Starting /dee2/code/volunteer_pipeline.sh SRR14639615 current disk space = 3058913050624 free memory = 1275068612 SRR14639615 SRAfilesize 54155d512588d4262f0ceb5ebc47ffc9 SRR14639615.sra SRR14639615.sra file validated SRR14639615 is paired end SRR14639615 is conventional basespace SRR14639615 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14639615_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.6025 32.0 32.0 32.0 32.0 32.0 2 31.51125 32.0 32.0 32.0 32.0 32.0 3 35.2825 37.0 32.0 37.0 32.0 37.0 4 36.26375 37.0 37.0 37.0 37.0 37.0 5 36.3675 37.0 37.0 37.0 37.0 37.0 6 39.8785 41.0 41.0 41.0 37.0 41.0 7 40.067 41.0 41.0 41.0 37.0 41.0 8 40.18725 41.0 41.0 41.0 37.0 41.0 9 40.2015 41.0 41.0 41.0 37.0 41.0 10-14 40.2632 41.0 41.0 41.0 41.0 41.0 15-19 40.246950000000005 41.0 41.0 41.0 40.2 41.0 20-24 40.26415 41.0 41.0 41.0 41.0 41.0 25-29 40.1842 41.0 41.0 41.0 39.4 41.0 30-34 40.10475 41.0 41.0 41.0 37.8 41.0 35-39 40.0844 41.0 41.0 41.0 37.0 41.0 40-44 40.0241 41.0 41.0 41.0 37.0 41.0 45-49 39.9862 41.0 41.0 41.0 37.0 41.0 50-54 39.9677 41.0 41.0 41.0 37.0 41.0 55-59 39.873650000000005 41.0 41.0 41.0 37.0 41.0 60-64 39.81915 41.0 41.0 41.0 37.0 41.0 65-69 39.71665 41.0 41.0 41.0 37.0 41.0 70-74 39.555800000000005 41.0 41.0 41.0 37.0 41.0 75-79 39.1336 41.0 40.2 41.0 36.0 41.0 80-84 39.542899999999996 41.0 41.0 41.0 37.0 41.0 85-89 39.591249999999995 41.0 41.0 41.0 37.0 41.0 90-94 39.5673 41.0 41.0 41.0 37.0 41.0 95-99 39.4165 41.0 41.0 41.0 37.0 41.0 100-104 39.3375 41.0 41.0 41.0 37.0 41.0 105-109 39.311449999999994 41.0 41.0 41.0 37.0 41.0 110-114 39.1917 41.0 41.0 41.0 37.0 41.0 115-119 39.244800000000005 41.0 41.0 41.0 37.0 41.0 120-124 39.14375 41.0 41.0 41.0 37.0 41.0 125-129 39.163 41.0 41.0 41.0 37.0 41.0 130-134 38.99365 41.0 41.0 41.0 35.0 41.0 135-139 38.58555 41.0 41.0 41.0 32.0 41.0 140-144 38.39155000000001 41.0 41.0 41.0 32.0 41.0 145-149 38.157599999999995 41.0 37.0 41.0 32.0 41.0 150 38.12325 41.0 37.0 41.0 32.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 1.0 22 3.0 23 5.0 24 3.0 25 10.0 26 5.0 27 7.0 28 21.0 29 13.0 30 26.0 31 33.0 32 42.0 33 42.0 34 78.0 35 86.0 36 105.0 37 146.0 38 232.0 39 494.0 40 2647.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.975 14.025000000000002 12.325 36.675000000000004 2 16.375 11.525 42.5 29.599999999999998 3 16.925 19.7 29.575000000000003 33.800000000000004 4 22.375 27.224999999999998 24.9 25.5 5 22.15 32.6 26.1 19.15 6 16.675 34.225 28.625 20.474999999999998 7 13.8 25.924999999999997 42.65 17.625 8 14.274999999999999 24.4 37.325 24.0 9 16.2 25.174999999999997 34.65 23.974999999999998 10-14 19.305 30.18 27.57 22.945 15-19 18.68 29.18 28.134999999999998 24.005000000000003 20-24 19.56 28.549999999999997 28.23 23.66 25-29 19.220000000000002 28.544999999999998 28.65 23.585 30-34 19.61 28.565 27.705000000000002 24.12 35-39 19.78 29.13 27.894999999999996 23.195 40-44 19.61 29.409999999999997 27.725 23.255 45-49 19.11 29.265 28.12 23.505000000000003 50-54 19.5 28.48 27.900000000000002 24.12 55-59 19.64 29.435 27.950000000000003 22.975 60-64 19.545 28.185 27.83 24.44 65-69 19.825 28.68 28.15 23.345 70-74 19.900000000000002 28.9 27.66 23.54 75-79 19.655 28.58 28.38 23.385 80-84 20.105 28.044999999999998 28.410000000000004 23.44 85-89 19.950000000000003 28.355000000000004 28.285 23.41 90-94 19.545 28.360000000000003 28.315 23.78 95-99 19.39 28.165000000000003 28.4 24.044999999999998 100-104 19.525000000000002 28.87 28.405 23.200000000000003 105-109 20.136006800340017 28.50142507125356 27.886394319715986 23.476173808690433 110-114 19.99 28.62 27.925 23.465 115-119 19.59 28.775000000000002 27.72 23.915 120-124 20.09 27.665 27.485 24.759999999999998 125-129 19.814999999999998 28.51 27.865000000000002 23.810000000000002 130-134 19.235 27.93 29.154999999999998 23.68 135-139 20.805 27.85 27.62 23.724999999999998 140-144 20.170042510627656 28.11702925731433 27.671917979494875 24.04101025256314 145-149 20.71 28.565 27.295 23.43 150 20.8 28.275 27.85 23.075000000000003 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.5 5 1.0 6 0.5 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 1.0 18 1.5 19 0.5 20 0.0 21 1.0 22 1.5 23 2.0 24 4.0 25 4.5 26 8.0 27 14.0 28 16.0 29 20.0 30 25.5 31 33.0 32 50.0 33 63.0 34 64.5 35 69.5 36 90.0 37 131.5 38 160.5 39 177.0 40 198.0 41 235.5 42 262.5 43 269.5 44 263.0 45 261.5 46 251.0 47 228.0 48 205.0 49 171.5 50 150.5 51 123.0 52 100.5 53 82.0 54 62.0 55 40.5 56 29.5 57 28.0 58 20.0 59 15.0 60 15.0 61 10.5 62 5.5 63 4.0 64 6.5 65 6.0 66 3.0 67 2.0 68 2.0 69 1.5 70 1.0 71 1.0 72 0.0 73 0.5 74 1.0 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.005 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.025 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.825 #Duplication Level Percentage of deduplicated Percentage of total 1 95.90399165144795 91.9 2 3.8351160970519174 7.35 3 0.2608922515001304 0.75 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.037500000000000006 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.05 0.0 0.0 0.0 0.0 102-103 0.05 0.0 0.0 0.0 0.0 104-105 0.05 0.0 0.0 0.0 0.0 106-107 0.075 0.0 0.0 0.0 0.0 108-109 0.1125 0.0 0.0 0.0 0.0 110-111 0.125 0.0 0.0 0.0 0.0 112-113 0.15 0.0 0.0 0.0 0.0 114-115 0.15 0.0 0.0 0.0 0.0 116-117 0.1875 0.0 0.0 0.0 0.0 118-119 0.225 0.0 0.0 0.0 0.0 120-121 0.275 0.0 0.0 0.0 0.0 122-123 0.3 0.0 0.0 0.0 0.0 124-125 0.375 0.0 0.0 0.0 0.0 126-127 0.375 0.0 0.0 0.0 0.0 128-129 0.3875 0.0 0.0 0.0 0.0 130-131 0.5 0.0 0.0 0.0 0.0 132-133 0.5625 0.0 0.0 0.0 0.0 134-135 0.6375 0.0 0.0 0.0 0.0 136-137 0.675 0.0 0.0 0.0 0.0 138 0.675 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AACCCGA 10 0.006973645 144.0 6 >>END_MODULE SRR14639615 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14639615_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.93125 32.0 32.0 32.0 32.0 32.0 2 30.72 32.0 32.0 32.0 32.0 32.0 3 34.10375 37.0 32.0 37.0 32.0 37.0 4 35.05625 37.0 37.0 37.0 32.0 37.0 5 35.275 37.0 37.0 37.0 32.0 37.0 6 38.531 41.0 41.0 41.0 32.0 41.0 7 38.27925 41.0 41.0 41.0 32.0 41.0 8 38.37225 41.0 41.0 41.0 32.0 41.0 9 38.4755 41.0 41.0 41.0 32.0 41.0 10-14 38.62575 41.0 41.0 41.0 32.0 41.0 15-19 38.461 41.0 41.0 41.0 32.0 41.0 20-24 38.373549999999994 41.0 41.0 41.0 32.0 41.0 25-29 37.986149999999995 41.0 39.4 41.0 29.0 41.0 30-34 37.871849999999995 41.0 38.6 41.0 27.0 41.0 35-39 37.92975 41.0 37.8 41.0 29.0 41.0 40-44 37.766450000000006 41.0 37.0 41.0 27.0 41.0 45-49 37.6522 41.0 37.0 41.0 27.0 41.0 50-54 37.4847 41.0 37.0 41.0 27.0 41.0 55-59 37.55675 41.0 37.0 41.0 27.0 41.0 60-64 37.60435 41.0 37.0 41.0 27.0 41.0 65-69 37.23425 41.0 37.0 41.0 27.0 41.0 70-74 37.020300000000006 41.0 37.0 41.0 26.0 41.0 75-79 36.27295 40.2 36.0 41.0 23.0 41.0 80-84 37.19984999999999 41.0 37.0 41.0 27.0 41.0 85-89 37.220749999999995 41.0 37.0 41.0 26.0 41.0 90-94 36.88015 41.0 37.0 41.0 23.0 41.0 95-99 36.99795 41.0 37.0 41.0 23.0 41.0 100-104 36.75575 41.0 37.0 41.0 24.0 41.0 105-109 36.709500000000006 41.0 37.0 41.0 22.0 41.0 110-114 36.67495 41.0 37.0 41.0 22.0 41.0 115-119 36.40415 41.0 37.0 41.0 22.0 41.0 120-124 36.5801 41.0 37.0 41.0 22.0 41.0 125-129 35.86944999999999 41.0 35.0 41.0 22.0 41.0 130-134 36.0493 41.0 37.0 41.0 22.0 41.0 135-139 35.54595 41.0 35.0 41.0 20.0 41.0 140-144 35.3053 41.0 32.0 41.0 18.0 41.0 145-149 35.2044 41.0 35.0 41.0 18.0 41.0 150 34.774 41.0 32.0 41.0 12.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 2.0 14 3.0 15 3.0 16 5.0 17 11.0 18 30.0 19 33.0 20 20.0 21 24.0 22 29.0 23 28.0 24 39.0 25 39.0 26 46.0 27 40.0 28 55.0 29 61.0 30 78.0 31 93.0 32 97.0 33 106.0 34 109.0 35 132.0 36 151.0 37 215.0 38 329.0 39 535.0 40 1687.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.647353900175574 26.661650363681964 10.835214446952596 24.855781289189867 2 18.75 26.0 39.074999999999996 16.175 3 19.025 25.724999999999998 35.15 20.1 4 23.225 33.050000000000004 23.549999999999997 20.175 5 21.825 39.125 23.1 15.950000000000001 6 18.575 35.975 26.200000000000003 19.25 7 19.400000000000002 23.125 36.75 20.724999999999998 8 17.075000000000003 24.45 32.45 26.025 9 20.200000000000003 25.05 31.65 23.1 10-14 22.845 28.825 27.334999999999997 20.995 15-19 22.335 27.655 28.355000000000004 21.654999999999998 20-24 23.005 28.13 28.000000000000004 20.865000000000002 25-29 22.18 28.310000000000002 28.065 21.445 30-34 22.115000000000002 27.900000000000002 28.48 21.505 35-39 22.33 27.71 28.720000000000002 21.240000000000002 40-44 22.68 27.98 28.23 21.11 45-49 22.595000000000002 27.905 28.310000000000002 21.19 50-54 23.36 27.33 28.084999999999997 21.224999999999998 55-59 22.634999999999998 28.225 27.639999999999997 21.5 60-64 22.695 27.91 28.044999999999998 21.349999999999998 65-69 23.169999999999998 27.55 27.92 21.36 70-74 22.830000000000002 27.875 28.115000000000002 21.18 75-79 22.245 28.16 27.884999999999998 21.709999999999997 80-84 22.61 27.939999999999998 28.015 21.435000000000002 85-89 22.405 27.950000000000003 28.205000000000002 21.44 90-94 23.39 27.715 27.765 21.13 95-99 22.45 28.375 28.565 20.61 100-104 22.725 28.52 27.334999999999997 21.42 105-109 23.205000000000002 27.735 28.12 20.94 110-114 22.595000000000002 28.425 28.199999999999996 20.78 115-119 23.705000000000002 27.405 27.92 20.97 120-124 22.755 28.405 27.589999999999996 21.25 125-129 23.07 27.66 28.12 21.15 130-134 23.385 28.050000000000004 28.225 20.34 135-139 23.605 28.505000000000003 27.334999999999997 20.555 140-144 23.674999999999997 28.675 27.04 20.61 145-149 23.1 28.515 27.29 21.095 150 22.35 28.275 27.950000000000003 21.425 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 1.0 16 0.5 17 0.5 18 2.0 19 2.5 20 0.5 21 0.0 22 0.5 23 3.0 24 5.0 25 4.0 26 4.0 27 6.5 28 7.0 29 9.5 30 15.5 31 24.0 32 38.0 33 50.0 34 57.0 35 82.5 36 108.0 37 133.0 38 147.5 39 167.5 40 203.5 41 235.5 42 258.5 43 262.0 44 256.5 45 264.5 46 256.5 47 224.5 48 214.5 49 198.5 50 159.0 51 116.0 52 94.5 53 77.5 54 63.0 55 57.0 56 41.0 57 28.0 58 26.0 59 19.0 60 13.5 61 15.5 62 11.5 63 6.5 64 5.0 65 4.5 66 4.5 67 2.5 68 3.5 69 2.5 70 1.0 71 0.5 72 0.5 73 0.5 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.5 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.325 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.8 #Duplication Level Percentage of deduplicated Percentage of total 1 96.900826446281 93.8 2 2.918388429752066 5.65 3 0.15495867768595042 0.44999999999999996 4 0.025826446280991736 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.037500000000000006 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.05 0.0 0.0 0.0 0.0 102-103 0.05 0.0 0.0 0.0 0.0 104-105 0.05 0.0 0.0 0.0 0.0 106-107 0.075 0.0 0.0 0.0 0.0 108-109 0.1 0.0 0.0 0.0 0.0 110-111 0.1 0.0 0.0 0.0 0.0 112-113 0.125 0.0 0.0 0.0 0.0 114-115 0.125 0.0 0.0 0.0 0.0 116-117 0.16249999999999998 0.0 0.0 0.0 0.0 118-119 0.225 0.0 0.0 0.0 0.0 120-121 0.275 0.0 0.0 0.0 0.0 122-123 0.3 0.0 0.0 0.0 0.0 124-125 0.3875 0.0 0.0 0.0 0.0 126-127 0.425 0.0 0.0 0.0 0.0 128-129 0.4375 0.0 0.0 0.0 0.0 130-131 0.525 0.0 0.0 0.0 0.0 132-133 0.575 0.0 0.0 0.0 0.0 134-135 0.6375 0.0 0.0 0.0 0.0 136-137 0.7 0.0 0.0 0.0 0.0 138 0.725 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTCAGC 10 0.006973645 144.0 6 CTTATTG 10 0.006973645 144.0 3 AGTTTCA 10 0.006973645 144.0 4 TCTTATT 10 0.006973645 144.0 2 CTTCTGA 10 0.006973645 144.0 5 >>END_MODULE Read 1206633 spots for SRR14639615.sra Written 1206633 spots for SRR14639615.sra Read 1206633 spots for SRR14639615.sra Written 1206633 spots for SRR14639615.sra Read 1206633 spots for SRR14639615.sra Written 1206633 spots for SRR14639615.sra Read 1206633 spots for SRR14639615.sra Written 1206633 spots for SRR14639615.sra Read 1206633 spots for SRR14639615.sra Written 1206633 spots for SRR14639615.sra Read 1206633 spots for SRR14639615.sra Written 1206633 spots for SRR14639615.sra Read 1206633 spots for SRR14639615.sra Written 1206633 spots for SRR14639615.sra Read 1206633 spots for SRR14639615.sra Written 1206633 spots for SRR14639615.sra Read 1206633 spots for SRR14639615.sra Written 1206633 spots for SRR14639615.sra Read 1206633 spots for SRR14639615.sra Written 1206633 spots for SRR14639615.sra Read 1206633 spots for SRR14639615.sra Written 1206633 spots for SRR14639615.sra Read 1206633 spots for SRR14639615.sra Written 1206633 spots for SRR14639615.sra Read 1206633 spots for SRR14639615.sra Written 1206633 spots for SRR14639615.sra Read 1206644 spots for SRR14639615.sra Written 1206644 spots for SRR14639615.sra Read 1206633 spots for SRR14639615.sra Written 1206633 spots for SRR14639615.sra Read 1206633 spots for SRR14639615.sra Written 1206633 spots for SRR14639615.sra Read 1206633 spots for SRR14639615.sra Written 1206633 spots for SRR14639615.sra Read 1206633 spots for SRR14639615.sra Written 1206633 spots for SRR14639615.sra Read 1206633 spots for SRR14639615.sra Written 1206633 spots for SRR14639615.sra Read 1206633 spots for SRR14639615.sra Written 1206633 spots for SRR14639615.sra SRR ids: ['SRR14639615.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__9ikx6rd SRR14639615.sra spots: 24132671 blocks: [[1, 1206633], [1206634, 2413266], [2413267, 3619899], [3619900, 4826532], [4826533, 6033165], [6033166, 7239798], [7239799, 8446431], [8446432, 9653064], [9653065, 10859697], [10859698, 12066330], [12066331, 13272963], [13272964, 14479596], [14479597, 15686229], [15686230, 16892862], [16892863, 18099495], [18099496, 19306128], [19306129, 20512761], [20512762, 21719394], [21719395, 22926027], [22926028, 24132671]] SRR14639615 file size 8933664 SRR14639615 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR14639615 SRR14639615_1.fastq SRR14639615_2.fastq Input file: SRR14639615_1.fastq Paired file: SRR14639615_2.fastq trimmed: SRR14639615-trimmed-pair1.fastq, SRR14639615-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 13:28:43 2025 >> started Mon Feb 10 13:29:11 2025 >> done (28.773s) 24132671 read pairs processed; of these: 105 ( 0.00%) short read pairs filtered out after trimming by size control 53 ( 0.00%) empty read pairs filtered out after trimming by size control 24132513 (100.00%) read pairs available; of these: 767477 ( 3.18%) trimmed read pairs available after processing 23365036 (96.82%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 17 0.00% 19 11 0.00% 20 15 0.00% 21 11 0.00% 22 24 0.00% 23 22 0.00% 24 25 0.00% 25 30 0.00% 26 24 0.00% 27 36 0.00% 28 35 0.00% 29 32 0.00% 30 42 0.00% 31 42 0.00% 32 43 0.00% 33 41 0.00% 34 41 0.00% 35 48 0.00% 36 53 0.00% 37 37 0.00% 38 71 0.00% 39 60 0.00% 40 55 0.00% 41 52 0.00% 42 71 0.00% 43 57 0.00% 44 66 0.00% 45 55 0.00% 46 63 0.00% 47 72 0.00% 48 75 0.00% 49 72 0.00% 50 91 0.00% 51 88 0.00% 52 115 0.00% 53 95 0.00% 54 104 0.00% 55 110 0.00% 56 149 0.00% 57 118 0.00% 58 119 0.00% 59 128 0.00% 60 146 0.00% 61 155 0.00% 62 152 0.00% 63 165 0.00% 64 181 0.00% 65 165 0.00% 66 180 0.00% 67 189 0.00% 68 179 0.00% 69 211 0.00% 70 224 0.00% 71 264 0.00% 72 270 0.00% 73 264 0.00% 74 285 0.00% 75 315 0.00% 76 287 0.00% 77 342 0.00% 78 390 0.00% 79 403 0.00% 80 444 0.00% 81 416 0.00% 82 495 0.00% 83 480 0.00% 84 545 0.00% 85 621 0.00% 86 552 0.00% 87 583 0.00% 88 737 0.00% 89 710 0.00% 90 749 0.00% 91 802 0.00% 92 858 0.00% 93 956 0.00% 94 982 0.00% 95 1061 0.00% 96 1179 0.00% 97 1273 0.01% 98 1284 0.01% 99 1502 0.01% 100 1555 0.01% 101 1565 0.01% 102 1779 0.01% 103 1860 0.01% 104 2004 0.01% 105 2286 0.01% 106 2224 0.01% 107 2380 0.01% 108 2531 0.01% 109 2660 0.01% 110 3011 0.01% 111 3114 0.01% 112 3364 0.01% 113 3564 0.01% 114 3773 0.02% 115 4184 0.02% 116 4281 0.02% 117 4580 0.02% 118 4785 0.02% 119 5076 0.02% 120 5460 0.02% 121 5629 0.02% 122 6094 0.03% 123 6481 0.03% 124 6764 0.03% 125 7338 0.03% 126 7706 0.03% 127 8000 0.03% 128 8481 0.04% 129 8969 0.04% 130 9292 0.04% 131 9936 0.04% 132 9955 0.04% 133 10527 0.04% 134 10964 0.05% 135 11545 0.05% 136 11887 0.05% 137 12446 0.05% 138 13290 0.06% 139 14055 0.06% 140 14180 0.06% 141 14874 0.06% 142 15610 0.06% 143 16178 0.07% 144 16915 0.07% 145 17610 0.07% 146 18754 0.08% 147 22006 0.09% 148 38599 0.16% 149 323845 1.34% 150 23365036 96.82% 24132513 reads passed initial QC criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=4.09 fanout-score-rank=8 prefix-density=0.31 prefix-fanout=3.2 sequence=GTTTTCTCATTTGCA criterion=fanout-score sequence-density=0.10 sequence-density-rank=14 fanout-score=15.02 fanout-score-rank=1 prefix-density=0.49 prefix-fanout=3.1 sequence=TTGCAGCCACTGCC criterion=sequence-density sequence-density=0.37 sequence-density-rank=1 fanout-score=5.02 fanout-score-rank=11 prefix-density=0.53 prefix-fanout=3.5 sequence=CTGCAAATGTGG criterion=fanout-score sequence-density=0.08 sequence-density-rank=21 fanout-score=81.96 fanout-score-rank=1 prefix-density=0.32 prefix-fanout=20.9 sequence=TCAAGAAAATGG SRR14639615 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 13:29:59 Started mapping on | Feb 10 13:29:59 Finished on | Feb 10 13:34:42 Mapping speed, Million of reads per hour | 306.99 Number of input reads | 24132513 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 20868615 Uniquely mapped reads % | 86.48% Average mapped length | 296.97 Number of splices: Total | 18141633 Number of splices: Annotated (sjdb) | 17739650 Number of splices: GT/AG | 17834755 Number of splices: GC/AG | 230199 Number of splices: AT/AC | 16136 Number of splices: Non-canonical | 60543 Mismatch rate per base, % | 0.54% Deletion rate per base | 0.03% Deletion average length | 2.98 Insertion rate per base | 0.02% Insertion average length | 2.60 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 593731 % of reads mapped to multiple loci | 2.46% Number of reads mapped to too many loci | 37218 % of reads mapped to too many loci | 0.15% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 10.79% % of reads unmapped: other | 0.12% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2670167 2670167 2670167 N_multimapping 593731 593731 593731 N_noFeature 781267 20679713 866392 N_ambiguous 248356 1397 143814 UnstrandedReadsAssigned:19838992 PositiveStrandReadsAssigned:187505 NegativeStrandReadsAssigned:19858409 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR14639615 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR14639615-trimmed-pair1.fastq SRR14639615-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 24,132,513 reads, 20,403,880 reads pseudoaligned [quant] estimated average fragment length: 330.133 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,083 rounds 52401 SRR14639615.ke.tsv 34699 SRR14639615.se.tsv 87100 total ==> SRR14639615.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1688.87 3392 91.9575 Potri.005G024800.1.v4.1 1035 705.867 515 33.405 Potri.004G059700.1.v4.1 961 632.332 204 14.7711 Potri.007G009000.2.v4.1 1416 1086.87 0 0 Potri.003G141000.2.v4.1 2943 2613.87 1064.64 18.6486 Potri.016G087400.1.v4.1 270 61.6789 1180.71 876.464 Potri.015G069301.1.v4.1 564 263.642 0 0 Potri.010G195200.1.v4.1 1773 1443.87 78 2.4734 Potri.012G127500.1.v4.1 977 648.139 2378 167.985 ==> SRR14639615.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 74 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 320 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 6 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 315 SRR14639615 completed mapping pipeline successfully