Starting /dee2/code/volunteer_pipeline.sh SRR14639619 current disk space = 3059086958592 free memory = 1270717312 SRR14639619 SRAfilesize f16ed670ecebbe745f8887c42820f952 SRR14639619.sra SRR14639619.sra file validated SRR14639619 is paired end SRR14639619 is conventional basespace SRR14639619 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14639619_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.69625 32.0 32.0 32.0 32.0 32.0 2 31.62125 32.0 32.0 32.0 32.0 32.0 3 35.26125 37.0 32.0 37.0 32.0 37.0 4 36.09125 37.0 37.0 37.0 32.0 37.0 5 36.195 37.0 37.0 37.0 37.0 37.0 6 39.59525 41.0 41.0 41.0 37.0 41.0 7 39.7755 41.0 41.0 41.0 37.0 41.0 8 40.05375 41.0 41.0 41.0 37.0 41.0 9 40.14075 41.0 41.0 41.0 37.0 41.0 10-14 40.10535 41.0 41.0 41.0 37.8 41.0 15-19 40.1085 41.0 41.0 41.0 37.0 41.0 20-24 40.12985 41.0 41.0 41.0 37.0 41.0 25-29 40.073350000000005 41.0 41.0 41.0 37.0 41.0 30-34 40.06735 41.0 41.0 41.0 37.0 41.0 35-39 39.965250000000005 41.0 41.0 41.0 37.0 41.0 40-44 39.90535 41.0 41.0 41.0 37.0 41.0 45-49 39.85545 41.0 41.0 41.0 37.0 41.0 50-54 39.776199999999996 41.0 41.0 41.0 37.0 41.0 55-59 39.726 41.0 41.0 41.0 37.0 41.0 60-64 39.6725 41.0 41.0 41.0 37.0 41.0 65-69 39.50445 41.0 41.0 41.0 37.0 41.0 70-74 39.43915 41.0 41.0 41.0 37.0 41.0 75-79 38.910250000000005 41.0 39.4 41.0 35.0 41.0 80-84 39.3212 41.0 41.0 41.0 37.0 41.0 85-89 39.268499999999996 41.0 41.0 41.0 37.0 41.0 90-94 39.3019 41.0 41.0 41.0 37.0 41.0 95-99 39.2071 41.0 41.0 41.0 37.0 41.0 100-104 39.15595 41.0 41.0 41.0 37.0 41.0 105-109 39.02165 41.0 41.0 41.0 35.0 41.0 110-114 38.99485 41.0 41.0 41.0 34.0 41.0 115-119 38.86405 41.0 41.0 41.0 34.0 41.0 120-124 38.8449 41.0 41.0 41.0 32.0 41.0 125-129 38.84005 41.0 41.0 41.0 33.0 41.0 130-134 38.6409 41.0 41.0 41.0 32.0 41.0 135-139 38.3741 41.0 40.2 41.0 32.0 41.0 140-144 38.1044 41.0 37.8 41.0 32.0 41.0 145-149 37.78045 41.0 37.0 41.0 32.0 41.0 150 37.71325 41.0 37.0 41.0 32.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 3.0 22 3.0 23 3.0 24 5.0 25 7.0 26 7.0 27 16.0 28 14.0 29 21.0 30 30.0 31 44.0 32 48.0 33 69.0 34 71.0 35 95.0 36 112.0 37 167.0 38 284.0 39 562.0 40 2439.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.800000000000004 14.299999999999999 15.225 37.675 2 16.3 11.899999999999999 39.675 32.125 3 17.45 18.925 29.025000000000002 34.599999999999994 4 23.5 24.45 25.624999999999996 26.424999999999997 5 22.95 31.65 25.974999999999998 19.425 6 16.950000000000003 29.875 30.025000000000002 23.150000000000002 7 16.25 26.0 39.725 18.025 8 15.25 23.575 37.225 23.95 9 17.549999999999997 25.25 34.175 23.025000000000002 10-14 20.395 28.07 28.060000000000002 23.474999999999998 15-19 20.27 27.275 28.125 24.33 20-24 20.19 27.765 28.095 23.95 25-29 20.405 27.77 28.125 23.7 30-34 20.335 27.425 28.37 23.87 35-39 20.45 27.884999999999998 27.644999999999996 24.02 40-44 20.485 27.775 27.92 23.82 45-49 20.349999999999998 27.584999999999997 27.67 24.395 50-54 20.435 27.865000000000002 27.615000000000002 24.085 55-59 20.94 27.49 27.575 23.995 60-64 20.9 28.26 27.215 23.625 65-69 20.955 26.99 28.285 23.77 70-74 20.294999999999998 28.015 27.139999999999997 24.55 75-79 21.36 27.045 27.74 23.855 80-84 21.465 27.089999999999996 26.875 24.57 85-89 20.985 27.625 27.139999999999997 24.25 90-94 21.23 27.1 27.26 24.41 95-99 20.93 27.74 27.500000000000004 23.830000000000002 100-104 21.445 27.04 27.295 24.22 105-109 21.266063303165158 27.66638331916596 27.2063603180159 23.861193059652983 110-114 21.075 27.21 27.834999999999997 23.880000000000003 115-119 21.495 26.669999999999998 27.67 24.165 120-124 21.435000000000002 26.889999999999997 27.345000000000002 24.33 125-129 21.94 27.38 26.71 23.97 130-134 21.495 27.275 27.51 23.72 135-139 22.02 26.669999999999998 27.634999999999998 23.674999999999997 140-144 22.03830574586188 26.90903635545332 27.35410311546732 23.69855478321748 145-149 21.905 26.91 27.029999999999998 24.154999999999998 150 22.05 25.874999999999996 26.950000000000003 25.124999999999996 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 3.0 1 1.5 2 0.5 3 1.0 4 1.5 5 1.0 6 0.0 7 0.5 8 1.0 9 1.0 10 0.5 11 0.0 12 0.0 13 0.5 14 0.5 15 0.5 16 1.0 17 1.0 18 0.5 19 0.0 20 0.5 21 4.5 22 7.0 23 4.5 24 3.0 25 4.5 26 5.0 27 7.0 28 11.0 29 13.5 30 21.0 31 26.5 32 33.5 33 42.5 34 49.5 35 60.5 36 75.0 37 98.5 38 131.0 39 153.5 40 172.0 41 203.0 42 219.5 43 235.5 44 237.5 45 236.0 46 225.0 47 212.5 48 208.0 49 196.0 50 176.0 51 147.0 52 134.5 53 118.0 54 98.0 55 81.5 56 67.5 57 54.0 58 46.0 59 37.5 60 31.5 61 21.0 62 11.0 63 15.0 64 16.0 65 10.0 66 6.5 67 5.5 68 5.0 69 2.5 70 1.5 71 1.5 72 0.5 73 1.0 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.005 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.015 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.45 #Duplication Level Percentage of deduplicated Percentage of total 1 95.62598218962808 91.27499999999999 2 4.138292299633315 7.9 3 0.18334206390780514 0.525 4 0.026191723415400735 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.026191723415400735 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 8 0.2 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.0625 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.075 0.0 0.0 0.0 0.0 102-103 0.075 0.0 0.0 0.0 0.0 104-105 0.1 0.0 0.0 0.0 0.0 106-107 0.1 0.0 0.0 0.0 0.0 108-109 0.1 0.0 0.0 0.0 0.0 110-111 0.1125 0.0 0.0 0.0 0.0 112-113 0.125 0.0 0.0 0.0 0.0 114-115 0.125 0.0 0.0 0.0 0.0 116-117 0.125 0.0 0.0 0.0 0.0 118-119 0.125 0.0 0.0 0.0 0.0 120-121 0.125 0.0 0.0 0.0 0.0 122-123 0.125 0.0 0.0 0.0 0.0 124-125 0.125 0.0 0.0 0.0 0.0 126-127 0.125 0.0 0.0 0.0 0.0 128-129 0.1625 0.0 0.0 0.0 0.0 130-131 0.2 0.0 0.0 0.0 0.0 132-133 0.2 0.0 0.0 0.0 0.0 134-135 0.2375 0.0 0.0 0.0 0.0 136-137 0.2625 0.0 0.0 0.0 0.0 138 0.3 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CACTCTC 10 0.006973645 144.0 5 >>END_MODULE SRR14639619 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14639619_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.65625 32.0 32.0 32.0 27.0 32.0 2 30.57125 32.0 32.0 32.0 27.0 32.0 3 33.21375 37.0 32.0 37.0 27.0 37.0 4 34.7325 37.0 37.0 37.0 32.0 37.0 5 34.98375 37.0 37.0 37.0 32.0 37.0 6 38.15275 41.0 37.0 41.0 32.0 41.0 7 37.91775 41.0 37.0 41.0 32.0 41.0 8 37.94625 41.0 37.0 41.0 27.0 41.0 9 38.373 41.0 41.0 41.0 32.0 41.0 10-14 38.4639 41.0 41.0 41.0 32.0 41.0 15-19 38.251400000000004 41.0 40.2 41.0 32.0 41.0 20-24 38.13385000000001 41.0 40.2 41.0 31.0 41.0 25-29 37.7812 41.0 37.0 41.0 28.0 41.0 30-34 37.71925 41.0 37.0 41.0 27.0 41.0 35-39 37.5607 41.0 37.0 41.0 27.0 41.0 40-44 37.346999999999994 41.0 37.0 41.0 27.0 41.0 45-49 37.3236 41.0 37.0 41.0 27.0 41.0 50-54 37.286649999999995 41.0 37.0 41.0 27.0 41.0 55-59 37.2202 41.0 37.0 41.0 27.0 41.0 60-64 37.1351 41.0 37.0 41.0 27.0 41.0 65-69 36.892 41.0 37.0 41.0 26.0 41.0 70-74 36.59465 41.0 37.0 41.0 23.0 41.0 75-79 35.93685 40.2 35.0 41.0 23.0 41.0 80-84 36.897149999999996 41.0 37.0 41.0 23.0 41.0 85-89 36.920100000000005 41.0 37.0 41.0 23.0 41.0 90-94 36.61555 41.0 37.0 41.0 22.0 41.0 95-99 36.644549999999995 41.0 37.0 41.0 22.0 41.0 100-104 36.2967 41.0 37.0 41.0 20.0 41.0 105-109 36.346149999999994 41.0 37.0 41.0 22.0 41.0 110-114 36.33015 41.0 37.0 41.0 22.0 41.0 115-119 35.9174 41.0 35.0 41.0 20.0 41.0 120-124 36.057399999999994 41.0 37.0 41.0 22.0 41.0 125-129 35.438550000000006 41.0 34.0 41.0 20.0 41.0 130-134 35.51389999999999 41.0 34.0 41.0 22.0 41.0 135-139 35.087650000000004 41.0 33.0 41.0 18.0 41.0 140-144 34.7469 41.0 32.0 41.0 18.0 41.0 145-149 34.636199999999995 40.2 32.0 41.0 12.0 41.0 150 34.35725 41.0 32.0 41.0 12.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 2.0 15 4.0 16 11.0 17 19.0 18 24.0 19 30.0 20 22.0 21 36.0 22 35.0 23 26.0 24 39.0 25 29.0 26 45.0 27 49.0 28 69.0 29 71.0 30 92.0 31 79.0 32 100.0 33 107.0 34 143.0 35 151.0 36 160.0 37 263.0 38 381.0 39 602.0 40 1411.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 33.2415519399249 28.585732165206508 11.214017521902377 26.958698372966204 2 18.425 24.625 38.875 18.075 3 17.224999999999998 26.950000000000003 35.025 20.8 4 22.650000000000002 32.074999999999996 23.549999999999997 21.725 5 22.825 37.55 22.0 17.625 6 17.875 36.975 24.125 21.025 7 19.3 23.125 35.775 21.8 8 16.925 24.025 32.775 26.275 9 19.925 26.625 27.750000000000004 25.7 10-14 21.915000000000003 28.51 26.115 23.46 15-19 22.535 27.82 26.665 22.98 20-24 22.46 27.395000000000003 27.365000000000002 22.78 25-29 22.725 27.255000000000003 27.315 22.705000000000002 30-34 22.7 27.200000000000003 26.950000000000003 23.150000000000002 35-39 21.955 28.044999999999998 27.575 22.425 40-44 22.825 27.810000000000002 26.765 22.6 45-49 23.03 26.965 27.185 22.82 50-54 24.125 27.205000000000002 26.045 22.625 55-59 23.595 27.015 26.805 22.585 60-64 22.75 27.544999999999998 26.729999999999997 22.975 65-69 23.215 27.615000000000002 26.840000000000003 22.33 70-74 23.01 27.195000000000004 26.895000000000003 22.900000000000002 75-79 23.315 27.735 26.31 22.64 80-84 23.294999999999998 27.685 26.584999999999997 22.435 85-89 23.605 27.175 26.66 22.56 90-94 23.34 26.775 27.200000000000003 22.685 95-99 23.43 27.72 26.284999999999997 22.564999999999998 100-104 24.16 26.700000000000003 26.55 22.59 105-109 23.485 27.96 26.169999999999998 22.384999999999998 110-114 23.59 27.115000000000002 26.755000000000003 22.54 115-119 23.235 26.729999999999997 27.48 22.555 120-124 23.425 26.855 26.625 23.095 125-129 23.275000000000002 26.57 26.640000000000004 23.515 130-134 24.12 27.3 26.355 22.225 135-139 23.72 26.915 26.07 23.294999999999998 140-144 23.785 27.089999999999996 26.895000000000003 22.23 145-149 23.315 27.295 26.615 22.775000000000002 150 23.3 27.425 27.150000000000002 22.125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 1.0 20 1.5 21 1.0 22 2.5 23 3.0 24 2.0 25 2.5 26 2.5 27 3.0 28 10.5 29 14.5 30 12.0 31 14.5 32 19.0 33 32.5 34 54.5 35 70.0 36 83.0 37 102.5 38 121.5 39 142.0 40 172.0 41 206.5 42 227.0 43 214.5 44 210.5 45 216.0 46 223.0 47 229.0 48 206.5 49 208.5 50 197.0 51 155.5 52 136.5 53 124.0 54 101.5 55 81.5 56 73.0 57 66.0 58 58.0 59 47.0 60 34.0 61 22.5 62 17.0 63 15.5 64 17.5 65 13.0 66 9.0 67 9.5 68 4.5 69 1.5 70 2.0 71 2.0 72 1.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.125 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.175 #Duplication Level Percentage of deduplicated Percentage of total 1 96.412789186379 92.72500000000001 2 3.275279438523525 6.3 3 0.23394853132310892 0.675 4 0.07798284377436965 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0125 0.0 0.0 0.0 0.0 36-37 0.037500000000000006 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.07500000000000001 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.1125 0.0 0.0 0.0 0.0 98-99 0.125 0.0 0.0 0.0 0.0 100-101 0.125 0.0 0.0 0.0 0.0 102-103 0.125 0.0 0.0 0.0 0.0 104-105 0.125 0.0 0.0 0.0 0.0 106-107 0.125 0.0 0.0 0.0 0.0 108-109 0.125 0.0 0.0 0.0 0.0 110-111 0.1375 0.0 0.0 0.0 0.0 112-113 0.15 0.0 0.0 0.0 0.0 114-115 0.15 0.0 0.0 0.0 0.0 116-117 0.15 0.0 0.0 0.0 0.0 118-119 0.15 0.0 0.0 0.0 0.0 120-121 0.15 0.0 0.0 0.0 0.0 122-123 0.1875 0.0 0.0 0.0 0.0 124-125 0.2 0.0 0.0 0.0 0.0 126-127 0.21250000000000002 0.0 0.0 0.0 0.0 128-129 0.2625 0.0 0.0 0.0 0.0 130-131 0.3 0.0 0.0 0.0 0.0 132-133 0.3 0.0 0.0 0.0 0.0 134-135 0.3 0.0 0.0 0.0 0.0 136-137 0.32499999999999996 0.0 0.0 0.0 0.0 138 0.35 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTAGAAA 10 0.006973645 144.0 2 ATTAGAA 10 0.006973645 144.0 1 >>END_MODULE Read 1166188 spots for SRR14639619.sra Written 1166188 spots for SRR14639619.sra Read 1166188 spots for SRR14639619.sra Written 1166188 spots for SRR14639619.sra Read 1166188 spots for SRR14639619.sra Written 1166188 spots for SRR14639619.sra Read 1166188 spots for SRR14639619.sra Written 1166188 spots for SRR14639619.sra Read 1166188 spots for SRR14639619.sra Written 1166188 spots for SRR14639619.sra Read 1166188 spots for SRR14639619.sra Written 1166188 spots for SRR14639619.sra Read 1166188 spots for SRR14639619.sra Written 1166188 spots for SRR14639619.sra Read 1166188 spots for SRR14639619.sra Written 1166188 spots for SRR14639619.sra Read 1166188 spots for SRR14639619.sra Written 1166188 spots for SRR14639619.sra Read 1166188 spots for SRR14639619.sra Written 1166188 spots for SRR14639619.sra Read 1166188 spots for SRR14639619.sra Written 1166188 spots for SRR14639619.sra Read 1166188 spots for SRR14639619.sra Written 1166188 spots for SRR14639619.sra Read 1166188 spots for SRR14639619.sra Written 1166188 spots for SRR14639619.sra Read 1166188 spots for SRR14639619.sra Written 1166188 spots for SRR14639619.sra Read 1166188 spots for SRR14639619.sra Written 1166188 spots for SRR14639619.sra Read 1166188 spots for SRR14639619.sra Written 1166188 spots for SRR14639619.sra Read 1166188 spots for SRR14639619.sra Written 1166188 spots for SRR14639619.sra Read 1166188 spots for SRR14639619.sra Written 1166188 spots for SRR14639619.sra Read 1166188 spots for SRR14639619.sra Written 1166188 spots for SRR14639619.sra Read 1166204 spots for SRR14639619.sra Written 1166204 spots for SRR14639619.sra SRR ids: ['SRR14639619.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_v2ta4k0b SRR14639619.sra spots: 23323776 blocks: [[1, 1166188], [1166189, 2332376], [2332377, 3498564], [3498565, 4664752], [4664753, 5830940], [5830941, 6997128], [6997129, 8163316], [8163317, 9329504], [9329505, 10495692], [10495693, 11661880], [11661881, 12828068], [12828069, 13994256], [13994257, 15160444], [15160445, 16326632], [16326633, 17492820], [17492821, 18659008], [18659009, 19825196], [19825197, 20991384], [20991385, 22157572], [22157573, 23323776]] SRR14639619 file size 8633928 SRR14639619 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR14639619 SRR14639619_1.fastq SRR14639619_2.fastq Input file: SRR14639619_1.fastq Paired file: SRR14639619_2.fastq trimmed: SRR14639619-trimmed-pair1.fastq, SRR14639619-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 13:59:37 2025 >> started Mon Feb 10 14:00:08 2025 >> done (30.133s) 23323776 read pairs processed; of these: 73 ( 0.00%) short read pairs filtered out after trimming by size control 56 ( 0.00%) empty read pairs filtered out after trimming by size control 23323647 (100.00%) read pairs available; of these: 606930 ( 2.60%) trimmed read pairs available after processing 22716717 (97.40%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 11 0.00% 19 16 0.00% 20 13 0.00% 21 18 0.00% 22 18 0.00% 23 31 0.00% 24 25 0.00% 25 42 0.00% 26 43 0.00% 27 33 0.00% 28 56 0.00% 29 37 0.00% 30 48 0.00% 31 57 0.00% 32 61 0.00% 33 57 0.00% 34 58 0.00% 35 49 0.00% 36 77 0.00% 37 72 0.00% 38 80 0.00% 39 84 0.00% 40 76 0.00% 41 82 0.00% 42 114 0.00% 43 87 0.00% 44 83 0.00% 45 101 0.00% 46 93 0.00% 47 100 0.00% 48 88 0.00% 49 113 0.00% 50 139 0.00% 51 101 0.00% 52 125 0.00% 53 104 0.00% 54 130 0.00% 55 144 0.00% 56 143 0.00% 57 159 0.00% 58 156 0.00% 59 158 0.00% 60 185 0.00% 61 166 0.00% 62 170 0.00% 63 175 0.00% 64 210 0.00% 65 229 0.00% 66 221 0.00% 67 211 0.00% 68 212 0.00% 69 257 0.00% 70 242 0.00% 71 250 0.00% 72 298 0.00% 73 307 0.00% 74 320 0.00% 75 315 0.00% 76 350 0.00% 77 370 0.00% 78 363 0.00% 79 402 0.00% 80 428 0.00% 81 477 0.00% 82 525 0.00% 83 507 0.00% 84 539 0.00% 85 601 0.00% 86 586 0.00% 87 644 0.00% 88 627 0.00% 89 716 0.00% 90 709 0.00% 91 784 0.00% 92 779 0.00% 93 855 0.00% 94 927 0.00% 95 913 0.00% 96 969 0.00% 97 1090 0.00% 98 1102 0.00% 99 1253 0.01% 100 1304 0.01% 101 1265 0.01% 102 1382 0.01% 103 1421 0.01% 104 1435 0.01% 105 1682 0.01% 106 1707 0.01% 107 1765 0.01% 108 1874 0.01% 109 1974 0.01% 110 1966 0.01% 111 2086 0.01% 112 2199 0.01% 113 2290 0.01% 114 2524 0.01% 115 2521 0.01% 116 2626 0.01% 117 2830 0.01% 118 2991 0.01% 119 2988 0.01% 120 3269 0.01% 121 3310 0.01% 122 3490 0.01% 123 3472 0.01% 124 3747 0.02% 125 3947 0.02% 126 4221 0.02% 127 4311 0.02% 128 4394 0.02% 129 4758 0.02% 130 4564 0.02% 131 5007 0.02% 132 4660 0.02% 133 5018 0.02% 134 4973 0.02% 135 5266 0.02% 136 5350 0.02% 137 5530 0.02% 138 5766 0.02% 139 6061 0.03% 140 5963 0.03% 141 6327 0.03% 142 6633 0.03% 143 6804 0.03% 144 7201 0.03% 145 7108 0.03% 146 8164 0.04% 147 11365 0.05% 148 29796 0.13% 149 362059 1.55% 150 22716717 97.40% 23323647 reads passed initial QC criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=2.96 fanout-score-rank=28 prefix-density=0.32 prefix-fanout=2.4 sequence=CAGGTGCAGTTTGATCC criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=229.54 fanout-score-rank=1 prefix-density=0.19 prefix-fanout=17.1 sequence=TTCATCAAAAAGTACAATCAATTATCCATATTTCCGATGAGAGTGTAAAGTAGACGCGACATTGACTCTCAATAGTTTACAGCAATACGTTCAGATACTCTTGTTGATTTCCTGCTGAGCCTCACCCTTGTCACGGCGCGTGTTACCAGCTGCCTGTTGGGTTTT criterion=sequence-density sequence-density=0.30 sequence-density-rank=1 fanout-score=4.01 fanout-score-rank=9 prefix-density=0.39 prefix-fanout=3.1 sequence=CTGCAAATGTGG criterion=fanout-score sequence-density=0.02 sequence-density-rank=32 fanout-score=34.80 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=7.9 sequence=CAACAACACTACTACCCCTCAACCTCTTAAGAATACAAGTTGTGCGTCATGTCCCTGGTTTTCACAGGAAAGTTCAACTACTCGCCCTACGCCTCTAACGAGAACATCTTTGTTGTTCTCCTTGACGGATGGGTCGAGCGCGGTGGCGTACTTGTTTTTTCGACTTTCACCAAGGATGCATCCGGAGTCGACAAGCGCCCCTTCGACCTTACAACCAAATACGTTCTCAAAGCGTCTGACTCTGACGTCAAGAAGT SRR14639619 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 14:01:21 Started mapping on | Feb 10 14:01:22 Finished on | Feb 10 14:14:53 Mapping speed, Million of reads per hour | 103.53 Number of input reads | 23323647 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 16248297 Uniquely mapped reads % | 69.66% Average mapped length | 297.30 Number of splices: Total | 13761707 Number of splices: Annotated (sjdb) | 13470549 Number of splices: GT/AG | 13532420 Number of splices: GC/AG | 171692 Number of splices: AT/AC | 12436 Number of splices: Non-canonical | 45159 Mismatch rate per base, % | 0.55% Deletion rate per base | 0.03% Deletion average length | 2.98 Insertion rate per base | 0.02% Insertion average length | 2.63 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 466434 % of reads mapped to multiple loci | 2.00% Number of reads mapped to too many loci | 50454 % of reads mapped to too many loci | 0.22% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 27.89% % of reads unmapped: other | 0.23% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 6608916 6608916 6608916 N_multimapping 466434 466434 466434 N_noFeature 517774 16112721 573096 N_ambiguous 196192 1035 115387 UnstrandedReadsAssigned:15534331 PositiveStrandReadsAssigned:134541 NegativeStrandReadsAssigned:15559814 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR14639619 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR14639619-trimmed-pair1.fastq SRR14639619-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,323,647 reads, 16,248,898 reads pseudoaligned [quant] estimated average fragment length: 339.983 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,118 rounds 52401 SRR14639619.ke.tsv 34699 SRR14639619.se.tsv 87100 total ==> SRR14639619.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1679.02 2882.62 91.1054 Potri.005G024800.1.v4.1 1035 696.017 777 59.2398 Potri.004G059700.1.v4.1 961 622.308 151 12.8761 Potri.007G009000.2.v4.1 1416 1077.02 0 0 Potri.003G141000.2.v4.1 2943 2604.02 790.4 16.107 Potri.016G087400.1.v4.1 270 50.2353 1117 1179.93 Potri.015G069301.1.v4.1 564 247.934 0 0 Potri.010G195200.1.v4.1 1773 1434.02 72 2.66435 Potri.012G127500.1.v4.1 977 638.205 2620 217.848 ==> SRR14639619.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 100 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 239 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 11 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 296 SRR14639619 completed mapping pipeline successfully