Starting /dee2/code/volunteer_pipeline.sh SRR14639618 current disk space = 3059209809920 free memory = 1565478312 SRR14639618 SRAfilesize 382efadc4e33a44a3463b572db151480 SRR14639618.sra SRR14639618.sra file validated SRR14639618 is paired end SRR14639618 is conventional basespace SRR14639618 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14639618_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.73125 32.0 32.0 32.0 32.0 32.0 2 31.61125 32.0 32.0 32.0 32.0 32.0 3 35.3275 37.0 32.0 37.0 32.0 37.0 4 36.12125 37.0 37.0 37.0 32.0 37.0 5 36.17 37.0 37.0 37.0 37.0 37.0 6 39.7405 41.0 41.0 41.0 37.0 41.0 7 39.91125 41.0 41.0 41.0 37.0 41.0 8 40.1805 41.0 41.0 41.0 37.0 41.0 9 40.20325 41.0 41.0 41.0 37.0 41.0 10-14 40.20555 41.0 41.0 41.0 38.6 41.0 15-19 40.20695 41.0 41.0 41.0 39.4 41.0 20-24 40.17665000000001 41.0 41.0 41.0 38.6 41.0 25-29 40.1779 41.0 41.0 41.0 38.6 41.0 30-34 40.1657 41.0 41.0 41.0 38.6 41.0 35-39 40.02105 41.0 41.0 41.0 37.0 41.0 40-44 39.99945 41.0 41.0 41.0 37.0 41.0 45-49 39.982800000000005 41.0 41.0 41.0 37.0 41.0 50-54 39.9319 41.0 41.0 41.0 37.0 41.0 55-59 39.83704999999999 41.0 41.0 41.0 37.0 41.0 60-64 39.764300000000006 41.0 41.0 41.0 37.0 41.0 65-69 39.618300000000005 41.0 41.0 41.0 37.0 41.0 70-74 39.477549999999994 41.0 41.0 41.0 37.0 41.0 75-79 39.03935 41.0 40.2 41.0 35.0 41.0 80-84 39.46835 41.0 41.0 41.0 37.0 41.0 85-89 39.44405 41.0 41.0 41.0 37.0 41.0 90-94 39.3771 41.0 41.0 41.0 37.0 41.0 95-99 39.34125 41.0 41.0 41.0 37.0 41.0 100-104 39.2181 41.0 41.0 41.0 37.0 41.0 105-109 39.0891 41.0 41.0 41.0 37.0 41.0 110-114 39.0157 41.0 41.0 41.0 36.0 41.0 115-119 39.107800000000005 41.0 41.0 41.0 36.0 41.0 120-124 39.03185 41.0 41.0 41.0 36.0 41.0 125-129 39.0048 41.0 41.0 41.0 35.0 41.0 130-134 38.66175 41.0 41.0 41.0 32.0 41.0 135-139 38.442750000000004 41.0 40.2 41.0 32.0 41.0 140-144 38.2183 41.0 39.4 41.0 32.0 41.0 145-149 37.946549999999995 41.0 37.0 41.0 32.0 41.0 150 37.723 41.0 37.0 41.0 27.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 1.0 23 2.0 24 5.0 25 8.0 26 10.0 27 16.0 28 14.0 29 26.0 30 32.0 31 28.0 32 49.0 33 57.0 34 69.0 35 94.0 36 97.0 37 155.0 38 265.0 39 517.0 40 2554.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.958239559889975 15.528882220555138 15.053763440860216 36.459114778694676 2 16.0 11.725 36.875 35.4 3 17.1 19.025 27.1 36.775000000000006 4 22.15 24.725 25.35 27.775 5 22.5 32.05 26.424999999999997 19.025 6 16.150000000000002 31.900000000000002 30.75 21.2 7 14.799999999999999 27.0 39.925 18.275 8 13.950000000000001 25.174999999999997 36.199999999999996 24.675 9 15.950000000000001 27.825 33.775 22.45 10-14 19.06 29.115000000000002 28.22 23.605 15-19 19.72 27.750000000000004 28.015 24.515 20-24 19.79 27.965 27.915 24.33 25-29 19.38 27.810000000000002 28.345 24.465 30-34 19.505 27.805000000000003 28.410000000000004 24.279999999999998 35-39 19.470000000000002 27.96 28.355000000000004 24.215 40-44 20.244999999999997 28.1 27.665 23.990000000000002 45-49 19.895 27.79 27.705000000000002 24.610000000000003 50-54 19.81 28.08 27.485 24.625 55-59 20.135 28.255000000000003 27.700000000000003 23.91 60-64 20.24 27.755000000000003 27.495000000000005 24.51 65-69 19.45 27.615000000000002 28.384999999999998 24.55 70-74 19.81 28.244999999999997 27.68 24.265 75-79 20.525 27.655 27.77 24.05 80-84 20.655 27.639999999999997 27.62 24.085 85-89 20.645 28.23 27.325 23.799999999999997 90-94 20.27 28.26 27.315 24.154999999999998 95-99 20.055 27.815 27.85 24.279999999999998 100-104 21.29 27.589999999999996 27.134999999999998 23.985 105-109 20.662066206620665 27.13271327132713 27.512751275127513 24.69246924692469 110-114 20.86 27.015 28.065 24.060000000000002 115-119 20.79 27.474999999999998 27.800000000000004 23.935000000000002 120-124 20.51 26.93 27.810000000000002 24.75 125-129 20.74 27.139999999999997 27.38 24.740000000000002 130-134 21.14 27.089999999999996 27.625 24.145 135-139 20.61 27.265 27.785 24.34 140-144 21.287128712871286 27.002700270027002 27.992799279927993 23.717371737173718 145-149 21.125 27.655 27.98 23.24 150 20.95 26.05 27.750000000000004 25.25 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 5.0 1 2.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 1.5 16 0.5 17 0.0 18 1.0 19 1.5 20 0.5 21 0.0 22 1.0 23 1.5 24 3.5 25 7.5 26 8.5 27 7.5 28 10.5 29 14.0 30 20.5 31 30.0 32 36.0 33 41.5 34 53.0 35 73.0 36 99.0 37 103.0 38 117.5 39 162.5 40 182.5 41 213.5 42 247.0 43 246.5 44 258.0 45 272.5 46 251.0 47 229.0 48 216.5 49 172.5 50 137.0 51 142.5 52 134.5 53 101.5 54 77.0 55 63.5 56 45.5 57 34.5 58 34.0 59 27.5 60 17.0 61 10.5 62 15.5 63 19.0 64 12.0 65 7.5 66 5.5 67 5.5 68 6.0 69 2.5 70 2.0 71 1.5 72 0.5 73 3.5 74 3.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.01 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.01 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.19999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 95.37815126050421 90.8 2 4.30672268907563 8.200000000000001 3 0.26260504201680673 0.75 4 0.026260504201680673 0.1 5 0.0 0.0 6 0.026260504201680673 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.0625 0.0 0.0 0.0 0.0 96-97 0.0875 0.0 0.0 0.0 0.0 98-99 0.1125 0.0 0.0 0.0 0.0 100-101 0.125 0.0 0.0 0.0 0.0 102-103 0.125 0.0 0.0 0.0 0.0 104-105 0.125 0.0 0.0 0.0 0.0 106-107 0.125 0.0 0.0 0.0 0.0 108-109 0.125 0.0 0.0 0.0 0.0 110-111 0.125 0.0 0.0 0.0 0.0 112-113 0.125 0.0 0.0 0.0 0.0 114-115 0.1375 0.0 0.0 0.0 0.0 116-117 0.15 0.0 0.0 0.0 0.0 118-119 0.15 0.0 0.0 0.0 0.0 120-121 0.175 0.0 0.0 0.0 0.0 122-123 0.1875 0.0 0.0 0.0 0.0 124-125 0.25 0.0 0.0 0.0 0.0 126-127 0.25 0.0 0.0 0.0 0.0 128-129 0.2625 0.0 0.0 0.0 0.0 130-131 0.275 0.0 0.0 0.0 0.0 132-133 0.3 0.0 0.0 0.0 0.0 134-135 0.3125 0.0 0.0 0.0 0.0 136-137 0.3375 0.0 0.0 0.0 0.0 138 0.35 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGCATAA 10 0.006973645 144.0 1 AATCACA 10 0.006973645 144.0 6 TAATCAC 10 0.006973645 144.0 5 ATCACAA 10 0.006973645 144.0 7 GCATAAT 10 0.006973645 144.0 2 TTATTAT 20 0.006139246 28.8 110-114 TATTATT 20 0.006139246 28.8 110-114 >>END_MODULE SRR14639618 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14639618_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.75 32.0 32.0 32.0 32.0 32.0 2 30.7825 32.0 32.0 32.0 32.0 32.0 3 33.295 37.0 32.0 37.0 27.0 37.0 4 34.7575 37.0 37.0 37.0 32.0 37.0 5 34.9475 37.0 37.0 37.0 32.0 37.0 6 38.13925 41.0 37.0 41.0 32.0 41.0 7 37.98425 41.0 37.0 41.0 32.0 41.0 8 37.97775 41.0 37.0 41.0 27.0 41.0 9 38.16325 41.0 41.0 41.0 32.0 41.0 10-14 38.32015 41.0 41.0 41.0 32.0 41.0 15-19 38.13695 41.0 41.0 41.0 32.0 41.0 20-24 37.993 41.0 39.4 41.0 29.0 41.0 25-29 37.80985 41.0 38.6 41.0 28.0 41.0 30-34 37.759550000000004 41.0 37.0 41.0 27.0 41.0 35-39 37.596500000000006 41.0 37.0 41.0 27.0 41.0 40-44 37.359249999999996 41.0 37.0 41.0 27.0 41.0 45-49 37.42885 41.0 37.0 41.0 27.0 41.0 50-54 37.26775000000001 41.0 37.0 41.0 27.0 41.0 55-59 37.17655 41.0 37.0 41.0 27.0 41.0 60-64 37.20185 41.0 37.0 41.0 27.0 41.0 65-69 36.93835 41.0 37.0 41.0 26.0 41.0 70-74 36.80225 41.0 37.0 41.0 25.0 41.0 75-79 35.96975 40.2 35.0 41.0 23.0 41.0 80-84 36.9498 41.0 37.0 41.0 22.0 41.0 85-89 36.9751 41.0 37.0 41.0 22.0 41.0 90-94 36.653 41.0 37.0 41.0 22.0 41.0 95-99 36.69695 41.0 37.0 41.0 22.0 41.0 100-104 36.49235 41.0 37.0 41.0 22.0 41.0 105-109 36.4714 41.0 37.0 41.0 22.0 41.0 110-114 36.4532 41.0 37.0 41.0 22.0 41.0 115-119 36.067449999999994 41.0 36.0 41.0 20.0 41.0 120-124 36.195100000000004 41.0 37.0 41.0 22.0 41.0 125-129 35.6315 41.0 35.0 41.0 20.0 41.0 130-134 35.605999999999995 41.0 36.0 41.0 22.0 41.0 135-139 35.20935000000001 41.0 34.0 41.0 18.0 41.0 140-144 34.9509 41.0 32.0 41.0 18.0 41.0 145-149 34.8272 41.0 32.0 41.0 14.0 41.0 150 34.6025 41.0 32.0 41.0 12.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 4.0 16 6.0 17 20.0 18 27.0 19 26.0 20 37.0 21 31.0 22 24.0 23 31.0 24 44.0 25 33.0 26 54.0 27 46.0 28 60.0 29 74.0 30 83.0 31 101.0 32 104.0 33 101.0 34 122.0 35 122.0 36 171.0 37 253.0 38 327.0 39 572.0 40 1527.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 33.69238476953908 28.632264529058116 12.5250501002004 25.150300601202403 2 19.35 26.25 35.3 19.1 3 19.0 27.175 35.075 18.75 4 23.375 31.775 22.925 21.925 5 22.425 37.85 22.6 17.125 6 18.075 35.825 26.825 19.275000000000002 7 21.375 22.725 35.475 20.424999999999997 8 17.05 23.575 32.425 26.950000000000003 9 20.45 26.075 29.525000000000002 23.95 10-14 22.255 28.705000000000002 26.915 22.125 15-19 22.25 27.884999999999998 27.605 22.259999999999998 20-24 22.835 28.54 27.139999999999997 21.485000000000003 25-29 22.634999999999998 28.139999999999997 27.395000000000003 21.83 30-34 23.064999999999998 28.144999999999996 27.08 21.709999999999997 35-39 22.5 28.375 27.47 21.654999999999998 40-44 22.505 27.57 27.089999999999996 22.835 45-49 22.900000000000002 27.29 27.96 21.85 50-54 23.06 28.244999999999997 27.200000000000003 21.495 55-59 23.125 28.12 27.045 21.709999999999997 60-64 23.515 27.224999999999998 27.71 21.55 65-69 23.685000000000002 27.92 27.355 21.04 70-74 23.244999999999997 27.925 27.1 21.73 75-79 23.625 28.24 26.474999999999998 21.66 80-84 23.59 27.800000000000004 27.150000000000002 21.46 85-89 23.275000000000002 27.555000000000003 27.589999999999996 21.58 90-94 23.785 27.24 27.13 21.845 95-99 23.53 27.62 27.33 21.52 100-104 23.7 28.335 26.56 21.404999999999998 105-109 23.695 27.43 27.07 21.805 110-114 24.305 27.48 26.625 21.59 115-119 24.125 27.3 26.625 21.95 120-124 24.005000000000003 27.41 26.815 21.77 125-129 23.595 27.13 27.034999999999997 22.24 130-134 23.724999999999998 27.634999999999998 26.945000000000004 21.695 135-139 23.685000000000002 27.705000000000002 26.889999999999997 21.72 140-144 24.2 26.840000000000003 27.105 21.855 145-149 23.665 27.474999999999998 26.950000000000003 21.91 150 23.875 26.75 26.75 22.625 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 1.0 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.5 20 0.5 21 0.5 22 2.5 23 2.5 24 0.5 25 2.5 26 4.5 27 3.0 28 5.0 29 9.5 30 13.5 31 16.0 32 28.5 33 40.0 34 52.0 35 72.0 36 83.0 37 104.5 38 132.5 39 161.5 40 193.0 41 216.0 42 248.0 43 267.0 44 267.0 45 268.0 46 252.5 47 227.5 48 204.5 49 185.0 50 163.5 51 135.5 52 109.5 53 95.0 54 83.5 55 66.5 56 54.0 57 46.0 58 34.0 59 30.0 60 29.5 61 20.0 62 15.5 63 13.5 64 6.5 65 6.0 66 7.0 67 4.5 68 4.5 69 3.0 70 2.0 71 1.5 72 1.0 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.2 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.875 #Duplication Level Percentage of deduplicated Percentage of total 1 96.01043024771838 92.05 2 3.728813559322034 7.1499999999999995 3 0.2346805736636245 0.675 4 0.0 0.0 5 0.02607561929595828 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ACCAGCTTGAGCAAATTCAGTTTCTAAGCAAAAGCTTTCCAGGCCCCTTT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.0625 0.0 0.0 0.0 0.0 96-97 0.0875 0.0 0.0 0.0 0.0 98-99 0.1125 0.0 0.0 0.0 0.0 100-101 0.15 0.0 0.0 0.0 0.0 102-103 0.15 0.0 0.0 0.0 0.0 104-105 0.16249999999999998 0.0 0.0 0.0 0.0 106-107 0.175 0.0 0.0 0.0 0.0 108-109 0.175 0.0 0.0 0.0 0.0 110-111 0.175 0.0 0.0 0.0 0.0 112-113 0.175 0.0 0.0 0.0 0.0 114-115 0.1875 0.0 0.0 0.0 0.0 116-117 0.2 0.0 0.0 0.0 0.0 118-119 0.225 0.0 0.0 0.0 0.0 120-121 0.225 0.0 0.0 0.0 0.0 122-123 0.2375 0.0 0.0 0.0 0.0 124-125 0.3 0.0 0.0 0.0 0.0 126-127 0.3 0.0 0.0 0.0 0.0 128-129 0.3125 0.0 0.0 0.0 0.0 130-131 0.35 0.0 0.0 0.0 0.0 132-133 0.3875 0.0 0.0 0.0 0.0 134-135 0.4125 0.0 0.0 0.0 0.0 136-137 0.4375 0.0 0.0 0.0 0.0 138 0.45 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AATTTTA 10 0.006973645 144.0 3 TTTTAGG 10 0.006973645 144.0 5 TTTAGGG 10 0.006973645 144.0 6 TTAGGGT 10 0.006973645 144.0 7 ATTTTAG 10 0.006973645 144.0 4 TTTTTTT 220 0.009731082 6.5454545 15-19 >>END_MODULE Read 966081 spots for SRR14639618.sra Written 966081 spots for SRR14639618.sra Read 966081 spots for SRR14639618.sra Written 966081 spots for SRR14639618.sra Read 966081 spots for SRR14639618.sra Written 966081 spots for SRR14639618.sra Read 966081 spots for SRR14639618.sra Written 966081 spots for SRR14639618.sra Read 966081 spots for SRR14639618.sra Written 966081 spots for SRR14639618.sra Read 966081 spots for SRR14639618.sra Written 966081 spots for SRR14639618.sra Read 966097 spots for SRR14639618.sra Written 966097 spots for SRR14639618.sra Read 966081 spots for SRR14639618.sra Written 966081 spots for SRR14639618.sra Read 966081 spots for SRR14639618.sra Written 966081 spots for SRR14639618.sra Read 966081 spots for SRR14639618.sra Written 966081 spots for SRR14639618.sra Read 966081 spots for SRR14639618.sra Written 966081 spots for SRR14639618.sra Read 966081 spots for SRR14639618.sra Written 966081 spots for SRR14639618.sra Read 966081 spots for SRR14639618.sra Written 966081 spots for SRR14639618.sra Read 966081 spots for SRR14639618.sra Written 966081 spots for SRR14639618.sra Read 966081 spots for SRR14639618.sra Written 966081 spots for SRR14639618.sra Read 966081 spots for SRR14639618.sra Written 966081 spots for SRR14639618.sra Read 966081 spots for SRR14639618.sra Written 966081 spots for SRR14639618.sra Read 966081 spots for SRR14639618.sra Written 966081 spots for SRR14639618.sra Read 966081 spots for SRR14639618.sra Written 966081 spots for SRR14639618.sra Read 966081 spots for SRR14639618.sra Written 966081 spots for SRR14639618.sra SRR ids: ['SRR14639618.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_7u5akhob SRR14639618.sra spots: 19321636 blocks: [[1, 966081], [966082, 1932162], [1932163, 2898243], [2898244, 3864324], [3864325, 4830405], [4830406, 5796486], [5796487, 6762567], [6762568, 7728648], [7728649, 8694729], [8694730, 9660810], [9660811, 10626891], [10626892, 11592972], [11592973, 12559053], [12559054, 13525134], [13525135, 14491215], [14491216, 15457296], [15457297, 16423377], [16423378, 17389458], [17389459, 18355539], [18355540, 19321636]] SRR14639618 file size 7150540 SRR14639618 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR14639618 SRR14639618_1.fastq SRR14639618_2.fastq Input file: SRR14639618_1.fastq Paired file: SRR14639618_2.fastq trimmed: SRR14639618-trimmed-pair1.fastq, SRR14639618-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 15:10:57 2025 >> started Mon Feb 10 15:11:26 2025 >> done (28.861s) 19321636 read pairs processed; of these: 73 ( 0.00%) short read pairs filtered out after trimming by size control 62 ( 0.00%) empty read pairs filtered out after trimming by size control 19321501 (100.00%) read pairs available; of these: 520692 ( 2.69%) trimmed read pairs available after processing 18800809 (97.31%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 21 0.00% 19 17 0.00% 20 16 0.00% 21 19 0.00% 22 36 0.00% 23 32 0.00% 24 32 0.00% 25 33 0.00% 26 31 0.00% 27 33 0.00% 28 47 0.00% 29 33 0.00% 30 52 0.00% 31 56 0.00% 32 47 0.00% 33 56 0.00% 34 46 0.00% 35 56 0.00% 36 67 0.00% 37 67 0.00% 38 91 0.00% 39 73 0.00% 40 64 0.00% 41 88 0.00% 42 75 0.00% 43 65 0.00% 44 73 0.00% 45 85 0.00% 46 85 0.00% 47 87 0.00% 48 106 0.00% 49 100 0.00% 50 105 0.00% 51 102 0.00% 52 90 0.00% 53 112 0.00% 54 122 0.00% 55 167 0.00% 56 137 0.00% 57 125 0.00% 58 143 0.00% 59 153 0.00% 60 174 0.00% 61 182 0.00% 62 213 0.00% 63 169 0.00% 64 183 0.00% 65 190 0.00% 66 213 0.00% 67 214 0.00% 68 233 0.00% 69 208 0.00% 70 267 0.00% 71 248 0.00% 72 257 0.00% 73 303 0.00% 74 318 0.00% 75 320 0.00% 76 327 0.00% 77 360 0.00% 78 359 0.00% 79 387 0.00% 80 414 0.00% 81 424 0.00% 82 480 0.00% 83 466 0.00% 84 555 0.00% 85 531 0.00% 86 621 0.00% 87 588 0.00% 88 647 0.00% 89 702 0.00% 90 724 0.00% 91 759 0.00% 92 863 0.00% 93 904 0.00% 94 905 0.00% 95 1008 0.01% 96 1031 0.01% 97 1104 0.01% 98 1082 0.01% 99 1198 0.01% 100 1230 0.01% 101 1304 0.01% 102 1400 0.01% 103 1517 0.01% 104 1548 0.01% 105 1753 0.01% 106 1765 0.01% 107 1852 0.01% 108 1937 0.01% 109 1907 0.01% 110 2036 0.01% 111 2240 0.01% 112 2220 0.01% 113 2415 0.01% 114 2537 0.01% 115 2746 0.01% 116 2771 0.01% 117 2892 0.01% 118 3057 0.02% 119 3171 0.02% 120 3238 0.02% 121 3518 0.02% 122 3486 0.02% 123 3759 0.02% 124 3934 0.02% 125 4046 0.02% 126 4364 0.02% 127 4502 0.02% 128 4743 0.02% 129 4835 0.03% 130 4925 0.03% 131 5103 0.03% 132 4910 0.03% 133 4997 0.03% 134 5014 0.03% 135 5171 0.03% 136 5456 0.03% 137 5545 0.03% 138 5865 0.03% 139 6209 0.03% 140 6078 0.03% 141 6426 0.03% 142 6593 0.03% 143 6748 0.03% 144 7065 0.04% 145 7319 0.04% 146 8145 0.04% 147 10801 0.06% 148 25297 0.13% 149 277126 1.43% 150 18800809 97.31% 19321501 reads passed initial QC criterion=sequence-density sequence-density=0.37 sequence-density-rank=1 fanout-score=2.31 fanout-score-rank=25 prefix-density=0.41 prefix-fanout=2.1 sequence=CAGGTGCAGTTTGATCCACA criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=40.83 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=5.1 sequence=CACCACCCATAGAATCAAGAAAGAGCTCTCAGTCTGTCAATCCTTACTATGTCTGGACCTGGTAAGTTTCCCCGTGTTGAGTCAAATTAAGCCGCAGGCTCCACTCCTGGTGGTGCCCTTCCGTCAATTCCTTTAAGTTTCAGCCTTGCGACCATACTCCCCCCAGAACCCAAAAACTTTGATTTCTCATAAGGTGCTGGCGGAGTCCTAAAAGCAACATCCGCCAATCCCTGGTCGGCATCGTTTATGGTTGAGACTAGGACGGTATCTGATCGTCTTCGAGCCCCCAACTTTCGTTCTTGATTAATGAAAACATCCTTGGCAAATGCTTTCGCAGTTGTTCGTCTTTCATAAATCCAAGAATTTCACCTCTGACTATGAAATACGAATGCCCCCGACTGTCCCTGTTAATCATTACTCCGATCCCGAAGGCCAACACAATAGGATCGAAATCCTATGATGTTATCCCATGCTAATGTATCCAGAGCGTAGGCTTGCTTTGAGCACTCTA criterion=sequence-density sequence-density=0.41 sequence-density-rank=1 fanout-score=4.05 fanout-score-rank=12 prefix-density=0.54 prefix-fanout=3.1 sequence=CTGCAAATGTGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=51.21 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=6.9 sequence=ATTTTCTTTGAGAGTGCATAGATTTGTGTTGATATAGAAAACAATGGCACTACATGGAAAGATTGAGACAACATTAGAACTCAAGTCCTCCGCAGAGAAGTTCTACAAAGTGTGGAGGAGCCAGTCCTTCCATGTTCCCAAACATGCTTCCAAGCATATCCAAGGAGTTGATATACATGCAGGTGACTGGGAGACTGCGGGCTCTATCAGGATTTGGCAGTACACAATCGGAGGGAAAGCCGGGGTCTTTAAAGAGGAGGTTTCCTTCGATGATGAGAACAAGATCATAACTCTTAATGGTTTGGAAGGAGATGTCATGAAAATTTACAAGGTCTATAGGCCCGTCTGGCAGCTTACACCAAAAGGCTCGGGCTGCTTGGCAAAACTGACCATTGAATACGAAAAACTCCATCCTGAAGTCCCGGTTCCAGAGATTTATGTTGATCTTATGGTTCATATGACTAAAGACATCGACGAAGCCCTTAGCACGGAGTAATAGAAGGGGTCATCG SRR14639618 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 15:12:26 Started mapping on | Feb 10 15:12:27 Finished on | Feb 10 15:19:19 Mapping speed, Million of reads per hour | 168.83 Number of input reads | 19321501 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 15196468 Uniquely mapped reads % | 78.65% Average mapped length | 297.15 Number of splices: Total | 12922014 Number of splices: Annotated (sjdb) | 12665525 Number of splices: GT/AG | 12713957 Number of splices: GC/AG | 155026 Number of splices: AT/AC | 11791 Number of splices: Non-canonical | 41240 Mismatch rate per base, % | 0.54% Deletion rate per base | 0.03% Deletion average length | 2.96 Insertion rate per base | 0.02% Insertion average length | 2.61 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 462148 % of reads mapped to multiple loci | 2.39% Number of reads mapped to too many loci | 262391 % of reads mapped to too many loci | 1.36% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 16.91% % of reads unmapped: other | 0.69% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 3662885 3662885 3662885 N_multimapping 462148 462148 462148 N_noFeature 405991 15055115 461464 N_ambiguous 193264 1163 106746 UnstrandedReadsAssigned:14597213 PositiveStrandReadsAssigned:140190 NegativeStrandReadsAssigned:14628258 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR14639618 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR14639618-trimmed-pair1.fastq SRR14639618-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,321,501 reads, 15,401,035 reads pseudoaligned [quant] estimated average fragment length: 329.384 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,079 rounds 52401 SRR14639618.ke.tsv 34699 SRR14639618.se.tsv 87100 total ==> SRR14639618.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1689.62 2507 73.7945 Potri.005G024800.1.v4.1 1035 706.616 980 68.9764 Potri.004G059700.1.v4.1 961 632.855 113 8.88039 Potri.007G009000.2.v4.1 1416 1087.62 0 0 Potri.003G141000.2.v4.1 2943 2614.62 734 13.9619 Potri.016G087400.1.v4.1 270 51.458 1168.7 1129.56 Potri.015G069301.1.v4.1 564 254.544 0 0 Potri.010G195200.1.v4.1 1773 1444.62 50 1.72137 Potri.012G127500.1.v4.1 977 648.728 1950 149.496 ==> SRR14639618.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 93 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 287 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 5 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 279 SRR14639618 completed mapping pipeline successfully