Starting /dee2/code/volunteer_pipeline.sh SRR14639620 current disk space = 3058969772032 free memory = 1271754004 SRR14639620 SRAfilesize 7703f6ef718486a1c9a70db0f52fc5d8 SRR14639620.sra SRR14639620.sra file validated SRR14639620 is paired end SRR14639620 is conventional basespace SRR14639620 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14639620_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.6925 32.0 32.0 32.0 32.0 32.0 2 31.58375 32.0 32.0 32.0 32.0 32.0 3 35.39375 37.0 37.0 37.0 32.0 37.0 4 36.09375 37.0 37.0 37.0 32.0 37.0 5 36.24375 37.0 37.0 37.0 37.0 37.0 6 39.79425 41.0 41.0 41.0 37.0 41.0 7 39.8905 41.0 41.0 41.0 37.0 41.0 8 40.14675 41.0 41.0 41.0 37.0 41.0 9 40.12875 41.0 41.0 41.0 37.0 41.0 10-14 40.22135 41.0 41.0 41.0 38.6 41.0 15-19 40.184799999999996 41.0 41.0 41.0 37.8 41.0 20-24 40.212149999999994 41.0 41.0 41.0 37.8 41.0 25-29 40.122699999999995 41.0 41.0 41.0 37.8 41.0 30-34 40.091950000000004 41.0 41.0 41.0 37.0 41.0 35-39 40.01795 41.0 41.0 41.0 37.8 41.0 40-44 39.929550000000006 41.0 41.0 41.0 37.0 41.0 45-49 39.9217 41.0 41.0 41.0 37.0 41.0 50-54 39.82055 41.0 41.0 41.0 37.0 41.0 55-59 39.746750000000006 41.0 41.0 41.0 37.0 41.0 60-64 39.682750000000006 41.0 41.0 41.0 37.0 41.0 65-69 39.517399999999995 41.0 41.0 41.0 37.0 41.0 70-74 39.39104999999999 41.0 41.0 41.0 37.0 41.0 75-79 38.9243 41.0 40.2 41.0 35.0 41.0 80-84 39.34845 41.0 41.0 41.0 37.0 41.0 85-89 39.35725 41.0 41.0 41.0 37.0 41.0 90-94 39.2348 41.0 41.0 41.0 37.0 41.0 95-99 39.227549999999994 41.0 41.0 41.0 37.0 41.0 100-104 39.022850000000005 41.0 41.0 41.0 36.0 41.0 105-109 39.070350000000005 41.0 41.0 41.0 37.0 41.0 110-114 38.9852 41.0 41.0 41.0 35.0 41.0 115-119 38.9934 41.0 41.0 41.0 35.0 41.0 120-124 38.85435 41.0 41.0 41.0 32.0 41.0 125-129 38.83555 41.0 41.0 41.0 32.0 41.0 130-134 38.576699999999995 41.0 41.0 41.0 32.0 41.0 135-139 38.3155 41.0 39.4 41.0 32.0 41.0 140-144 38.03135 41.0 37.0 41.0 32.0 41.0 145-149 37.73545 41.0 37.0 41.0 30.0 41.0 150 37.745 41.0 37.0 41.0 32.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 0.0 20 1.0 21 0.0 22 3.0 23 6.0 24 2.0 25 9.0 26 10.0 27 12.0 28 25.0 29 22.0 30 24.0 31 31.0 32 52.0 33 58.0 34 66.0 35 96.0 36 127.0 37 173.0 38 262.0 39 556.0 40 2464.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.28432108027007 13.003250812703177 15.453863465866466 34.25856464116029 2 17.75 11.600000000000001 37.375 33.275 3 18.425 19.1 29.275000000000002 33.2 4 23.075000000000003 23.3 25.624999999999996 28.000000000000004 5 22.975 31.924999999999997 26.575 18.525 6 17.375 32.525 28.125 21.975 7 17.05 25.575 38.275 19.1 8 16.425 23.375 36.325 23.875 9 17.65 25.3 33.725 23.325000000000003 10-14 20.46 27.450000000000003 28.575 23.515 15-19 21.13 26.915 27.865000000000002 24.09 20-24 20.64 27.32 27.634999999999998 24.404999999999998 25-29 20.84 27.779999999999998 27.175 24.205 30-34 20.8 26.715 27.72 24.765 35-39 20.695 27.015 27.515 24.775 40-44 21.265 27.46 27.36 23.915 45-49 21.255 27.889999999999997 26.815 24.04 50-54 21.305 26.96 27.275 24.46 55-59 21.98 26.8 27.150000000000002 24.07 60-64 21.310000000000002 27.1 27.29 24.3 65-69 21.165 27.400000000000002 27.165 24.27 70-74 21.93 27.125 26.810000000000002 24.135 75-79 21.63 26.939999999999998 27.22 24.21 80-84 21.490000000000002 26.97 27.13 24.41 85-89 21.92 26.88 27.16 24.04 90-94 21.825 27.315 26.72 24.14 95-99 21.465 26.924999999999997 27.07 24.54 100-104 21.495 26.790000000000003 26.740000000000002 24.975 105-109 21.83218321832183 26.67766776677668 27.27272727272727 24.217421742174217 110-114 21.8 25.900000000000002 27.310000000000002 24.990000000000002 115-119 21.555 26.575 27.66 24.21 120-124 21.959999999999997 26.490000000000002 27.26 24.29 125-129 21.65 25.915 27.625 24.81 130-134 22.115000000000002 26.3 27.229999999999997 24.355 135-139 22.195 25.81 27.655 24.34 140-144 22.254450890178035 25.96019203840768 27.70554110822164 24.079815963192637 145-149 22.14 26.69 27.279999999999998 23.89 150 22.400000000000002 26.424999999999997 26.224999999999998 24.95 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 7.0 1 5.0 2 2.5 3 1.5 4 0.5 5 0.0 6 0.5 7 2.0 8 1.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.5 19 2.5 20 2.0 21 1.0 22 3.0 23 5.5 24 7.0 25 5.0 26 6.0 27 7.5 28 8.0 29 12.5 30 18.0 31 22.5 32 25.0 33 34.0 34 54.0 35 59.5 36 65.5 37 97.0 38 115.0 39 126.5 40 145.5 41 168.0 42 190.5 43 210.0 44 222.0 45 231.5 46 235.0 47 223.5 48 207.0 49 180.5 50 177.5 51 177.0 52 151.0 53 129.0 54 115.0 55 90.0 56 69.5 57 69.5 58 65.5 59 58.5 60 46.0 61 31.0 62 23.5 63 17.5 64 15.0 65 18.5 66 15.5 67 8.5 68 5.5 69 3.5 70 2.0 71 0.5 72 1.0 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.01 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.02 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.65 #Duplication Level Percentage of deduplicated Percentage of total 1 95.92263460533194 91.75 2 3.868269733403032 7.3999999999999995 3 0.15682174594877157 0.44999999999999996 4 0.026136957658128592 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.026136957658128592 0.3 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 12 0.3 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0125 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.125 0.0 0.0 0.0 0.0 102-103 0.15 0.0 0.0 0.0 0.0 104-105 0.15 0.0 0.0 0.0 0.0 106-107 0.15 0.0 0.0 0.0 0.0 108-109 0.15 0.0 0.0 0.0 0.0 110-111 0.175 0.0 0.0 0.0 0.0 112-113 0.2 0.0 0.0 0.0 0.0 114-115 0.25 0.0 0.0 0.0 0.0 116-117 0.2875 0.0 0.0 0.0 0.0 118-119 0.35 0.0 0.0 0.0 0.0 120-121 0.375 0.0 0.0 0.0 0.0 122-123 0.4 0.0 0.0 0.0 0.0 124-125 0.425 0.0 0.0 0.0 0.0 126-127 0.45 0.0 0.0 0.0 0.0 128-129 0.4625 0.0 0.0 0.0 0.0 130-131 0.475 0.0 0.0 0.0 0.0 132-133 0.475 0.0 0.0 0.0 0.0 134-135 0.5625 0.0 0.0 0.0 0.0 136-137 0.6125 0.0 0.0 0.0 0.0 138 0.675 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCGCGAG 10 0.006973645 144.0 9 >>END_MODULE SRR14639620 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14639620_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 46 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.77125 32.0 32.0 32.0 32.0 32.0 2 30.72375 32.0 32.0 32.0 32.0 32.0 3 33.1 37.0 32.0 37.0 27.0 37.0 4 34.88 37.0 37.0 37.0 32.0 37.0 5 35.12875 37.0 37.0 37.0 32.0 37.0 6 38.24925 41.0 37.0 41.0 32.0 41.0 7 37.87975 41.0 37.0 41.0 32.0 41.0 8 38.01725 41.0 37.0 41.0 27.0 41.0 9 38.22 41.0 41.0 41.0 32.0 41.0 10-14 38.3077 41.0 41.0 41.0 32.0 41.0 15-19 38.1366 41.0 41.0 41.0 31.0 41.0 20-24 38.1533 41.0 40.2 41.0 31.0 41.0 25-29 37.756600000000006 41.0 38.6 41.0 28.0 41.0 30-34 37.73365 41.0 37.0 41.0 27.0 41.0 35-39 37.5013 41.0 37.0 41.0 27.0 41.0 40-44 37.3462 41.0 37.0 41.0 27.0 41.0 45-49 37.4111 41.0 37.0 41.0 27.0 41.0 50-54 37.183949999999996 41.0 37.0 41.0 27.0 41.0 55-59 37.198750000000004 41.0 37.0 41.0 27.0 41.0 60-64 37.255 41.0 37.0 41.0 27.0 41.0 65-69 36.87045 41.0 37.0 41.0 26.0 41.0 70-74 36.72715000000001 41.0 37.0 41.0 25.0 41.0 75-79 35.88865 40.2 35.0 41.0 22.0 41.0 80-84 36.907399999999996 41.0 37.0 41.0 23.0 41.0 85-89 36.86595 41.0 37.0 41.0 23.0 41.0 90-94 36.647999999999996 41.0 37.0 41.0 22.0 41.0 95-99 36.69465 41.0 37.0 41.0 22.0 41.0 100-104 36.4516 41.0 37.0 41.0 22.0 41.0 105-109 36.38535 41.0 37.0 41.0 22.0 41.0 110-114 36.410450000000004 41.0 37.0 41.0 22.0 41.0 115-119 36.10845 41.0 36.0 41.0 20.0 41.0 120-124 36.042049999999996 41.0 37.0 41.0 22.0 41.0 125-129 35.54915 41.0 34.0 41.0 20.0 41.0 130-134 35.623599999999996 41.0 35.0 41.0 22.0 41.0 135-139 35.12035000000001 41.0 33.0 41.0 18.0 41.0 140-144 34.92965 41.0 32.0 41.0 18.0 41.0 145-149 34.797700000000006 41.0 32.0 41.0 14.0 41.0 150 34.54625 41.0 32.0 41.0 12.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 4.0 16 10.0 17 22.0 18 23.0 19 26.0 20 36.0 21 30.0 22 28.0 23 36.0 24 40.0 25 34.0 26 42.0 27 54.0 28 55.0 29 76.0 30 81.0 31 68.0 32 106.0 33 98.0 34 129.0 35 147.0 36 206.0 37 252.0 38 344.0 39 617.0 40 1436.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.930844399899776 26.20897018291155 12.37785016286645 25.482335254322226 2 18.775 25.45 36.75 19.025 3 18.675 25.25 34.150000000000006 21.925 4 22.475 31.900000000000002 22.95 22.675 5 22.85 38.074999999999996 21.025 18.05 6 18.4 34.9 25.45 21.25 7 19.875 22.35 35.175 22.6 8 17.175 23.325000000000003 31.775 27.725 9 20.175 26.0 28.625 25.2 10-14 22.615 27.48 26.590000000000003 23.315 15-19 22.35 27.195000000000004 27.405 23.05 20-24 22.23 27.08 26.93 23.76 25-29 22.71 27.325 26.700000000000003 23.265 30-34 23.13 27.224999999999998 26.715 22.93 35-39 23.035 26.265 27.115000000000002 23.585 40-44 22.91 26.685 27.229999999999997 23.175 45-49 23.3 26.875 26.61 23.215 50-54 22.145 27.474999999999998 27.029999999999998 23.35 55-59 23.189999999999998 26.815 26.889999999999997 23.105 60-64 23.445 26.8 27.29 22.465 65-69 23.555 27.384999999999998 26.07 22.99 70-74 23.580000000000002 27.125 25.629999999999995 23.665 75-79 23.64 27.27 26.365 22.725 80-84 24.035 26.740000000000002 26.490000000000002 22.735 85-89 23.805 27.205000000000002 26.36 22.63 90-94 23.59 27.21 26.640000000000004 22.56 95-99 23.355 26.97 26.69 22.985 100-104 23.25 27.51 26.375 22.865 105-109 23.605 27.284999999999997 26.22 22.89 110-114 23.96 27.055 26.135 22.85 115-119 24.445 26.995 25.655 22.905 120-124 24.09 26.88 26.179999999999996 22.85 125-129 24.185000000000002 26.490000000000002 26.5 22.825 130-134 24.025 27.215 25.715 23.044999999999998 135-139 24.6 26.775 25.44 23.185 140-144 24.51 27.05 25.85 22.59 145-149 24.285 26.985 25.71 23.02 150 25.324999999999996 27.150000000000002 26.0 21.525 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 1.0 12 0.5 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.5 19 0.5 20 1.5 21 2.0 22 0.5 23 1.0 24 1.0 25 1.0 26 4.0 27 4.5 28 7.0 29 9.0 30 11.5 31 17.0 32 18.5 33 29.0 34 45.0 35 55.5 36 70.5 37 79.0 38 97.0 39 130.0 40 161.0 41 182.0 42 203.5 43 229.0 44 233.0 45 240.0 46 246.0 47 222.5 48 215.0 49 195.5 50 173.5 51 170.5 52 153.5 53 142.0 54 121.0 55 95.0 56 83.5 57 72.5 58 58.5 59 45.0 60 35.5 61 32.0 62 22.5 63 16.0 64 14.5 65 13.5 66 10.5 67 6.0 68 4.5 69 6.0 70 3.0 71 2.5 72 2.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.22499999999999998 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.25 #Duplication Level Percentage of deduplicated Percentage of total 1 96.36363636363636 92.75 2 3.428571428571429 6.6000000000000005 3 0.15584415584415584 0.44999999999999996 4 0.05194805194805195 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0125 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.037500000000000006 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.075 0.0 0.0 0.0 0.0 54-55 0.075 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.16249999999999998 0.0 0.0 0.0 0.0 100-101 0.175 0.0 0.0 0.0 0.0 102-103 0.175 0.0 0.0 0.0 0.0 104-105 0.2375 0.0 0.0 0.0 0.0 106-107 0.25 0.0 0.0 0.0 0.0 108-109 0.275 0.0 0.0 0.0 0.0 110-111 0.3 0.0 0.0 0.0 0.0 112-113 0.3125 0.0 0.0 0.0 0.0 114-115 0.35 0.0 0.0 0.0 0.0 116-117 0.3875 0.0 0.0 0.0 0.0 118-119 0.425 0.0 0.0 0.0 0.0 120-121 0.475 0.0 0.0 0.0 0.0 122-123 0.5 0.0 0.0 0.0 0.0 124-125 0.55 0.0 0.0 0.0 0.0 126-127 0.575 0.0 0.0 0.0 0.0 128-129 0.5874999999999999 0.0 0.0 0.0 0.0 130-131 0.625 0.0 0.0 0.0 0.0 132-133 0.6625000000000001 0.0 0.0 0.0 0.0 134-135 0.7625 0.0 0.0 0.0 0.0 136-137 0.8125 0.0 0.0 0.0 0.0 138 0.875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 938667 spots for SRR14639620.sra Written 938667 spots for SRR14639620.sra Read 938667 spots for SRR14639620.sra Written 938667 spots for SRR14639620.sra Read 938667 spots for SRR14639620.sra Written 938667 spots for SRR14639620.sra Read 938667 spots for SRR14639620.sra Written 938667 spots for SRR14639620.sra Read 938667 spots for SRR14639620.sra Written 938667 spots for SRR14639620.sra Read 938667 spots for SRR14639620.sra Written 938667 spots for SRR14639620.sra Read 938667 spots for SRR14639620.sra Written 938667 spots for SRR14639620.sra Read 938667 spots for SRR14639620.sra Written 938667 spots for SRR14639620.sra Read 938667 spots for SRR14639620.sra Written 938667 spots for SRR14639620.sra Read 938667 spots for SRR14639620.sra Written 938667 spots for SRR14639620.sra Read 938667 spots for SRR14639620.sra Written 938667 spots for SRR14639620.sra Read 938667 spots for SRR14639620.sra Written 938667 spots for SRR14639620.sra Read 938667 spots for SRR14639620.sra Written 938667 spots for SRR14639620.sra Read 938686 spots for SRR14639620.sra Written 938686 spots for SRR14639620.sra Read 938667 spots for SRR14639620.sra Written 938667 spots for SRR14639620.sra Read 938667 spots for SRR14639620.sra Written 938667 spots for SRR14639620.sra Read 938667 spots for SRR14639620.sra Written 938667 spots for SRR14639620.sra Read 938667 spots for SRR14639620.sra Written 938667 spots for SRR14639620.sra Read 938667 spots for SRR14639620.sra Written 938667 spots for SRR14639620.sra Read 938667 spots for SRR14639620.sra Written 938667 spots for SRR14639620.sra SRR ids: ['SRR14639620.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_c_0sh6z6 SRR14639620.sra spots: 18773359 blocks: [[1, 938667], [938668, 1877334], [1877335, 2816001], [2816002, 3754668], [3754669, 4693335], [4693336, 5632002], [5632003, 6570669], [6570670, 7509336], [7509337, 8448003], [8448004, 9386670], [9386671, 10325337], [10325338, 11264004], [11264005, 12202671], [12202672, 13141338], [13141339, 14080005], [14080006, 15018672], [15018673, 15957339], [15957340, 16896006], [16896007, 17834673], [17834674, 18773359]] SRR14639620 file size 6947280 SRR14639620 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR14639620 SRR14639620_1.fastq SRR14639620_2.fastq Input file: SRR14639620_1.fastq Paired file: SRR14639620_2.fastq trimmed: SRR14639620-trimmed-pair1.fastq, SRR14639620-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 14:12:18 2025 >> started Mon Feb 10 14:12:54 2025 >> done (36.679s) 18773359 read pairs processed; of these: 93 ( 0.00%) short read pairs filtered out after trimming by size control 62 ( 0.00%) empty read pairs filtered out after trimming by size control 18773204 (100.00%) read pairs available; of these: 624556 ( 3.33%) trimmed read pairs available after processing 18148648 (96.67%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 21 0.00% 19 12 0.00% 20 17 0.00% 21 31 0.00% 22 38 0.00% 23 33 0.00% 24 43 0.00% 25 32 0.00% 26 64 0.00% 27 57 0.00% 28 55 0.00% 29 55 0.00% 30 66 0.00% 31 60 0.00% 32 62 0.00% 33 77 0.00% 34 85 0.00% 35 85 0.00% 36 92 0.00% 37 92 0.00% 38 99 0.00% 39 97 0.00% 40 113 0.00% 41 98 0.00% 42 112 0.00% 43 130 0.00% 44 109 0.00% 45 132 0.00% 46 127 0.00% 47 120 0.00% 48 149 0.00% 49 149 0.00% 50 138 0.00% 51 193 0.00% 52 163 0.00% 53 180 0.00% 54 184 0.00% 55 227 0.00% 56 185 0.00% 57 198 0.00% 58 218 0.00% 59 229 0.00% 60 273 0.00% 61 277 0.00% 62 286 0.00% 63 278 0.00% 64 299 0.00% 65 273 0.00% 66 339 0.00% 67 333 0.00% 68 343 0.00% 69 413 0.00% 70 409 0.00% 71 422 0.00% 72 442 0.00% 73 510 0.00% 74 479 0.00% 75 501 0.00% 76 519 0.00% 77 527 0.00% 78 623 0.00% 79 670 0.00% 80 694 0.00% 81 717 0.00% 82 801 0.00% 83 802 0.00% 84 852 0.00% 85 894 0.00% 86 965 0.01% 87 930 0.00% 88 998 0.01% 89 1060 0.01% 90 1119 0.01% 91 1257 0.01% 92 1249 0.01% 93 1390 0.01% 94 1352 0.01% 95 1466 0.01% 96 1516 0.01% 97 1593 0.01% 98 1650 0.01% 99 1712 0.01% 100 1783 0.01% 101 1844 0.01% 102 2027 0.01% 103 2132 0.01% 104 2229 0.01% 105 2334 0.01% 106 2511 0.01% 107 2525 0.01% 108 2625 0.01% 109 2701 0.01% 110 2822 0.02% 111 2893 0.02% 112 2974 0.02% 113 3208 0.02% 114 3322 0.02% 115 3670 0.02% 116 3644 0.02% 117 3793 0.02% 118 3801 0.02% 119 3953 0.02% 120 4145 0.02% 121 4411 0.02% 122 4575 0.02% 123 4700 0.03% 124 4933 0.03% 125 5018 0.03% 126 5295 0.03% 127 5561 0.03% 128 5918 0.03% 129 5900 0.03% 130 5876 0.03% 131 6172 0.03% 132 5890 0.03% 133 6087 0.03% 134 6107 0.03% 135 6536 0.03% 136 6714 0.04% 137 6878 0.04% 138 7142 0.04% 139 7419 0.04% 140 7355 0.04% 141 8049 0.04% 142 8059 0.04% 143 8326 0.04% 144 8608 0.05% 145 9126 0.05% 146 9687 0.05% 147 12739 0.07% 148 29063 0.15% 149 315816 1.68% 150 18148648 96.67% 18773204 reads passed initial QC criterion=sequence-density sequence-density=0.30 sequence-density-rank=1 fanout-score=5.11 fanout-score-rank=12 prefix-density=0.41 prefix-fanout=3.7 sequence=GCAGCTGCTTTCCTGCCACCCCTGTGTTTTCGACCGCGGCCGTGACG criterion=fanout-score sequence-density=0.05 sequence-density-rank=34 fanout-score=110.87 fanout-score-rank=1 prefix-density=0.40 prefix-fanout=12.9 sequence=TGCTTCTTCTTGGGGGTACCTGACGCCGACGCGGATGGGGTAGCGGGTTCCGGGTCACTTGTGGAATTGGCCTTCAAGTTGGAGGGCGTGGTCTCCTCGACTTTGGTGGCGTGCTTCTTCTTTCCGAGTCCGAAGAGAGAGAAAGGCTCGGGCTCTCGGGC criterion=sequence-density sequence-density=0.33 sequence-density-rank=1 fanout-score=3.68 fanout-score-rank=10 prefix-density=0.42 prefix-fanout=2.9 sequence=CTGCAAATGTGG criterion=fanout-score sequence-density=0.11 sequence-density-rank=22 fanout-score=30.11 fanout-score-rank=1 prefix-density=0.34 prefix-fanout=10.1 sequence=AAGAAGGAGGCACCCAAACT SRR14639620 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 14:14:20 Started mapping on | Feb 10 14:14:20 Finished on | Feb 10 14:29:15 Mapping speed, Million of reads per hour | 75.51 Number of input reads | 18773204 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 11464500 Uniquely mapped reads % | 61.07% Average mapped length | 297.06 Number of splices: Total | 9635667 Number of splices: Annotated (sjdb) | 9442297 Number of splices: GT/AG | 9479594 Number of splices: GC/AG | 116286 Number of splices: AT/AC | 9130 Number of splices: Non-canonical | 30657 Mismatch rate per base, % | 0.53% Deletion rate per base | 0.03% Deletion average length | 2.93 Insertion rate per base | 0.02% Insertion average length | 2.60 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 357519 % of reads mapped to multiple loci | 1.90% Number of reads mapped to too many loci | 51124 % of reads mapped to too many loci | 0.27% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 36.42% % of reads unmapped: other | 0.33% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 6951185 6951185 6951185 N_multimapping 357519 357519 357519 N_noFeature 308918 11367708 347405 N_ambiguous 139777 738 81088 UnstrandedReadsAssigned:11015805 PositiveStrandReadsAssigned:96054 NegativeStrandReadsAssigned:11036007 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR14639620 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR14639620-trimmed-pair1.fastq SRR14639620-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,773,204 reads, 11,665,961 reads pseudoaligned [quant] estimated average fragment length: 324.424 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,103 rounds 52401 SRR14639620.ke.tsv 34699 SRR14639620.se.tsv 87100 total ==> SRR14639620.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1694.58 2468 100.911 Potri.005G024800.1.v4.1 1035 711.576 573 55.7942 Potri.004G059700.1.v4.1 961 637.787 146 15.8611 Potri.007G009000.2.v4.1 1416 1092.58 0 0 Potri.003G141000.2.v4.1 2943 2619.58 549.421 14.5322 Potri.016G087400.1.v4.1 270 55.2573 783 981.812 Potri.015G069301.1.v4.1 564 260.704 0 0 Potri.010G195200.1.v4.1 1773 1449.58 26 1.24276 Potri.012G127500.1.v4.1 977 653.683 1582 167.685 ==> SRR14639620.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 28 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 170 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 4 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 192 SRR14639620 completed mapping pipeline successfully