Starting /dee2/code/volunteer_pipeline.sh SRR14639617 current disk space = 3059068583936 free memory = 1304644772 SRR14639617 SRAfilesize 4da41888171b1e44117bc51d6b84fcac SRR14639617.sra SRR14639617.sra file validated SRR14639617 is paired end SRR14639617 is conventional basespace SRR14639617 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14639617_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.58875 32.0 32.0 32.0 32.0 32.0 2 31.63 32.0 32.0 32.0 32.0 32.0 3 35.2525 37.0 32.0 37.0 32.0 37.0 4 36.15875 37.0 37.0 37.0 32.0 37.0 5 36.29 37.0 37.0 37.0 37.0 37.0 6 39.78375 41.0 41.0 41.0 37.0 41.0 7 39.84825 41.0 41.0 41.0 37.0 41.0 8 40.0995 41.0 41.0 41.0 37.0 41.0 9 40.18025 41.0 41.0 41.0 37.0 41.0 10-14 40.200599999999994 41.0 41.0 41.0 37.8 41.0 15-19 40.1141 41.0 41.0 41.0 37.0 41.0 20-24 40.1288 41.0 41.0 41.0 37.8 41.0 25-29 40.06 41.0 41.0 41.0 37.8 41.0 30-34 40.077 41.0 41.0 41.0 37.0 41.0 35-39 39.9716 41.0 41.0 41.0 37.0 41.0 40-44 39.97765 41.0 41.0 41.0 37.0 41.0 45-49 39.914100000000005 41.0 41.0 41.0 37.0 41.0 50-54 39.8642 41.0 41.0 41.0 37.0 41.0 55-59 39.81785 41.0 41.0 41.0 37.0 41.0 60-64 39.703799999999994 41.0 41.0 41.0 37.0 41.0 65-69 39.632999999999996 41.0 41.0 41.0 37.0 41.0 70-74 39.38275 41.0 41.0 41.0 37.0 41.0 75-79 39.09825 41.0 40.2 41.0 36.0 41.0 80-84 39.464549999999996 41.0 41.0 41.0 37.0 41.0 85-89 39.43535 41.0 41.0 41.0 37.0 41.0 90-94 39.418400000000005 41.0 41.0 41.0 37.0 41.0 95-99 39.3291 41.0 41.0 41.0 37.0 41.0 100-104 39.2476 41.0 41.0 41.0 37.0 41.0 105-109 39.190250000000006 41.0 41.0 41.0 37.0 41.0 110-114 39.14295 41.0 41.0 41.0 37.0 41.0 115-119 39.056799999999996 41.0 41.0 41.0 36.0 41.0 120-124 39.0086 41.0 41.0 41.0 37.0 41.0 125-129 39.0276 41.0 41.0 41.0 36.0 41.0 130-134 38.7528 41.0 41.0 41.0 32.0 41.0 135-139 38.4785 41.0 41.0 41.0 32.0 41.0 140-144 38.253750000000004 41.0 39.4 41.0 32.0 41.0 145-149 38.097500000000004 41.0 37.0 41.0 32.0 41.0 150 38.00975 41.0 37.0 41.0 32.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 0.0 22 5.0 23 2.0 24 4.0 25 9.0 26 15.0 27 14.0 28 18.0 29 21.0 30 27.0 31 36.0 32 41.0 33 47.0 34 79.0 35 83.0 36 108.0 37 161.0 38 244.0 39 488.0 40 2597.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.19259629814908 13.431715857928964 9.304652326163081 42.07103551775888 2 15.1 11.5 44.95 28.449999999999996 3 14.6 18.5 30.95 35.949999999999996 4 22.625 25.05 24.349999999999998 27.975 5 21.95 33.175 25.4 19.475 6 17.075000000000003 32.824999999999996 27.975 22.125 7 14.025000000000002 27.275 41.225 17.474999999999998 8 14.424999999999999 23.974999999999998 39.4 22.2 9 14.85 25.05 36.75 23.35 10-14 19.025 29.38 28.249999999999996 23.345 15-19 18.84 28.7 28.535 23.925 20-24 18.970000000000002 28.87 27.944999999999997 24.215 25-29 18.775 28.87 28.58 23.775 30-34 19.535 28.76 27.88 23.825 35-39 19.405 28.389999999999997 27.779999999999998 24.425 40-44 18.995 28.994999999999997 28.110000000000003 23.9 45-49 19.245 28.51 28.055000000000003 24.19 50-54 19.415 28.599999999999998 28.115000000000002 23.87 55-59 19.09 28.205000000000002 28.435 24.27 60-64 19.415 28.71 28.26 23.615 65-69 19.145 28.68 27.99 24.185000000000002 70-74 18.96 28.775000000000002 28.525 23.74 75-79 19.28 28.575 28.000000000000004 24.145 80-84 19.42 28.675 28.12 23.785 85-89 19.85 28.82 27.785 23.544999999999998 90-94 19.62 28.54 27.49 24.349999999999998 95-99 19.335 28.49 28.244999999999997 23.93 100-104 19.245 28.7 27.61 24.445 105-109 20.15100755037752 27.551377568878443 28.116405820291014 24.181209060453025 110-114 19.580000000000002 28.465 27.93 24.025 115-119 20.19 28.645 27.575 23.59 120-124 20.055 28.355000000000004 27.77 23.82 125-129 20.14 28.494999999999997 27.534999999999997 23.830000000000002 130-134 20.705000000000002 28.410000000000004 27.54 23.345 135-139 19.965 28.765 27.839999999999996 23.43 140-144 20.407040704070408 28.257825782578255 27.3977397739774 23.937393739373938 145-149 20.29 28.54 27.115000000000002 24.055 150 18.875 29.425 27.025 24.675 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 2.0 1 1.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 3.0 23 5.5 24 6.5 25 5.5 26 6.5 27 10.0 28 14.0 29 18.0 30 20.5 31 30.0 32 47.5 33 61.0 34 70.0 35 86.0 36 99.0 37 110.0 38 148.0 39 196.0 40 222.0 41 222.0 42 237.5 43 261.0 44 255.5 45 266.0 46 262.5 47 233.0 48 209.0 49 186.5 50 160.5 51 124.0 52 93.0 53 67.5 54 49.5 55 44.5 56 37.0 57 26.5 58 20.5 59 16.0 60 14.0 61 10.0 62 6.0 63 4.5 64 5.5 65 4.5 66 2.0 67 2.5 68 2.5 69 1.5 70 1.0 71 1.5 72 3.5 73 4.0 74 1.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.005 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.01 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.175 #Duplication Level Percentage of deduplicated Percentage of total 1 95.35066981875492 90.75 2 4.307853953244025 8.200000000000001 3 0.28894142369319675 0.8250000000000001 4 0.026267402153926978 0.1 5 0.026267402153926978 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTTTATTACAACAACAACAACTTAAATAGAAGTCCCATTTATGTTTGTTT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.025 0.0 12-13 0.0 0.0 0.0 0.025 0.0 14-15 0.0 0.0 0.0 0.025 0.0 16-17 0.0 0.0 0.0 0.025 0.0 18-19 0.0 0.0 0.0 0.025 0.0 20-21 0.0 0.0 0.0 0.025 0.0 22-23 0.0 0.0 0.0 0.025 0.0 24-25 0.0 0.0 0.0 0.025 0.0 26-27 0.0 0.0 0.0 0.025 0.0 28-29 0.0 0.0 0.0 0.025 0.0 30-31 0.0 0.0 0.0 0.025 0.0 32-33 0.0 0.0 0.0 0.025 0.0 34-35 0.0 0.0 0.0 0.025 0.0 36-37 0.0 0.0 0.0 0.025 0.0 38-39 0.0 0.0 0.0 0.025 0.0 40-41 0.0 0.0 0.0 0.025 0.0 42-43 0.0 0.0 0.0 0.025 0.0 44-45 0.0 0.0 0.0 0.025 0.0 46-47 0.0 0.0 0.0 0.025 0.0 48-49 0.0 0.0 0.0 0.025 0.0 50-51 0.0 0.0 0.0 0.025 0.0 52-53 0.0 0.0 0.0 0.025 0.0 54-55 0.0 0.0 0.0 0.025 0.0 56-57 0.0 0.0 0.0 0.025 0.0 58-59 0.0 0.0 0.0 0.025 0.0 60-61 0.0 0.0 0.0 0.025 0.0 62-63 0.0 0.0 0.0 0.025 0.0 64-65 0.0 0.0 0.0 0.025 0.0 66-67 0.0 0.0 0.0 0.025 0.0 68-69 0.0 0.0 0.0 0.025 0.0 70-71 0.0 0.0 0.0 0.025 0.0 72-73 0.0 0.0 0.0 0.025 0.0 74-75 0.025 0.0 0.0 0.025 0.0 76-77 0.025 0.0 0.0 0.025 0.0 78-79 0.025 0.0 0.0 0.025 0.0 80-81 0.025 0.0 0.0 0.025 0.0 82-83 0.025 0.0 0.0 0.025 0.0 84-85 0.025 0.0 0.0 0.025 0.0 86-87 0.025 0.0 0.0 0.025 0.0 88-89 0.025 0.0 0.0 0.025 0.0 90-91 0.025 0.0 0.0 0.025 0.0 92-93 0.037500000000000006 0.0 0.0 0.025 0.0 94-95 0.05 0.0 0.0 0.025 0.0 96-97 0.05 0.0 0.0 0.025 0.0 98-99 0.0625 0.0 0.0 0.025 0.0 100-101 0.1125 0.0 0.0 0.025 0.0 102-103 0.125 0.0 0.0 0.025 0.0 104-105 0.175 0.0 0.0 0.025 0.0 106-107 0.2625 0.0 0.0 0.025 0.0 108-109 0.35 0.0 0.0 0.025 0.0 110-111 0.4125 0.0 0.0 0.025 0.0 112-113 0.48750000000000004 0.0 0.0 0.025 0.0 114-115 0.6375 0.0 0.0 0.025 0.0 116-117 0.7625 0.0 0.0 0.025 0.0 118-119 0.825 0.0 0.0 0.025 0.0 120-121 0.8999999999999999 0.0 0.0 0.025 0.0 122-123 1.125 0.0 0.0 0.025 0.0 124-125 1.375 0.0 0.0 0.025 0.0 126-127 1.6375000000000002 0.0 0.0 0.025 0.0 128-129 1.8875000000000002 0.0 0.0 0.025 0.0 130-131 2.175 0.0 0.0 0.025 0.0 132-133 2.3875 0.0 0.0 0.025 0.0 134-135 2.8625 0.0 0.0 0.025 0.0 136-137 3.1625 0.0 0.0 0.025 0.0 138 3.375 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR14639617 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14639617_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.86875 32.0 32.0 32.0 32.0 32.0 2 30.885 32.0 32.0 32.0 32.0 32.0 3 34.05625 37.0 32.0 37.0 32.0 37.0 4 35.01875 37.0 37.0 37.0 32.0 37.0 5 35.34375 37.0 37.0 37.0 32.0 37.0 6 38.46075 41.0 41.0 41.0 32.0 41.0 7 38.35475 41.0 41.0 41.0 32.0 41.0 8 38.4855 41.0 41.0 41.0 32.0 41.0 9 38.5215 41.0 41.0 41.0 32.0 41.0 10-14 38.75274999999999 41.0 41.0 41.0 35.0 41.0 15-19 38.580949999999994 41.0 41.0 41.0 33.0 41.0 20-24 38.4596 41.0 41.0 41.0 32.0 41.0 25-29 38.1846 41.0 40.2 41.0 30.0 41.0 30-34 38.1106 41.0 41.0 41.0 30.0 41.0 35-39 38.02095 41.0 38.6 41.0 29.0 41.0 40-44 37.927 41.0 37.8 41.0 29.0 41.0 45-49 37.83205 41.0 37.0 41.0 28.0 41.0 50-54 37.68575 41.0 37.0 41.0 27.0 41.0 55-59 37.68315 41.0 37.0 41.0 27.0 41.0 60-64 37.65525 41.0 37.0 41.0 27.0 41.0 65-69 37.30465 41.0 37.0 41.0 27.0 41.0 70-74 37.1546 41.0 37.0 41.0 27.0 41.0 75-79 36.4079 40.2 36.0 41.0 23.0 41.0 80-84 37.415350000000004 41.0 37.0 41.0 27.0 41.0 85-89 37.4225 41.0 37.0 41.0 27.0 41.0 90-94 37.056200000000004 41.0 37.0 41.0 24.0 41.0 95-99 37.119150000000005 41.0 37.0 41.0 25.0 41.0 100-104 36.944849999999995 41.0 37.0 41.0 24.0 41.0 105-109 36.8842 41.0 37.0 41.0 22.0 41.0 110-114 36.909800000000004 41.0 37.0 41.0 22.0 41.0 115-119 36.5804 41.0 37.0 41.0 22.0 41.0 120-124 36.6937 41.0 37.0 41.0 22.0 41.0 125-129 36.087 41.0 36.0 41.0 22.0 41.0 130-134 36.0072 41.0 37.0 41.0 22.0 41.0 135-139 35.56395 41.0 35.0 41.0 18.0 41.0 140-144 35.32875 41.0 32.0 41.0 18.0 41.0 145-149 35.21515 41.0 35.0 41.0 12.0 41.0 150 34.83 41.0 32.0 41.0 12.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 3.0 15 3.0 16 6.0 17 22.0 18 14.0 19 27.0 20 20.0 21 26.0 22 25.0 23 26.0 24 36.0 25 48.0 26 41.0 27 52.0 28 57.0 29 55.0 30 62.0 31 71.0 32 94.0 33 103.0 34 109.0 35 141.0 36 163.0 37 226.0 38 324.0 39 520.0 40 1726.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.11495116453794 26.296018031555224 8.314550463310793 28.274480340596043 2 19.55 25.525 38.75 16.175 3 17.724999999999998 26.700000000000003 34.949999999999996 20.625 4 22.75 33.900000000000006 23.849999999999998 19.5 5 24.05 38.15 22.0 15.8 6 18.65 37.824999999999996 24.675 18.85 7 18.5 23.45 38.15 19.900000000000002 8 18.15 24.75 32.75 24.349999999999998 9 19.35 25.624999999999996 32.275 22.75 10-14 22.835 28.765 27.51 20.89 15-19 23.135 28.194999999999997 27.925 20.745 20-24 22.905 28.205000000000002 27.615000000000002 21.275 25-29 22.335 28.59 27.91 21.165 30-34 22.825 28.294999999999998 28.165000000000003 20.715 35-39 22.625 28.415000000000003 27.985 20.974999999999998 40-44 22.875 27.495000000000005 28.449999999999996 21.18 45-49 23.055 28.084999999999997 28.035 20.825 50-54 22.650000000000002 27.705000000000002 28.01 21.634999999999998 55-59 22.770000000000003 28.21 27.93 21.09 60-64 22.945 28.535 27.87 20.65 65-69 23.189999999999998 28.485 27.49 20.835 70-74 23.72 28.025 27.96 20.294999999999998 75-79 23.515 27.79 28.494999999999997 20.200000000000003 80-84 23.355 27.87 27.810000000000002 20.965 85-89 24.14 27.775 27.705000000000002 20.380000000000003 90-94 23.985 28.585 27.644999999999996 19.785 95-99 23.630000000000003 27.38 28.63 20.36 100-104 23.57 28.185 27.865000000000002 20.380000000000003 105-109 24.035 27.445000000000004 27.82 20.7 110-114 23.990000000000002 27.97 27.955000000000002 20.085 115-119 24.03 27.950000000000003 27.88 20.14 120-124 23.87 27.644999999999996 28.015 20.47 125-129 23.39 28.705000000000002 27.544999999999998 20.36 130-134 24.625 28.02 27.139999999999997 20.215 135-139 24.455 27.615000000000002 26.735 21.195 140-144 24.535 28.28 27.245 19.939999999999998 145-149 25.025 27.92 26.63 20.424999999999997 150 24.625 27.650000000000002 27.35 20.375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 2.0 22 2.0 23 1.5 24 1.5 25 1.5 26 3.0 27 6.5 28 10.5 29 13.5 30 17.5 31 25.0 32 38.0 33 49.5 34 58.0 35 86.0 36 114.0 37 119.0 38 144.5 39 183.5 40 211.0 41 237.5 42 248.5 43 256.0 44 272.0 45 279.5 46 274.0 47 229.0 48 190.5 49 184.5 50 157.0 51 113.5 52 96.0 53 83.5 54 53.5 55 40.0 56 36.5 57 31.0 58 23.5 59 16.5 60 13.5 61 13.5 62 12.0 63 9.5 64 10.5 65 7.5 66 2.0 67 2.5 68 2.5 69 1.5 70 1.5 71 1.5 72 1.0 73 1.0 74 1.5 75 1.5 76 1.5 77 1.5 78 1.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.17500000000000002 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.75 #Duplication Level Percentage of deduplicated Percentage of total 1 95.92689295039165 91.85 2 3.733681462140992 7.1499999999999995 3 0.3133159268929504 0.8999999999999999 4 0.02610966057441253 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.0625 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.0875 0.0 0.0 0.0 0.0 100-101 0.1375 0.0 0.0 0.0 0.0 102-103 0.15 0.0 0.0 0.0 0.0 104-105 0.175 0.0 0.0 0.0 0.0 106-107 0.2625 0.0 0.0 0.0 0.0 108-109 0.35 0.0 0.0 0.0 0.0 110-111 0.4125 0.0 0.0 0.0 0.0 112-113 0.48750000000000004 0.0 0.0 0.0 0.0 114-115 0.6375 0.0 0.0 0.0 0.0 116-117 0.7375 0.0 0.0 0.0 0.0 118-119 0.8374999999999999 0.0 0.0 0.0 0.0 120-121 0.9125 0.0 0.0 0.0 0.0 122-123 1.175 0.0 0.0 0.0 0.0 124-125 1.425 0.0 0.0 0.0 0.0 126-127 1.675 0.0 0.0 0.0 0.0 128-129 1.9125 0.0 0.0 0.0 0.0 130-131 2.125 0.0 0.0 0.0 0.0 132-133 2.325 0.0 0.0 0.0 0.0 134-135 2.7375 0.0 0.0 0.0 0.0 136-137 3.0125 0.0 0.0 0.0 0.0 138 3.225 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1021931 spots for SRR14639617.sra Written 1021931 spots for SRR14639617.sra Read 1021931 spots for SRR14639617.sra Written 1021931 spots for SRR14639617.sra Read 1021931 spots for SRR14639617.sra Written 1021931 spots for SRR14639617.sra Read 1021931 spots for SRR14639617.sra Written 1021931 spots for SRR14639617.sra Read 1021931 spots for SRR14639617.sra Written 1021931 spots for SRR14639617.sra Read 1021931 spots for SRR14639617.sra Written 1021931 spots for SRR14639617.sra Read 1021931 spots for SRR14639617.sra Written 1021931 spots for SRR14639617.sra Read 1021931 spots for SRR14639617.sra Written 1021931 spots for SRR14639617.sra Read 1021931 spots for SRR14639617.sra Written 1021931 spots for SRR14639617.sra Read 1021931 spots for SRR14639617.sra Written 1021931 spots for SRR14639617.sra Read 1021931 spots for SRR14639617.sra Written 1021931 spots for SRR14639617.sra Read 1021931 spots for SRR14639617.sra Written 1021931 spots for SRR14639617.sra Read 1021931 spots for SRR14639617.sra Written 1021931 spots for SRR14639617.sra Read 1021931 spots for SRR14639617.sra Written 1021931 spots for SRR14639617.sra Read 1021931 spots for SRR14639617.sra Written 1021931 spots for SRR14639617.sra Read 1021947 spots for SRR14639617.sra Written 1021947 spots for SRR14639617.sra Read 1021931 spots for SRR14639617.sra Written 1021931 spots for SRR14639617.sra Read 1021931 spots for SRR14639617.sra Written 1021931 spots for SRR14639617.sra Read 1021931 spots for SRR14639617.sra Written 1021931 spots for SRR14639617.sra Read 1021931 spots for SRR14639617.sra Written 1021931 spots for SRR14639617.sra SRR ids: ['SRR14639617.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_51fnud3u SRR14639617.sra spots: 20438636 blocks: [[1, 1021931], [1021932, 2043862], [2043863, 3065793], [3065794, 4087724], [4087725, 5109655], [5109656, 6131586], [6131587, 7153517], [7153518, 8175448], [8175449, 9197379], [9197380, 10219310], [10219311, 11241241], [11241242, 12263172], [12263173, 13285103], [13285104, 14307034], [14307035, 15328965], [15328966, 16350896], [16350897, 17372827], [17372828, 18394758], [18394759, 19416689], [19416690, 20438636]] SRR14639617 file size 7564507 SRR14639617 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR14639617 SRR14639617_1.fastq SRR14639617_2.fastq Input file: SRR14639617_1.fastq Paired file: SRR14639617_2.fastq trimmed: SRR14639617-trimmed-pair1.fastq, SRR14639617-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 13:32:00 2025 >> started Mon Feb 10 13:32:24 2025 >> done (24.015s) 20438636 read pairs processed; of these: 80 ( 0.00%) short read pairs filtered out after trimming by size control 77 ( 0.00%) empty read pairs filtered out after trimming by size control 20438479 (100.00%) read pairs available; of these: 1618471 ( 7.92%) trimmed read pairs available after processing 18820008 (92.08%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 14 0.00% 19 11 0.00% 20 9 0.00% 21 11 0.00% 22 12 0.00% 23 18 0.00% 24 21 0.00% 25 17 0.00% 26 14 0.00% 27 19 0.00% 28 23 0.00% 29 31 0.00% 30 22 0.00% 31 26 0.00% 32 36 0.00% 33 48 0.00% 34 39 0.00% 35 38 0.00% 36 29 0.00% 37 35 0.00% 38 71 0.00% 39 30 0.00% 40 34 0.00% 41 58 0.00% 42 55 0.00% 43 52 0.00% 44 51 0.00% 45 65 0.00% 46 71 0.00% 47 79 0.00% 48 80 0.00% 49 68 0.00% 50 94 0.00% 51 92 0.00% 52 95 0.00% 53 92 0.00% 54 90 0.00% 55 116 0.00% 56 105 0.00% 57 127 0.00% 58 122 0.00% 59 144 0.00% 60 147 0.00% 61 166 0.00% 62 187 0.00% 63 221 0.00% 64 205 0.00% 65 235 0.00% 66 277 0.00% 67 255 0.00% 68 312 0.00% 69 317 0.00% 70 358 0.00% 71 412 0.00% 72 496 0.00% 73 486 0.00% 74 537 0.00% 75 579 0.00% 76 694 0.00% 77 677 0.00% 78 761 0.00% 79 846 0.00% 80 1015 0.00% 81 1032 0.01% 82 1210 0.01% 83 1284 0.01% 84 1508 0.01% 85 1652 0.01% 86 1811 0.01% 87 1983 0.01% 88 2097 0.01% 89 2404 0.01% 90 2591 0.01% 91 2807 0.01% 92 3131 0.02% 93 3410 0.02% 94 3793 0.02% 95 3896 0.02% 96 4469 0.02% 97 4926 0.02% 98 5106 0.02% 99 5526 0.03% 100 6130 0.03% 101 6628 0.03% 102 7170 0.04% 103 7607 0.04% 104 8134 0.04% 105 8896 0.04% 106 9480 0.05% 107 10118 0.05% 108 10707 0.05% 109 11200 0.05% 110 11885 0.06% 111 13182 0.06% 112 13429 0.07% 113 14467 0.07% 114 15586 0.08% 115 16378 0.08% 116 17448 0.09% 117 18217 0.09% 118 18727 0.09% 119 19786 0.10% 120 21188 0.10% 121 21911 0.11% 122 22834 0.11% 123 24221 0.12% 124 25173 0.12% 125 25895 0.13% 126 27304 0.13% 127 28264 0.14% 128 29174 0.14% 129 30179 0.15% 130 31026 0.15% 131 32125 0.16% 132 32974 0.16% 133 33729 0.17% 134 34427 0.17% 135 35267 0.17% 136 36254 0.18% 137 37464 0.18% 138 38848 0.19% 139 39582 0.19% 140 40163 0.20% 141 41101 0.20% 142 42402 0.21% 143 43443 0.21% 144 44612 0.22% 145 45339 0.22% 146 45497 0.22% 147 49360 0.24% 148 63043 0.31% 149 284414 1.39% 150 18820008 92.08% 20438479 reads passed initial QC criterion=sequence-density sequence-density=0.31 sequence-density-rank=1 fanout-score=3.71 fanout-score-rank=15 prefix-density=0.37 prefix-fanout=3.1 sequence=GTTTTCTCATTTGCA criterion=fanout-score sequence-density=0.02 sequence-density-rank=27 fanout-score=20.33 fanout-score-rank=1 prefix-density=0.18 prefix-fanout=2.7 sequence=CGCATCGCCGGCCCCCATCCACTTCCCTCCCGACAATTTCAAGCACTCTTTGACTCTCTTTTCAAAGTCCTTTTCATCTTTCCCTCGCGGTACTTGTTTGCTATCGGTCTCTCGCCCGTATTTAGCCTTGGACGGAATTTACCGCCCGATTGGGGCTGCATTCCCAAACAACCCGACTCGCAGACAGCGCCTCGTGGTGCGGCAGGGTCCAGCCACGACGGGGCTCTCACCCTCTCCGGCGCCCCTTTCCAGGGGACTTGGGCCTGGTCCGCCGCTGAGGACGCTTCTCCAGACTACAATTCGGACGCCGCAGGCGCCAGATTCTCAAGCTGGGCATTTCCCGGTTCGCTCGCCGTTACTAGGGGAATCCTTGTAAGTTTCTTTTCCT criterion=sequence-density sequence-density=0.42 sequence-density-rank=1 fanout-score=3.17 fanout-score-rank=16 prefix-density=0.49 prefix-fanout=2.7 sequence=TGCAAGTGCGGCAGTG criterion=fanout-score sequence-density=0.14 sequence-density-rank=17 fanout-score=14.32 fanout-score-rank=1 prefix-density=0.29 prefix-fanout=6.7 sequence=AAGGCCAAGATCCAGGACAAGGA SRR14639617 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 13:33:23 Started mapping on | Feb 10 13:33:24 Finished on | Feb 10 13:36:37 Mapping speed, Million of reads per hour | 381.24 Number of input reads | 20438479 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 17602122 Uniquely mapped reads % | 86.12% Average mapped length | 295.00 Number of splices: Total | 15620662 Number of splices: Annotated (sjdb) | 15270279 Number of splices: GT/AG | 15354406 Number of splices: GC/AG | 200181 Number of splices: AT/AC | 14849 Number of splices: Non-canonical | 51226 Mismatch rate per base, % | 0.51% Deletion rate per base | 0.03% Deletion average length | 2.94 Insertion rate per base | 0.02% Insertion average length | 2.56 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 492655 % of reads mapped to multiple loci | 2.41% Number of reads mapped to too many loci | 494893 % of reads mapped to too many loci | 2.42% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 8.31% % of reads unmapped: other | 0.74% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2343702 2343702 2343702 N_multimapping 492655 492655 492655 N_noFeature 657935 17418247 740570 N_ambiguous 210529 1517 108368 UnstrandedReadsAssigned:16733658 PositiveStrandReadsAssigned:182358 NegativeStrandReadsAssigned:16753184 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR14639617 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR14639617-trimmed-pair1.fastq SRR14639617-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,438,479 reads, 17,540,952 reads pseudoaligned [quant] estimated average fragment length: 290.946 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,066 rounds 52401 SRR14639617.ke.tsv 34699 SRR14639617.se.tsv 87100 total ==> SRR14639617.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1728.05 2178.59 66.8739 Potri.005G024800.1.v4.1 1035 745.054 189 13.4559 Potri.004G059700.1.v4.1 961 671.476 164 12.9554 Potri.007G009000.2.v4.1 1416 1126.05 0 0 Potri.003G141000.2.v4.1 2943 2653.05 858.228 17.1591 Potri.016G087400.1.v4.1 270 79.0287 1180 792.018 Potri.015G069301.1.v4.1 564 299.047 0 0 Potri.010G195200.1.v4.1 1773 1483.05 79 2.82558 Potri.012G127500.1.v4.1 977 687.344 1640 126.563 ==> SRR14639617.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 75 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 408 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 458 SRR14639617 completed mapping pipeline successfully