000000004 41.0 41.0 41.0 37.0 41.0 35-39 40.01275 41.0 41.0 41.0 37.0 41.0 40-44 39.99105 41.0 41.0 41.0 37.0 41.0 45-49 39.90585 41.0 41.0 41.0 37.0 41.0 50-54 39.87175 41.0 41.0 41.0 37.0 41.0 55-59 39.7895 41.0 41.0 41.0 37.0 41.0 60-64 39.70989999999999 41.0 41.0 41.0 37.0 41.0 65-69 39.6171 41.0 41.0 41.0 37.0 41.0 70-74 39.388 41.0 41.0 41.0 37.0 41.0 75-79 38.93485 41.0 40.2 41.0 35.0 41.0 80-84 39.440799999999996 41.0 41.0 41.0 37.0 41.0 85-89 39.422450000000005 41.0 41.0 41.0 37.0 41.0 90-94 39.376599999999996 41.0 41.0 41.0 37.0 41.0 95-99 39.2949 41.0 41.0 41.0 37.0 41.0 100-104 39.21485 41.0 41.0 41.0 37.0 41.0 105-109 39.0929 41.0 41.0 41.0 37.0 41.0 110-114 39.09955000000001 41.0 41.0 41.0 37.0 41.0 115-119 39.068000000000005 41.0 41.0 41.0 36.0 41.0 120-124 39.067350000000005 41.0 41.0 41.0 36.0 41.0 125-129 39.0692 41.0 41.0 41.0 36.0 41.0 130-134 38.7702 41.0 41.0 41.0 32.0 41.0 135-139 38.55665 41.0 41.0 41.0 32.0 41.0 140-144 38.285849999999996 41.0 37.8 41.0 32.0 41.0 145-149 38.01655 41.0 37.0 41.0 32.0 41.0 150 37.881 41.0 37.0 41.0 32.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 2.0 20 0.0 21 3.0 22 2.0 23 3.0 24 1.0 25 5.0 26 5.0 27 19.0 28 11.0 29 29.0 30 24.0 31 40.0 32 42.0 33 44.0 34 79.0 35 96.0 36 105.0 37 146.0 38 286.0 39 563.0 40 2495.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.03575893973493 12.603150787696924 11.252813203300825 33.10827706926732 2 17.025000000000002 13.475000000000001 39.900000000000006 29.599999999999998 3 18.425 19.325 30.125 32.125 4 23.599999999999998 25.724999999999998 23.75 26.924999999999997 5 23.575 31.900000000000002 26.3 18.224999999999998 6 17.75 33.875 27.85 20.525 7 14.274999999999999 26.200000000000003 40.9 18.625 8 14.299999999999999 24.675 37.375 23.65 9 15.875 24.875 36.825 22.425 10-14 19.66 29.465000000000003 28.155 22.720000000000002 15-19 19.905 27.965 28.625 23.505000000000003 20-24 20.005 28.43 27.79 23.775 25-29 19.509999999999998 28.975 28.115000000000002 23.400000000000002 30-34 19.79 29.005 27.584999999999997 23.62 35-39 19.915 28.139999999999997 27.439999999999998 24.505 40-44 19.950000000000003 28.305000000000003 28.315 23.43 45-49 20.11 28.134999999999998 27.85 23.905 50-54 19.535 28.575 28.01 23.880000000000003 55-59 20.544999999999998 28.17 27.02 24.265 60-64 20.495 28.49 27.43 23.585 65-69 20.385 27.96 27.715 23.94 70-74 20.28 27.675 28.01 24.035 75-79 20.78 27.944999999999997 27.685 23.59 80-84 20.044999999999998 28.42 27.779999999999998 23.755000000000003 85-89 20.605 27.855 27.97 23.57 90-94 20.75 27.865000000000002 27.935 23.45 95-99 20.580000000000002 28.34 27.384999999999998 23.695 100-104 20.155 28.065 27.99 23.79 105-109 20.34 28.875 27.029999999999998 23.755000000000003 110-114 21.115000000000002 27.900000000000002 27.450000000000003 23.535 115-119 20.645 28.585 26.724999999999998 24.044999999999998 120-124 20.465 28.384999999999998 27.63 23.52 125-129 20.380000000000003 27.715 27.55 24.355 130-134 20.79 28.02 27.355 23.835 135-139 21.45 27.88 26.88 23.79 140-144 20.7810390519526 27.59637981899095 28.271413570678533 23.35116755837792 145-149 20.974999999999998 28.725 27.279999999999998 23.02 150 20.674999999999997 26.35 27.224999999999998 25.75 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 1.0 5 0.5 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.5 15 1.0 16 0.0 17 0.5 18 1.0 19 1.0 20 0.5 21 0.5 22 1.0 23 1.5 24 3.5 25 7.0 26 7.5 27 8.0 28 11.5 29 14.5 30 19.5 31 29.5 32 40.0 33 40.0 34 49.5 35 80.5 36 90.5 37 103.0 38 138.5 39 164.0 40 178.5 41 213.5 42 254.5 43 282.0 44 288.5 45 260.5 46 238.0 47 232.5 48 214.0 49 186.5 50 154.0 51 117.5 52 98.5 53 94.0 54 85.5 55 62.5 56 46.5 57 44.0 58 42.0 59 30.0 60 14.5 61 12.0 62 10.0 63 5.5 64 5.0 65 4.0 66 2.5 67 0.5 68 2.0 69 2.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.005 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.525 #Duplication Level Percentage of deduplicated Percentage of total 1 95.5509029049987 91.27499999999999 2 4.213556660560063 8.05 3 0.23554043444124576 0.675 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.025 0.0 0.0 0.0 0.0 100-101 0.025 0.0 0.0 0.0 0.0 102-103 0.037500000000000006 0.0 0.0 0.0 0.0 104-105 0.05 0.0 0.0 0.0 0.0 106-107 0.05 0.0 0.0 0.0 0.0 108-109 0.0625 0.0 0.0 0.0 0.0 110-111 0.075 0.0 0.0 0.0 0.0 112-113 0.075 0.0 0.0 0.0 0.0 114-115 0.0875 0.0 0.0 0.0 0.0 116-117 0.1 0.0 0.0 0.0 0.0 118-119 0.1125 0.0 0.0 0.0 0.0 120-121 0.15 0.0 0.0 0.0 0.0 122-123 0.1875 0.0 0.0 0.0 0.0 124-125 0.2 0.0 0.0 0.0 0.0 126-127 0.2 0.0 0.0 0.0 0.0 128-129 0.21250000000000002 0.0 0.0 0.0 0.0 130-131 0.25 0.0 0.0 0.0 0.0 132-133 0.32499999999999996 0.0 0.0 0.0 0.0 134-135 0.4 0.0 0.0 0.0 0.0 136-137 0.425 0.0 0.0 0.0 0.0 138 0.475 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR14639614 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14639614_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.6825 32.0 32.0 32.0 32.0 32.0 2 30.345 32.0 32.0 32.0 27.0 32.0 3 33.44 37.0 32.0 37.0 27.0 37.0 4 34.435 37.0 37.0 37.0 32.0 37.0 5 34.85 37.0 37.0 37.0 32.0 37.0 6 37.8215 41.0 37.0 41.0 32.0 41.0 7 37.607 41.0 37.0 41.0 32.0 41.0 8 37.76025 41.0 37.0 41.0 27.0 41.0 9 38.0205 41.0 37.0 41.0 27.0 41.0 10-14 37.99665 41.0 40.2 41.0 28.0 41.0 15-19 37.922700000000006 41.0 39.4 41.0 28.0 41.0 20-24 37.80625 41.0 37.8 41.0 27.0 41.0 25-29 37.3335 41.0 37.0 41.0 26.0 41.0 30-34 37.33855 41.0 37.0 41.0 27.0 41.0 35-39 37.302800000000005 41.0 37.0 41.0 27.0 41.0 40-44 37.1445 41.0 37.0 41.0 27.0 41.0 45-49 36.9367 41.0 37.0 41.0 26.0 41.0 50-54 36.748000000000005 41.0 37.0 41.0 23.0 41.0 55-59 36.769450000000006 41.0 37.0 41.0 22.0 41.0 60-64 36.7351 41.0 37.0 41.0 24.0 41.0 65-69 36.52675000000001 41.0 37.0 41.0 22.0 41.0 70-74 36.249700000000004 41.0 37.0 41.0 22.0 41.0 75-79 35.38955 40.2 34.0 41.0 22.0 41.0 80-84 36.3423 41.0 37.0 41.0 22.0 41.0 85-89 36.415499999999994 41.0 37.0 41.0 22.0 41.0 90-94 36.1683 41.0 37.0 41.0 22.0 41.0 95-99 36.1991 41.0 37.0 41.0 22.0 41.0 100-104 35.972350000000006 41.0 36.0 41.0 20.0 41.0 105-109 35.9388 41.0 37.0 41.0 22.0 41.0 110-114 35.771100000000004 41.0 36.0 41.0 22.0 41.0 115-119 35.45845 41.0 33.0 41.0 20.0 41.0 120-124 35.49555 41.0 33.0 41.0 20.0 41.0 125-129 34.9833 41.0 32.0 41.0 18.0 41.0 130-134 35.005 41.0 32.0 41.0 18.0 41.0 135-139 34.532300000000006 41.0 31.0 41.0 14.0 41.0 140-144 34.3381 41.0 32.0 41.0 12.0 41.0 145-149 34.126149999999996 40.2 31.0 41.0 12.0 41.0 150 33.646 37.0 27.0 41.0 12.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 5.0 15 5.0 16 13.0 17 26.0 18 27.0 19 32.0 20 34.0 21 44.0 22 40.0 23 46.0 24 54.0 25 51.0 26 55.0 27 78.0 28 70.0 29 75.0 30 71.0 31 79.0 32 98.0 33 106.0 34 139.0 35 141.0 36 158.0 37 213.0 38 327.0 39 525.0 40 1487.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.691767068273094 25.40160642570281 9.33734939759036 23.569277108433734 2 18.7 28.299999999999997 37.075 15.925 3 18.15 27.05 34.449999999999996 20.349999999999998 4 24.525 32.975 21.75 20.75 5 22.875 39.15 22.85 15.125 6 19.575 37.175000000000004 24.4 18.85 7 19.075 23.200000000000003 37.55 20.175 8 17.75 22.95 32.800000000000004 26.5 9 19.7 25.525 29.849999999999998 24.925 10-14 23.1 28.634999999999998 26.415 21.85 15-19 22.695 28.095 27.694999999999997 21.515 20-24 21.68 28.175 27.975 22.17 25-29 22.585 28.365000000000002 27.62 21.43 30-34 22.955000000000002 28.1 27.05 21.895 35-39 22.795 27.41 27.565 22.23 40-44 22.89 27.175 28.01 21.925 45-49 22.759999999999998 27.76 27.634999999999998 21.845 50-54 22.78 27.72 27.884999999999998 21.615000000000002 55-59 23.185 27.6 27.77 21.445 60-64 22.814999999999998 27.525 27.650000000000002 22.009999999999998 65-69 22.66 27.105 28.215 22.02 70-74 23.26 27.715 27.389999999999997 21.634999999999998 75-79 23.474999999999998 26.779999999999998 27.61 22.134999999999998 80-84 23.515 27.650000000000002 27.165 21.67 85-89 23.31 28.465 27.24 20.985 90-94 23.525 27.83 27.284999999999997 21.36 95-99 23.41 27.33 27.77 21.490000000000002 100-104 23.715 27.125 27.12 22.040000000000003 105-109 23.1 27.439999999999998 27.51 21.95 110-114 22.770000000000003 27.860000000000003 27.584999999999997 21.785 115-119 23.71 27.6 26.645000000000003 22.045 120-124 23.5 27.32 27.41 21.77 125-129 23.51 26.87 27.575 22.045 130-134 23.61 27.295 27.750000000000004 21.345 135-139 23.615 26.955000000000002 27.6 21.83 140-144 23.119999999999997 27.36 27.134999999999998 22.384999999999998 145-149 23.085 27.800000000000004 27.16 21.955 150 23.3 27.6 28.000000000000004 21.099999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.5 16 1.5 17 0.5 18 0.5 19 0.5 20 2.0 21 2.5 22 2.0 23 3.0 24 2.5 25 3.0 26 5.5 27 8.5 28 11.5 29 13.5 30 17.0 31 27.0 32 32.5 33 39.0 34 50.0 35 70.0 36 91.5 37 111.5 38 132.0 39 159.0 40 181.0 41 200.0 42 239.5 43 262.0 44 257.0 45 252.0 46 243.0 47 219.5 48 201.0 49 183.5 50 155.5 51 137.0 52 121.5 53 105.5 54 86.0 55 64.0 56 65.5 57 60.0 58 42.0 59 34.5 60 28.0 61 21.0 62 12.5 63 9.5 64 9.0 65 5.0 66 3.5 67 3.0 68 2.5 69 1.5 70 1.5 71 0.5 72 0.5 73 1.0 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.5 96 0.5 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.4 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.6 #Duplication Level Percentage of deduplicated Percentage of total 1 96.63561076604555 93.35 2 3.2091097308488616 6.2 3 0.15527950310559005 0.44999999999999996 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.025 0.0 0.0 0.0 0.0 100-101 0.025 0.0 0.0 0.0 0.0 102-103 0.025 0.0 0.0 0.0 0.0 104-105 0.025 0.0 0.0 0.0 0.0 106-107 0.025 0.0 0.0 0.0 0.0 108-109 0.037500000000000006 0.0 0.0 0.0 0.0 110-111 0.05 0.0 0.0 0.0 0.0 112-113 0.05 0.0 0.0 0.0 0.0 114-115 0.0625 0.0 0.0 0.0 0.0 116-117 0.075 0.0 0.0 0.0 0.0 118-119 0.0875 0.0 0.0 0.0 0.0 120-121 0.1 0.0 0.0 0.0 0.0 122-123 0.125 0.0 0.0 0.0 0.0 124-125 0.15 0.0 0.0 0.0 0.0 126-127 0.15 0.0 0.0 0.0 0.0 128-129 0.15 0.0 0.0 0.0 0.0 130-131 0.16249999999999998 0.0 0.0 0.0 0.0 132-133 0.225 0.0 0.0 0.0 0.0 134-135 0.275 0.0 0.0 0.0 0.0 136-137 0.3 0.0 0.0 0.0 0.0 138 0.375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAGTCAA 10 0.006973645 144.0 5 >>END_MODULE Read 1089318 spots for SRR14639614.sra Written 1089318 spots for SRR14639614.sra Read 1089318 spots for SRR14639614.sra Written 1089318 spots for SRR14639614.sra Read 1089318 spots for SRR14639614.sra Written 1089318 spots for SRR14639614.sra Read 1089318 spots for SRR14639614.sra Written 1089318 spots for SRR14639614.sra Read 1089318 spots for SRR14639614.sra Written 1089318 spots for SRR14639614.sra Read 1089318 spots for SRR14639614.sra Written 1089318 spots for SRR14639614.sra Read 1089318 spots for SRR14639614.sra Written 1089318 spots for SRR14639614.sra Read 1089318 spots for SRR14639614.sra Written 1089318 spots for SRR14639614.sra Read 1089318 spots for SRR14639614.sra Written 1089318 spots for SRR14639614.sra Read 1089318 spots for SRR14639614.sra Written 1089318 spots for SRR14639614.sra Read 1089318 spots for SRR14639614.sra Written 1089318 spots for SRR14639614.sra Read 1089318 spots for SRR14639614.sra Written 1089318 spots for SRR14639614.sra Read 1089318 spots for SRR14639614.sra Written 1089318 spots for SRR14639614.sra Read 1089318 spots for SRR14639614.sra Written 1089318 spots for SRR14639614.sra Read 1089318 spots for SRR14639614.sra Written 1089318 spots for SRR14639614.sra Read 1089318 spots for SRR14639614.sra Written 1089318 spots for SRR14639614.sra Read 1089318 spots for SRR14639614.sra Written 1089318 spots for SRR14639614.sra Read 1089318 spots for SRR14639614.sra Written 1089318 spots for SRR14639614.sra Read 1089318 spots for SRR14639614.sra Written 1089318 spots for SRR14639614.sra Read 1089322 spots for SRR14639614.sra Written 1089322 spots for SRR14639614.sra SRR ids: ['SRR14639614.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_0azsrk22 SRR14639614.sra spots: 21786364 blocks: [[1, 1089318], [1089319, 2178636], [2178637, 3267954], [3267955, 4357272], [4357273, 5446590], [5446591, 6535908], [6535909, 7625226], [7625227, 8714544], [8714545, 9803862], [9803863, 10893180], [10893181, 11982498], [11982499, 13071816], [13071817, 14161134], [14161135, 15250452], [15250453, 16339770], [16339771, 17429088], [17429089, 18518406], [18518407, 19607724], [19607725, 20697042], [20697043, 21786364]] SRR14639614 file size 8064042 SRR14639614 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR14639614 SRR14639614_1.fastq SRR14639614_2.fastq Input file: SRR14639614_1.fastq Paired file: SRR14639614_2.fastq trimmed: SRR14639614-trimmed-pair1.fastq, SRR14639614-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 13:18:26 2025 >> started Mon Feb 10 13:18:59 2025 >> done (32.950s) 21786364 read pairs processed; of these: 101 ( 0.00%) short read pairs filtered out after trimming by size control 155 ( 0.00%) empty read pairs filtered out after trimming by size control 21786108 (100.00%) read pairs available; of these: 681509 ( 3.13%) trimmed read pairs available after processing 21104599 (96.87%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 17 0.00% 19 24 0.00% 20 21 0.00% 21 19 0.00% 22 22 0.00% 23 22 0.00% 24 29 0.00% 25 39 0.00% 26 23 0.00% 27 37 0.00% 28 42 0.00% 29 34 0.00% 30 33 0.00% 31 32 0.00% 32 42 0.00% 33 37 0.00% 34 47 0.00% 35 43 0.00% 36 32 0.00% 37 49 0.00% 38 71 0.00% 39 52 0.00% 40 54 0.00% 41 40 0.00% 42 55 0.00% 43 60 0.00% 44 61 0.00% 45 68 0.00% 46 76 0.00% 47 66 0.00% 48 52 0.00% 49 81 0.00% 50 79 0.00% 51 84 0.00% 52 65 0.00% 53 71 0.00% 54 88 0.00% 55 96 0.00% 56 102 0.00% 57 98 0.00% 58 89 0.00% 59 103 0.00% 60 119 0.00% 61 111 0.00% 62 109 0.00% 63 104 0.00% 64 120 0.00% 65 126 0.00% 66 132 0.00% 67 146 0.00% 68 142 0.00% 69 132 0.00% 70 175 0.00% 71 183 0.00% 72 152 0.00% 73 189 0.00% 74 189 0.00% 75 217 0.00% 76 221 0.00% 77 206 0.00% 78 234 0.00% 79 244 0.00% 80 252 0.00% 81 261 0.00% 82 280 0.00% 83 319 0.00% 84 302 0.00% 85 360 0.00% 86 325 0.00% 87 364 0.00% 88 405 0.00% 89 451 0.00% 90 453 0.00% 91 445 0.00% 92 492 0.00% 93 588 0.00% 94 579 0.00% 95 581 0.00% 96 623 0.00% 97 656 0.00% 98 719 0.00% 99 803 0.00% 100 859 0.00% 101 848 0.00% 102 949 0.00% 103 1030 0.00% 104 1107 0.01% 105 1193 0.01% 106 1306 0.01% 107 1368 0.01% 108 1368 0.01% 109 1491 0.01% 110 1669 0.01% 111 1755 0.01% 112 1796 0.01% 113 1965 0.01% 114 2131 0.01% 115 2185 0.01% 116 2382 0.01% 117 2632 0.01% 118 2832 0.01% 119 2922 0.01% 120 3200 0.01% 121 3260 0.01% 122 3595 0.02% 123 3820 0.02% 124 4136 0.02% 125 4321 0.02% 126 4469 0.02% 127 4868 0.02% 128 5053 0.02% 129 5420 0.02% 130 5883 0.03% 131 6054 0.03% 132 6030 0.03% 133 6506 0.03% 134 6694 0.03% 135 7224 0.03% 136 7448 0.03% 137 7801 0.04% 138 8392 0.04% 139 8787 0.04% 140 9345 0.04% 141 9481 0.04% 142 10155 0.05% 143 10794 0.05% 144 11167 0.05% 145 11792 0.05% 146 13247 0.06% 147 17358 0.08% 148 40273 0.18% 149 386384 1.77% 150 21104599 96.87% 21786108 reads passed initial QC criterion=sequence-density sequence-density=0.35 sequence-density-rank=1 fanout-score=4.28 fanout-score-rank=10 prefix-density=0.51 prefix-fanout=2.9 sequence=TTGCAGCCATTCTCAGCACCA criterion=fanout-score sequence-density=0.10 sequence-density-rank=11 fanout-score=15.06 fanout-score-rank=1 prefix-density=0.51 prefix-fanout=2.9 sequence=TTGCAGCCACTGCC criterion=sequence-density sequence-density=0.39 sequence-density-rank=1 fanout-score=5.47 fanout-score-rank=10 prefix-density=0.57 prefix-fanout=3.7 sequence=CTGCAAATGTGG criterion=fanout-score sequence-density=0.03 sequence-density-rank=28 fanout-score=54.65 fanout-score-rank=1 prefix-density=0.16 prefix-fanout=11.5 sequence=AAGAAAAACAAAAAAGAAATGGATGCCAAAGCTCTCTTCTTCTTTGCCTTGTTGTCCTTCTCAGCTGTGTCGGTCAGGCCGGCATTAGCAGAAAATGAAGAAGACCCTGGTCTTGTTATGAACTTTTACAAGGATACATGCCCTCAAGCTGAGGACATTGTCAAAGAACAAGTTAGACTCCTTTACAAGAGACACAAAAACACTGCATTTTCTTGGCTAAGAAACATCTTCCATGACTGTGCTGTTCAGTCATGTGATGCTTCACTGCTGCTGGACTCAACAAGGAGGACCTTGTCCGAGAAGGAGACAGACAGGAGCTTTGGCCTCAGGAACTTTAGATACTTTGACGATATCAAAGAAGCTGTTGAAAGAGAGTGTCCTGGAGTCGTTTCCTGTGCTGATATTCTTGTCCTGTCTGCTAGAGATGGCATTGTTTCGCTAGGAGGACCTCATATCCCTCTCAAAACTGGAAGGAGGGATGGCAGGAAGAGCAGAGCAGATGTGATCGAGG SRR14639614 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 13:19:58 Started mapping on | Feb 10 13:19:58 Finished on | Feb 10 13:26:39 Mapping speed, Million of reads per hour | 195.59 Number of input reads | 21786108 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 16880580 Uniquely mapped reads % | 77.48% Average mapped length | 296.98 Number of splices: Total | 14870211 Number of splices: Annotated (sjdb) | 14540386 Number of splices: GT/AG | 14616244 Number of splices: GC/AG | 191874 Number of splices: AT/AC | 13443 Number of splices: Non-canonical | 48650 Mismatch rate per base, % | 0.56% Deletion rate per base | 0.03% Deletion average length | 2.98 Insertion rate per base | 0.02% Insertion average length | 2.59 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 470366 % of reads mapped to multiple loci | 2.16% Number of reads mapped to too many loci | 49823 % of reads mapped to too many loci | 0.23% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 19.96% % of reads unmapped: other | 0.16% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 4435162 4435162 4435162 N_multimapping 470366 470366 470366 N_noFeature 628362 16724133 698940 N_ambiguous 203089 1137 116647 UnstrandedReadsAssigned:16049129 PositiveStrandReadsAssigned:155310 NegativeStrandReadsAssigned:16064993 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR14639614 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR14639614-trimmed-pair1.fastq SRR14639614-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,786,108 reads, 17,020,796 reads pseudoaligned [quant] estimated average fragment length: 335.581 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,108 rounds 52401 SRR14639614.ke.tsv 34699 SRR14639614.se.tsv 87100 total ==> SRR14639614.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1683.42 2562 84.5845 Potri.005G024800.1.v4.1 1035 700.419 190 15.0765 Potri.004G059700.1.v4.1 961 627.105 150 13.294 Potri.007G009000.2.v4.1 1416 1081.42 0 0 Potri.003G141000.2.v4.1 2943 2608.42 865.613 18.4438 Potri.016G087400.1.v4.1 270 59.3081 1039.73 974.341 Potri.015G069301.1.v4.1 564 262.68 0 0 Potri.010G195200.1.v4.1 1773 1438.42 80 3.09107 Potri.012G127500.1.v4.1 977 642.809 2298 198.688 ==> SRR14639614.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 100 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 298 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 8 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 328 SRR14639614 completed mapping pipeline successfully