Starting /dee2/code/volunteer_pipeline.sh SRR14639616 current disk space = 3059053998080 free memory = 1522169332 SRR14639616 SRAfilesize f0b8a26045b2129f587e50d8f26835c1 SRR14639616.sra SRR14639616.sra file validated SRR14639616 is paired end SRR14639616 is conventional basespace SRR14639616 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14639616_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.7525 32.0 32.0 32.0 32.0 32.0 2 31.5975 32.0 32.0 32.0 32.0 32.0 3 35.26375 37.0 32.0 37.0 32.0 37.0 4 36.15875 37.0 37.0 37.0 37.0 37.0 5 36.32125 37.0 37.0 37.0 37.0 37.0 6 39.87525 41.0 41.0 41.0 37.0 41.0 7 39.88875 41.0 41.0 41.0 37.0 41.0 8 40.22775 41.0 41.0 41.0 37.0 41.0 9 40.19575 41.0 41.0 41.0 37.0 41.0 10-14 40.20455 41.0 41.0 41.0 37.0 41.0 15-19 40.2479 41.0 41.0 41.0 40.2 41.0 20-24 40.2147 41.0 41.0 41.0 40.2 41.0 25-29 40.18245 41.0 41.0 41.0 39.4 41.0 30-34 40.16035 41.0 41.0 41.0 38.6 41.0 35-39 40.13965 41.0 41.0 41.0 37.8 41.0 40-44 40.0466 41.0 41.0 41.0 37.0 41.0 45-49 40.08125 41.0 41.0 41.0 37.0 41.0 50-54 40.0307 41.0 41.0 41.0 37.0 41.0 55-59 39.89985 41.0 41.0 41.0 37.0 41.0 60-64 39.8671 41.0 41.0 41.0 37.0 41.0 65-69 39.70925 41.0 41.0 41.0 37.0 41.0 70-74 39.5989 41.0 41.0 41.0 37.0 41.0 75-79 39.134100000000004 41.0 40.2 41.0 36.0 41.0 80-84 39.629949999999994 41.0 41.0 41.0 37.0 41.0 85-89 39.56205 41.0 41.0 41.0 37.0 41.0 90-94 39.52005 41.0 41.0 41.0 37.0 41.0 95-99 39.43495 41.0 41.0 41.0 37.0 41.0 100-104 39.31230000000001 41.0 41.0 41.0 37.0 41.0 105-109 39.182300000000005 41.0 41.0 41.0 37.0 41.0 110-114 39.21275 41.0 41.0 41.0 37.0 41.0 115-119 39.189800000000005 41.0 41.0 41.0 37.0 41.0 120-124 39.15865 41.0 41.0 41.0 37.0 41.0 125-129 39.213899999999995 41.0 41.0 41.0 37.0 41.0 130-134 38.8644 41.0 41.0 41.0 34.0 41.0 135-139 38.751200000000004 41.0 41.0 41.0 32.0 41.0 140-144 38.428399999999996 41.0 41.0 41.0 32.0 41.0 145-149 38.2265 41.0 37.0 41.0 32.0 41.0 150 38.125 41.0 37.0 41.0 32.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 2.0 23 3.0 24 2.0 25 4.0 26 4.0 27 9.0 28 16.0 29 23.0 30 30.0 31 26.0 32 48.0 33 49.0 34 63.0 35 90.0 36 86.0 37 168.0 38 256.0 39 518.0 40 2603.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.48362090522631 13.303325831457865 11.77794448612153 40.4351087771943 2 14.95 12.174999999999999 41.325 31.55 3 15.925 18.475 29.849999999999998 35.75 4 21.2 26.1 25.174999999999997 27.525 5 21.325 33.625 26.625 18.425 6 16.425 33.4 29.7 20.474999999999998 7 14.674999999999999 26.400000000000002 40.875 18.05 8 13.425 24.375 38.574999999999996 23.625 9 14.95 25.874999999999996 35.8 23.375 10-14 19.045 29.485 28.13 23.34 15-19 19.41 28.375 28.515 23.7 20-24 19.55 29.315 27.985 23.150000000000002 25-29 19.64 28.305000000000003 28.675 23.380000000000003 30-34 19.41 28.634999999999998 28.110000000000003 23.845 35-39 19.645000000000003 28.835 28.28 23.24 40-44 19.400000000000002 28.799999999999997 28.799999999999997 23.0 45-49 19.27 29.189999999999998 27.735 23.805 50-54 19.235 28.51 28.535 23.72 55-59 18.865000000000002 29.07 28.285 23.78 60-64 19.145 28.76 28.185 23.91 65-69 20.055 28.585 27.925 23.435 70-74 19.595000000000002 29.07 28.32 23.015 75-79 19.259999999999998 28.78 28.32 23.64 80-84 19.895 28.705000000000002 28.144999999999996 23.255 85-89 20.169999999999998 29.195 27.250000000000004 23.385 90-94 19.955000000000002 29.34 27.18 23.525 95-99 19.545 28.825 28.165000000000003 23.465 100-104 19.85 27.905 28.555000000000003 23.69 105-109 19.99599979999 27.661383069153455 28.191409570478527 24.15120756037802 110-114 19.405 28.095 28.494999999999997 24.005000000000003 115-119 20.05 28.77 27.700000000000003 23.48 120-124 19.62 27.994999999999997 28.65 23.735 125-129 20.169999999999998 28.53 27.595 23.705000000000002 130-134 19.689999999999998 28.52 28.08 23.71 135-139 20.31 28.405 27.655 23.630000000000003 140-144 20.139027805561113 27.955591118223644 27.850570114022805 24.054810962192438 145-149 20.215 28.38 27.825 23.580000000000002 150 19.85 28.4 28.000000000000004 23.75 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 2.0 1 1.5 2 0.5 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.5 13 0.5 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 2.0 22 3.0 23 3.0 24 5.0 25 7.5 26 8.0 27 10.0 28 16.0 29 20.5 30 29.0 31 33.0 32 36.5 33 55.5 34 70.5 35 84.0 36 99.0 37 109.5 38 146.0 39 180.0 40 219.0 41 254.0 42 263.0 43 279.0 44 272.0 45 264.5 46 250.0 47 206.5 48 186.5 49 180.0 50 155.5 51 131.5 52 108.5 53 79.0 54 49.0 55 33.5 56 30.0 57 28.0 58 25.0 59 15.0 60 10.5 61 7.5 62 4.0 63 5.0 64 5.0 65 4.0 66 2.5 67 2.0 68 1.0 69 1.0 70 1.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.005 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.02 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.95 #Duplication Level Percentage of deduplicated Percentage of total 1 95.10268562401264 90.3 2 4.555028962611901 8.649999999999999 3 0.2632964718272775 0.75 4 0.07898894154818326 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.037500000000000006 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.0625 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.0875 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.125 0.0 0.0 0.0 0.0 104-105 0.15 0.0 0.0 0.0 0.0 106-107 0.16249999999999998 0.0 0.0 0.0 0.0 108-109 0.1875 0.0 0.0 0.0 0.0 110-111 0.2375 0.0 0.0 0.0 0.0 112-113 0.2625 0.0 0.0 0.0 0.0 114-115 0.30000000000000004 0.0 0.0 0.0 0.0 116-117 0.375 0.0 0.0 0.0 0.0 118-119 0.4625 0.0 0.0 0.0 0.0 120-121 0.575 0.0 0.0 0.0 0.0 122-123 0.65 0.0 0.0 0.0 0.0 124-125 0.6625000000000001 0.0 0.0 0.0125 0.0 126-127 0.7875 0.0 0.0 0.025 0.0 128-129 0.975 0.0 0.0 0.025 0.0 130-131 1.0625 0.0 0.0 0.025 0.0 132-133 1.1749999999999998 0.0 0.0 0.025 0.0 134-135 1.2375 0.0 0.0 0.025 0.0 136-137 1.3 0.0 0.0 0.025 0.0 138 1.425 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATAGTTA 10 0.006973645 144.0 5 >>END_MODULE SRR14639616 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14639616_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.985 32.0 32.0 32.0 32.0 32.0 2 30.66875 32.0 32.0 32.0 32.0 32.0 3 33.95375 37.0 32.0 37.0 32.0 37.0 4 34.97375 37.0 37.0 37.0 32.0 37.0 5 35.295 37.0 37.0 37.0 32.0 37.0 6 38.33475 41.0 37.0 41.0 32.0 41.0 7 38.0895 41.0 41.0 41.0 32.0 41.0 8 38.24925 41.0 41.0 41.0 32.0 41.0 9 38.4745 41.0 41.0 41.0 32.0 41.0 10-14 38.46130000000001 41.0 41.0 41.0 32.0 41.0 15-19 38.3132 41.0 41.0 41.0 32.0 41.0 20-24 38.20585 41.0 41.0 41.0 32.0 41.0 25-29 37.93635 41.0 39.4 41.0 29.0 41.0 30-34 37.8707 41.0 39.4 41.0 27.0 41.0 35-39 37.84285 41.0 37.0 41.0 27.0 41.0 40-44 37.580349999999996 41.0 37.0 41.0 27.0 41.0 45-49 37.600449999999995 41.0 37.0 41.0 27.0 41.0 50-54 37.40895 41.0 37.0 41.0 27.0 41.0 55-59 37.39515 41.0 37.0 41.0 27.0 41.0 60-64 37.30475 41.0 37.0 41.0 27.0 41.0 65-69 36.98535 41.0 37.0 41.0 26.0 41.0 70-74 36.8666 41.0 37.0 41.0 24.0 41.0 75-79 36.21015 40.2 35.0 41.0 22.0 41.0 80-84 37.08735 41.0 37.0 41.0 24.0 41.0 85-89 37.074 41.0 37.0 41.0 23.0 41.0 90-94 36.8125 41.0 37.0 41.0 22.0 41.0 95-99 36.81635 41.0 37.0 41.0 22.0 41.0 100-104 36.65045 41.0 37.0 41.0 22.0 41.0 105-109 36.59055 41.0 37.0 41.0 22.0 41.0 110-114 36.4162 41.0 37.0 41.0 22.0 41.0 115-119 36.144149999999996 41.0 36.0 41.0 22.0 41.0 120-124 36.3362 41.0 37.0 41.0 22.0 41.0 125-129 35.727250000000005 41.0 35.0 41.0 20.0 41.0 130-134 35.8163 41.0 37.0 41.0 22.0 41.0 135-139 35.2482 41.0 34.0 41.0 18.0 41.0 140-144 35.1644 41.0 33.0 41.0 18.0 41.0 145-149 34.9272 41.0 32.0 41.0 12.0 41.0 150 34.544 41.0 32.0 41.0 12.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 1.0 14 3.0 15 6.0 16 9.0 17 19.0 18 30.0 19 30.0 20 38.0 21 28.0 22 23.0 23 38.0 24 35.0 25 28.0 26 58.0 27 45.0 28 57.0 29 56.0 30 78.0 31 83.0 32 88.0 33 79.0 34 103.0 35 144.0 36 195.0 37 223.0 38 312.0 39 542.0 40 1648.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.74649298597195 27.17935871743487 10.896793587174349 26.177354709418836 2 19.35 27.750000000000004 37.85 15.049999999999999 3 17.974999999999998 27.224999999999998 33.85 20.95 4 22.400000000000002 35.099999999999994 22.650000000000002 19.85 5 23.925 36.275 23.275000000000002 16.525000000000002 6 18.125 37.15 25.575 19.15 7 20.7 22.900000000000002 37.125 19.275000000000002 8 16.325 23.775 34.1 25.8 9 19.475 25.4 31.4 23.724999999999998 10-14 23.205000000000002 28.505000000000003 27.07 21.22 15-19 22.564999999999998 28.205000000000002 28.32 20.91 20-24 22.78 28.38 27.82 21.02 25-29 22.615 28.415000000000003 27.98 20.990000000000002 30-34 22.56 28.49 28.27 20.68 35-39 22.095000000000002 27.935 28.875 21.095 40-44 22.67 27.245 28.634999999999998 21.45 45-49 21.875 28.16 28.395 21.57 50-54 21.93 28.08 28.625 21.365000000000002 55-59 22.955000000000002 27.650000000000002 28.225 21.17 60-64 22.825 28.144999999999996 28.595 20.435 65-69 22.29 28.265 28.255000000000003 21.19 70-74 22.765 28.62 27.889999999999997 20.724999999999998 75-79 22.755 27.935 28.544999999999998 20.765 80-84 22.835 28.15 28.32 20.695 85-89 23.325000000000003 28.084999999999997 28.48 20.11 90-94 23.419999999999998 28.65 27.61 20.32 95-99 23.225 28.23 27.575 20.97 100-104 22.965 28.685 27.705000000000002 20.645 105-109 23.075000000000003 27.49 28.194999999999997 21.240000000000002 110-114 23.005 27.515 28.935 20.544999999999998 115-119 23.474999999999998 28.215 27.715 20.595 120-124 23.315 28.405 27.705000000000002 20.575 125-129 23.05 28.505000000000003 27.474999999999998 20.97 130-134 23.925 27.6 27.92 20.555 135-139 23.645 27.800000000000004 27.779999999999998 20.775 140-144 23.075000000000003 27.755000000000003 28.52 20.65 145-149 23.87 28.075 27.665 20.39 150 24.474999999999998 26.450000000000003 28.575 20.5 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.5 12 1.0 13 0.5 14 0.0 15 1.0 16 1.0 17 1.0 18 1.0 19 0.5 20 1.5 21 2.5 22 4.5 23 5.0 24 3.0 25 3.0 26 7.0 27 9.0 28 13.5 29 17.5 30 20.5 31 30.5 32 41.5 33 47.5 34 60.0 35 72.5 36 95.0 37 119.0 38 155.5 39 189.5 40 224.0 41 257.0 42 242.5 43 255.0 44 268.0 45 268.0 46 256.0 47 212.5 48 195.5 49 177.5 50 138.5 51 114.0 52 104.0 53 84.0 54 66.0 55 53.5 56 39.5 57 29.5 58 25.5 59 22.5 60 17.0 61 13.5 62 7.0 63 4.0 64 4.5 65 4.0 66 3.0 67 2.5 68 1.0 69 0.0 70 1.5 71 1.5 72 0.5 73 0.5 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.2 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 95.93114241001565 91.95 2 3.8601982263954095 7.3999999999999995 3 0.1564945226917058 0.44999999999999996 4 0.05216484089723526 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0125 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.037500000000000006 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.0625 0.0 0.0 0.0 0.0 100-101 0.075 0.0 0.0 0.0 0.0 102-103 0.075 0.0 0.0 0.0 0.0 104-105 0.1 0.0 0.0 0.0 0.0 106-107 0.1125 0.0 0.0 0.0 0.0 108-109 0.15 0.0 0.0 0.0 0.0 110-111 0.1875 0.0 0.0 0.0 0.0 112-113 0.21250000000000002 0.0 0.0 0.0 0.0 114-115 0.2625 0.0 0.0 0.0 0.0 116-117 0.2875 0.0 0.0 0.0 0.0 118-119 0.3375 0.0 0.0 0.0 0.0 120-121 0.45 0.0 0.0 0.0 0.0 122-123 0.55 0.0 0.0 0.0 0.0 124-125 0.575 0.0 0.0 0.0 0.0 126-127 0.7375 0.0 0.0 0.0 0.0 128-129 0.9375 0.0 0.0 0.0 0.0 130-131 1.0625 0.0 0.0 0.0 0.0 132-133 1.1625 0.0 0.0 0.0 0.0 134-135 1.2375 0.0 0.0 0.0 0.0 136-137 1.2875 0.0 0.0 0.0 0.0 138 1.4 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 986374 spots for SRR14639616.sra Written 986374 spots for SRR14639616.sra Read 986374 spots for SRR14639616.sra Written 986374 spots for SRR14639616.sra Read 986374 spots for SRR14639616.sra Written 986374 spots for SRR14639616.sra Read 986374 spots for SRR14639616.sra Written 986374 spots for SRR14639616.sra Read 986374 spots for SRR14639616.sra Written 986374 spots for SRR14639616.sra Read 986374 spots for SRR14639616.sra Written 986374 spots for SRR14639616.sra Read 986374 spots for SRR14639616.sra Written 986374 spots for SRR14639616.sra Read 986374 spots for SRR14639616.sra Written 986374 spots for SRR14639616.sra Read 986374 spots for SRR14639616.sra Written 986374 spots for SRR14639616.sra Read 986374 spots for SRR14639616.sra Written 986374 spots for SRR14639616.sra Read 986374 spots for SRR14639616.sra Written 986374 spots for SRR14639616.sra Read 986374 spots for SRR14639616.sra Written 986374 spots for SRR14639616.sra Read 986374 spots for SRR14639616.sra Written 986374 spots for SRR14639616.sra Read 986374 spots for SRR14639616.sra Written 986374 spots for SRR14639616.sra Read 986391 spots for SRR14639616.sra Written 986391 spots for SRR14639616.sra Read 986374 spots for SRR14639616.sra Written 986374 spots for SRR14639616.sra Read 986374 spots for SRR14639616.sra Written 986374 spots for SRR14639616.sra Read 986374 spots for SRR14639616.sra Written 986374 spots for SRR14639616.sra Read 986374 spots for SRR14639616.sra Written 986374 spots for SRR14639616.sra Read 986374 spots for SRR14639616.sra Written 986374 spots for SRR14639616.sra SRR ids: ['SRR14639616.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_yj_agsp5 SRR14639616.sra spots: 19727497 blocks: [[1, 986374], [986375, 1972748], [1972749, 2959122], [2959123, 3945496], [3945497, 4931870], [4931871, 5918244], [5918245, 6904618], [6904619, 7890992], [7890993, 8877366], [8877367, 9863740], [9863741, 10850114], [10850115, 11836488], [11836489, 12822862], [12822863, 13809236], [13809237, 14795610], [14795611, 15781984], [15781985, 16768358], [16768359, 17754732], [17754733, 18741106], [18741107, 19727497]] SRR14639616 file size 7300957 SRR14639616 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR14639616 SRR14639616_1.fastq SRR14639616_2.fastq Input file: SRR14639616_1.fastq Paired file: SRR14639616_2.fastq trimmed: SRR14639616-trimmed-pair1.fastq, SRR14639616-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 14:02:47 2025 >> started Mon Feb 10 14:03:17 2025 >> done (29.445s) 19727497 read pairs processed; of these: 81 ( 0.00%) short read pairs filtered out after trimming by size control 106 ( 0.00%) empty read pairs filtered out after trimming by size control 19727310 (100.00%) read pairs available; of these: 1009546 ( 5.12%) trimmed read pairs available after processing 18717764 (94.88%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 10 0.00% 19 9 0.00% 20 13 0.00% 21 19 0.00% 22 18 0.00% 23 20 0.00% 24 21 0.00% 25 23 0.00% 26 18 0.00% 27 30 0.00% 28 43 0.00% 29 36 0.00% 30 25 0.00% 31 37 0.00% 32 39 0.00% 33 37 0.00% 34 45 0.00% 35 51 0.00% 36 59 0.00% 37 63 0.00% 38 71 0.00% 39 68 0.00% 40 74 0.00% 41 62 0.00% 42 100 0.00% 43 105 0.00% 44 92 0.00% 45 109 0.00% 46 123 0.00% 47 109 0.00% 48 111 0.00% 49 150 0.00% 50 168 0.00% 51 150 0.00% 52 169 0.00% 53 182 0.00% 54 204 0.00% 55 204 0.00% 56 245 0.00% 57 254 0.00% 58 247 0.00% 59 279 0.00% 60 291 0.00% 61 260 0.00% 62 300 0.00% 63 321 0.00% 64 329 0.00% 65 319 0.00% 66 387 0.00% 67 411 0.00% 68 377 0.00% 69 512 0.00% 70 479 0.00% 71 536 0.00% 72 569 0.00% 73 667 0.00% 74 678 0.00% 75 741 0.00% 76 723 0.00% 77 746 0.00% 78 782 0.00% 79 859 0.00% 80 928 0.00% 81 967 0.00% 82 1093 0.01% 83 1146 0.01% 84 1132 0.01% 85 1311 0.01% 86 1362 0.01% 87 1447 0.01% 88 1513 0.01% 89 1598 0.01% 90 1721 0.01% 91 1878 0.01% 92 1895 0.01% 93 2126 0.01% 94 2142 0.01% 95 2355 0.01% 96 2605 0.01% 97 2784 0.01% 98 2912 0.01% 99 2953 0.01% 100 3288 0.02% 101 3515 0.02% 102 3664 0.02% 103 3958 0.02% 104 4196 0.02% 105 4435 0.02% 106 4551 0.02% 107 4992 0.03% 108 5295 0.03% 109 5530 0.03% 110 5654 0.03% 111 6156 0.03% 112 6490 0.03% 113 7123 0.04% 114 7447 0.04% 115 7945 0.04% 116 8382 0.04% 117 8857 0.04% 118 9328 0.05% 119 9525 0.05% 120 10083 0.05% 121 10567 0.05% 122 11225 0.06% 123 11877 0.06% 124 12305 0.06% 125 12846 0.07% 126 13380 0.07% 127 14068 0.07% 128 14665 0.07% 129 15611 0.08% 130 15877 0.08% 131 16572 0.08% 132 16921 0.09% 133 17348 0.09% 134 18159 0.09% 135 19020 0.10% 136 19385 0.10% 137 20030 0.10% 138 21119 0.11% 139 21596 0.11% 140 22146 0.11% 141 23030 0.12% 142 24108 0.12% 143 24562 0.12% 144 25818 0.13% 145 26085 0.13% 146 27110 0.14% 147 30642 0.16% 148 44345 0.22% 149 278668 1.41% 150 18717764 94.88% 19727310 reads passed initial QC criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=2.70 fanout-score-rank=20 prefix-density=0.30 prefix-fanout=2.4 sequence=AGTTCATCTCAGA criterion=fanout-score sequence-density=0.11 sequence-density-rank=15 fanout-score=14.57 fanout-score-rank=1 prefix-density=0.28 prefix-fanout=5.8 sequence=AGCACCAAGTGGAGGGTGGACTCCTTCTGGATGTTGTA criterion=sequence-density sequence-density=0.41 sequence-density-rank=1 fanout-score=4.96 fanout-score-rank=11 prefix-density=0.58 prefix-fanout=3.5 sequence=CTGCAAATGTGG criterion=fanout-score sequence-density=0.06 sequence-density-rank=26 fanout-score=163.80 fanout-score-rank=1 prefix-density=0.41 prefix-fanout=24.4 sequence=TTCAAGAAAATGG SRR14639616 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 14:04:07 Started mapping on | Feb 10 14:04:07 Finished on | Feb 10 14:07:40 Mapping speed, Million of reads per hour | 333.42 Number of input reads | 19727310 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 17303951 Uniquely mapped reads % | 87.72% Average mapped length | 296.05 Number of splices: Total | 15142969 Number of splices: Annotated (sjdb) | 14791549 Number of splices: GT/AG | 14883044 Number of splices: GC/AG | 195873 Number of splices: AT/AC | 14107 Number of splices: Non-canonical | 49945 Mismatch rate per base, % | 0.54% Deletion rate per base | 0.03% Deletion average length | 2.97 Insertion rate per base | 0.02% Insertion average length | 2.59 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 470198 % of reads mapped to multiple loci | 2.38% Number of reads mapped to too many loci | 25576 % of reads mapped to too many loci | 0.13% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 9.68% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1953161 1953161 1953161 N_multimapping 470198 470198 470198 N_noFeature 705649 17142368 780380 N_ambiguous 203435 1141 115915 UnstrandedReadsAssigned:16394867 PositiveStrandReadsAssigned:160442 NegativeStrandReadsAssigned:16407656 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR14639616 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR14639616-trimmed-pair1.fastq SRR14639616-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,727,310 reads, 16,851,607 reads pseudoaligned [quant] estimated average fragment length: 311.412 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,118 rounds 52401 SRR14639616.ke.tsv 34699 SRR14639616.se.tsv 87100 total ==> SRR14639616.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1707.59 2433 83.8132 Potri.005G024800.1.v4.1 1035 724.588 175 14.2069 Potri.004G059700.1.v4.1 961 651.19 135 12.1949 Potri.007G009000.2.v4.1 1416 1105.59 0 0 Potri.003G141000.2.v4.1 2943 2632.59 816.216 18.2379 Potri.016G087400.1.v4.1 270 71.0715 1018 842.57 Potri.015G069301.1.v4.1 564 281.333 0 0 Potri.010G195200.1.v4.1 1773 1462.59 73 2.93599 Potri.012G127500.1.v4.1 977 666.885 1566 138.132 ==> SRR14639616.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 41 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 330 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 6 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 361 SRR14639616 completed mapping pipeline successfully