Starting /dee2/code/volunteer_pipeline.sh SRR14639621 current disk space = 3058938707968 free memory = 1294448000 SRR14639621 SRAfilesize 6b2697a55b978245446ad3925bc4f6f2 SRR14639621.sra SRR14639621.sra file validated SRR14639621 is paired end SRR14639621 is conventional basespace SRR14639621 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14639621_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.57375 32.0 32.0 32.0 32.0 32.0 2 31.61 32.0 32.0 32.0 32.0 32.0 3 35.375 37.0 37.0 37.0 32.0 37.0 4 36.12375 37.0 37.0 37.0 32.0 37.0 5 36.28875 37.0 37.0 37.0 37.0 37.0 6 39.77575 41.0 41.0 41.0 37.0 41.0 7 39.7415 41.0 41.0 41.0 37.0 41.0 8 39.99025 41.0 41.0 41.0 37.0 41.0 9 40.07575 41.0 41.0 41.0 37.0 41.0 10-14 40.12835 41.0 41.0 41.0 37.0 41.0 15-19 40.15245 41.0 41.0 41.0 37.0 41.0 20-24 40.1434 41.0 41.0 41.0 37.0 41.0 25-29 40.139149999999994 41.0 41.0 41.0 37.8 41.0 30-34 40.04965 41.0 41.0 41.0 37.0 41.0 35-39 39.98985 41.0 41.0 41.0 37.0 41.0 40-44 39.93705 41.0 41.0 41.0 37.0 41.0 45-49 39.90005000000001 41.0 41.0 41.0 37.0 41.0 50-54 39.8237 41.0 41.0 41.0 37.0 41.0 55-59 39.713849999999994 41.0 41.0 41.0 37.0 41.0 60-64 39.64095 41.0 41.0 41.0 37.0 41.0 65-69 39.58675000000001 41.0 41.0 41.0 37.0 41.0 70-74 39.45175 41.0 41.0 41.0 37.0 41.0 75-79 39.01875 41.0 40.2 41.0 35.0 41.0 80-84 39.42505 41.0 41.0 41.0 37.0 41.0 85-89 39.3657 41.0 41.0 41.0 37.0 41.0 90-94 39.30965 41.0 41.0 41.0 37.0 41.0 95-99 39.1792 41.0 41.0 41.0 37.0 41.0 100-104 39.0797 41.0 41.0 41.0 37.0 41.0 105-109 39.03530000000001 41.0 41.0 41.0 34.0 41.0 110-114 39.005649999999996 41.0 41.0 41.0 34.0 41.0 115-119 38.963699999999996 41.0 41.0 41.0 34.0 41.0 120-124 38.96939999999999 41.0 41.0 41.0 34.0 41.0 125-129 38.8997 41.0 41.0 41.0 33.0 41.0 130-134 38.67475 41.0 41.0 41.0 32.0 41.0 135-139 38.41105 41.0 40.2 41.0 32.0 41.0 140-144 38.114 41.0 37.0 41.0 32.0 41.0 145-149 37.85525 41.0 37.0 41.0 31.0 41.0 150 37.74875 41.0 37.0 41.0 32.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 2.0 22 0.0 23 3.0 24 3.0 25 10.0 26 4.0 27 10.0 28 18.0 29 21.0 30 31.0 31 36.0 32 47.0 33 74.0 34 75.0 35 110.0 36 128.0 37 153.0 38 257.0 39 539.0 40 2479.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.734183545886474 12.628157039259817 16.35408852213053 34.28357089272318 2 17.45 11.5 37.45 33.6 3 19.0 19.8 26.950000000000003 34.25 4 23.625 24.7 23.549999999999997 28.125 5 22.775000000000002 31.874999999999996 26.625 18.725 6 17.775 31.0 30.325000000000003 20.9 7 17.349999999999998 26.85 37.775 18.025 8 15.775 24.15 37.25 22.825 9 18.525 25.650000000000002 33.25 22.575 10-14 20.855 28.044999999999998 27.744999999999997 23.355 15-19 21.295 26.875 27.689999999999998 24.14 20-24 20.835 27.6 27.495000000000005 24.07 25-29 21.105 26.950000000000003 27.36 24.585 30-34 21.04 27.595 27.13 24.235 35-39 20.9 27.49 27.125 24.485 40-44 20.705000000000002 28.294999999999998 27.284999999999997 23.715 45-49 20.89 27.415 27.315 24.38 50-54 20.97 27.089999999999996 27.49 24.45 55-59 21.345 27.515 27.27 23.87 60-64 21.39 27.779999999999998 26.57 24.26 65-69 21.085 27.37 27.284999999999997 24.26 70-74 20.925 28.01 26.919999999999998 24.145 75-79 22.175 26.825 27.24 23.76 80-84 21.43 27.315 26.615 24.64 85-89 21.475 27.87 26.729999999999997 23.925 90-94 22.14 27.465 26.495 23.9 95-99 21.85 27.310000000000002 26.525 24.315 100-104 21.955 27.985 26.8 23.26 105-109 22.23222322232223 27.622762276227625 26.117611761176118 24.027402740274027 110-114 21.815 27.505000000000003 26.810000000000002 23.87 115-119 22.155 27.165 26.85 23.830000000000002 120-124 22.29 27.295 26.38 24.035 125-129 21.43 27.534999999999997 27.145000000000003 23.89 130-134 22.25 26.790000000000003 27.0 23.96 135-139 22.18 27.405 26.395000000000003 24.02 140-144 22.195548887221804 26.346586646661663 27.38184546136534 24.07601900475119 145-149 22.605 27.005000000000003 26.87 23.52 150 22.7 26.85 27.425 23.025000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 1.0 2 1.5 3 1.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.0 15 0.5 16 0.0 17 1.0 18 1.5 19 1.0 20 0.5 21 1.5 22 2.0 23 2.5 24 2.5 25 2.0 26 4.5 27 8.5 28 9.5 29 9.5 30 15.0 31 24.0 32 31.0 33 30.5 34 49.5 35 65.0 36 69.0 37 86.5 38 104.0 39 145.0 40 171.5 41 185.0 42 205.0 43 215.5 44 229.0 45 233.0 46 240.5 47 233.0 48 218.0 49 213.5 50 190.5 51 155.0 52 134.5 53 124.5 54 109.0 55 89.0 56 72.5 57 59.5 58 50.0 59 46.5 60 33.5 61 21.5 62 18.5 63 18.0 64 18.0 65 15.5 66 10.0 67 5.0 68 4.0 69 3.5 70 2.0 71 0.5 72 0.5 73 1.0 74 1.0 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.01 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.025 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.3 #Duplication Level Percentage of deduplicated Percentage of total 1 95.27806925498426 90.8 2 4.512067156348373 8.6 3 0.2098635886673662 0.6 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.0875 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.125 0.0 0.0 0.0 0.0 100-101 0.125 0.0 0.0 0.0 0.0 102-103 0.1375 0.0 0.0 0.0 0.0 104-105 0.15 0.0 0.0 0.0 0.0 106-107 0.15 0.0 0.0 0.0 0.0 108-109 0.15 0.0 0.0 0.0 0.0 110-111 0.2 0.0 0.0 0.0 0.0 112-113 0.25 0.0 0.0 0.0 0.0 114-115 0.32499999999999996 0.0 0.0 0.0 0.0 116-117 0.4125 0.0 0.0 0.0 0.0 118-119 0.48750000000000004 0.0 0.0 0.0 0.0 120-121 0.55 0.0 0.0 0.0 0.0 122-123 0.7 0.0 0.0 0.0 0.0 124-125 0.8 0.0 0.0 0.0 0.0 126-127 0.9 0.0 0.0 0.0 0.0 128-129 1.0625 0.0 0.0 0.0 0.0 130-131 1.25 0.0 0.0 0.0 0.0 132-133 1.475 0.0 0.0 0.0 0.0 134-135 1.6375000000000002 0.0 0.0 0.0 0.0 136-137 1.7875 0.0 0.0 0.0 0.0 138 1.9 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CGTTGAC 10 0.006973645 144.0 4 >>END_MODULE SRR14639621 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14639621_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 46 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.85 32.0 32.0 32.0 32.0 32.0 2 30.815 32.0 32.0 32.0 32.0 32.0 3 33.5525 37.0 32.0 37.0 27.0 37.0 4 34.81375 37.0 37.0 37.0 32.0 37.0 5 35.12375 37.0 37.0 37.0 32.0 37.0 6 38.1835 41.0 37.0 41.0 32.0 41.0 7 37.926 41.0 37.0 41.0 32.0 41.0 8 38.19975 41.0 41.0 41.0 32.0 41.0 9 38.24725 41.0 41.0 41.0 32.0 41.0 10-14 38.49844999999999 41.0 41.0 41.0 32.0 41.0 15-19 38.3729 41.0 41.0 41.0 32.0 41.0 20-24 38.289100000000005 41.0 41.0 41.0 31.0 41.0 25-29 37.90735 41.0 39.4 41.0 29.0 41.0 30-34 37.858000000000004 41.0 37.8 41.0 27.0 41.0 35-39 37.678900000000006 41.0 37.0 41.0 27.0 41.0 40-44 37.569649999999996 41.0 37.0 41.0 27.0 41.0 45-49 37.466750000000005 41.0 37.0 41.0 27.0 41.0 50-54 37.33655 41.0 37.0 41.0 27.0 41.0 55-59 37.2743 41.0 37.0 41.0 27.0 41.0 60-64 37.2524 41.0 37.0 41.0 27.0 41.0 65-69 37.12915 41.0 37.0 41.0 27.0 41.0 70-74 36.991550000000004 41.0 37.0 41.0 26.0 41.0 75-79 36.1622 40.2 35.0 41.0 23.0 41.0 80-84 37.023250000000004 41.0 37.0 41.0 22.0 41.0 85-89 37.093599999999995 41.0 37.0 41.0 24.0 41.0 90-94 36.780150000000006 41.0 37.0 41.0 22.0 41.0 95-99 36.899649999999994 41.0 37.0 41.0 22.0 41.0 100-104 36.7062 41.0 37.0 41.0 22.0 41.0 105-109 36.58259999999999 41.0 37.0 41.0 22.0 41.0 110-114 36.5659 41.0 37.0 41.0 22.0 41.0 115-119 36.299850000000006 41.0 37.0 41.0 22.0 41.0 120-124 36.35715 41.0 37.0 41.0 22.0 41.0 125-129 35.9768 41.0 36.0 41.0 20.0 41.0 130-134 35.87975 41.0 37.0 41.0 22.0 41.0 135-139 35.40469999999999 41.0 34.0 41.0 18.0 41.0 140-144 35.2585 41.0 32.0 41.0 18.0 41.0 145-149 35.022499999999994 41.0 34.0 41.0 12.0 41.0 150 34.685 41.0 32.0 41.0 12.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 4.0 15 9.0 16 10.0 17 21.0 18 26.0 19 32.0 20 36.0 21 26.0 22 28.0 23 37.0 24 36.0 25 44.0 26 34.0 27 48.0 28 47.0 29 66.0 30 60.0 31 80.0 32 83.0 33 104.0 34 111.0 35 136.0 36 181.0 37 219.0 38 317.0 39 561.0 40 1644.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.93984962406015 27.518796992481203 12.030075187969924 24.51127819548872 2 19.125 25.775 36.05 19.05 3 18.15 25.95 35.4 20.5 4 22.2 31.6 24.3 21.9 5 21.95 38.75 22.175 17.125 6 19.575 34.725 26.1 19.6 7 20.0 23.5 33.425 23.075000000000003 8 17.474999999999998 23.075000000000003 31.45 28.000000000000004 9 19.675 24.975 29.575000000000003 25.775 10-14 22.97 27.52 26.435 23.075000000000003 15-19 22.79 27.224999999999998 26.040000000000003 23.945 20-24 22.175 27.195000000000004 27.765 22.865 25-29 22.655 28.194999999999997 26.39 22.759999999999998 30-34 22.895 26.884999999999998 27.3 22.919999999999998 35-39 22.79 26.8 27.865000000000002 22.545 40-44 23.11 26.865 27.215 22.81 45-49 23.080000000000002 26.72 27.26 22.939999999999998 50-54 23.155 26.875 27.01 22.96 55-59 23.125 27.54 27.034999999999997 22.3 60-64 23.015 27.279999999999998 26.96 22.745 65-69 23.005 26.85 26.82 23.325000000000003 70-74 23.385 27.13 26.640000000000004 22.845 75-79 23.07 26.995 27.1 22.835 80-84 23.095 27.62 26.795 22.49 85-89 23.705000000000002 27.750000000000004 26.450000000000003 22.095000000000002 90-94 23.23 27.025 26.784999999999997 22.96 95-99 23.5 26.905 26.87 22.725 100-104 23.919999999999998 26.700000000000003 26.69 22.689999999999998 105-109 23.94 26.765 26.71 22.585 110-114 23.105 27.295 26.529999999999998 23.07 115-119 23.57 27.08 26.229999999999997 23.119999999999997 120-124 24.07 26.83 26.56 22.54 125-129 23.965 26.865 26.474999999999998 22.695 130-134 23.825 26.865 26.715 22.595000000000002 135-139 24.09 26.66 26.674999999999997 22.575 140-144 25.264999999999997 27.01 25.345000000000002 22.38 145-149 24.490000000000002 26.735 26.21 22.564999999999998 150 23.325000000000003 26.125 27.85 22.7 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 1.0 20 1.0 21 0.0 22 1.0 23 1.5 24 2.0 25 4.5 26 3.5 27 3.5 28 8.0 29 11.0 30 15.0 31 21.5 32 26.5 33 33.0 34 48.0 35 62.0 36 70.0 37 93.0 38 115.5 39 134.0 40 159.0 41 185.5 42 218.0 43 230.0 44 239.5 45 254.0 46 233.0 47 214.5 48 206.5 49 195.0 50 178.0 51 162.0 52 140.0 53 118.5 54 111.0 55 93.5 56 72.5 57 59.5 58 54.0 59 42.0 60 32.5 61 28.0 62 25.5 63 20.0 64 13.0 65 13.0 66 12.5 67 9.5 68 6.5 69 3.0 70 2.5 71 3.0 72 2.5 73 1.5 74 0.5 75 0.0 76 0.5 77 1.0 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.25 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.92500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 95.9864477456346 92.07499999999999 2 3.7789940057336464 7.249999999999999 3 0.23455824863174357 0.675 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.07500000000000001 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1125 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.1375 0.0 0.0 0.0 0.0 96-97 0.2 0.0 0.0 0.0 0.0 98-99 0.2 0.0 0.0 0.0 0.0 100-101 0.2 0.0 0.0 0.0 0.0 102-103 0.225 0.0 0.0 0.0 0.0 104-105 0.225 0.0 0.0 0.0 0.0 106-107 0.2375 0.0 0.0 0.0 0.0 108-109 0.25 0.0 0.0 0.0 0.0 110-111 0.2875 0.0 0.0 0.0 0.0 112-113 0.32499999999999996 0.0 0.0 0.0 0.0 114-115 0.3625 0.0 0.0 0.0 0.0 116-117 0.45 0.0 0.0 0.0 0.0 118-119 0.5375 0.0 0.0 0.0 0.0 120-121 0.625 0.0 0.0 0.0 0.0 122-123 0.75 0.0 0.0 0.0 0.0 124-125 0.85 0.0 0.0 0.0 0.0 126-127 0.9 0.0 0.0 0.0 0.0 128-129 1.025 0.0 0.0 0.0 0.0 130-131 1.1375000000000002 0.0 0.0 0.0 0.0 132-133 1.325 0.0 0.0 0.0 0.0 134-135 1.4375 0.0 0.0 0.0 0.0 136-137 1.6375000000000002 0.0 0.0 0.0 0.0 138 1.8 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1091005 spots for SRR14639621.sra Written 1091005 spots for SRR14639621.sra Read 1091005 spots for SRR14639621.sra Written 1091005 spots for SRR14639621.sra Read 1091005 spots for SRR14639621.sra Written 1091005 spots for SRR14639621.sra Read 1091005 spots for SRR14639621.sra Written 1091005 spots for SRR14639621.sra Read 1091005 spots for SRR14639621.sra Written 1091005 spots for SRR14639621.sra Read 1091005 spots for SRR14639621.sra Written 1091005 spots for SRR14639621.sra Read 1091005 spots for SRR14639621.sra Written 1091005 spots for SRR14639621.sra Read 1091005 spots for SRR14639621.sra Written 1091005 spots for SRR14639621.sra Read 1091005 spots for SRR14639621.sra Written 1091005 spots for SRR14639621.sra Read 1091005 spots for SRR14639621.sra Written 1091005 spots for SRR14639621.sra Read 1091005 spots for SRR14639621.sra Written 1091005 spots for SRR14639621.sra Read 1091005 spots for SRR14639621.sra Written 1091005 spots for SRR14639621.sra Read 1091005 spots for SRR14639621.sra Written 1091005 spots for SRR14639621.sra Read 1091005 spots for SRR14639621.sra Written 1091005 spots for SRR14639621.sra Read 1091005 spots for SRR14639621.sra Written 1091005 spots for SRR14639621.sra Read 1091005 spots for SRR14639621.sra Written 1091005 spots for SRR14639621.sra Read 1091018 spots for SRR14639621.sra Written 1091018 spots for SRR14639621.sra Read 1091005 spots for SRR14639621.sra Written 1091005 spots for SRR14639621.sra Read 1091005 spots for SRR14639621.sra Written 1091005 spots for SRR14639621.sra Read 1091005 spots for SRR14639621.sra Written 1091005 spots for SRR14639621.sra SRR ids: ['SRR14639621.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_e1c1_1o9 SRR14639621.sra spots: 21820113 blocks: [[1, 1091005], [1091006, 2182010], [2182011, 3273015], [3273016, 4364020], [4364021, 5455025], [5455026, 6546030], [6546031, 7637035], [7637036, 8728040], [8728041, 9819045], [9819046, 10910050], [10910051, 12001055], [12001056, 13092060], [13092061, 14183065], [14183066, 15274070], [15274071, 16365075], [16365076, 17456080], [17456081, 18547085], [18547086, 19638090], [19638091, 20729095], [20729096, 21820113]] SRR14639621 file size 8076490 SRR14639621 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR14639621 SRR14639621_1.fastq SRR14639621_2.fastq Input file: SRR14639621_1.fastq Paired file: SRR14639621_2.fastq trimmed: SRR14639621-trimmed-pair1.fastq, SRR14639621-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 14:18:44 2025 >> started Mon Feb 10 14:19:17 2025 >> done (33.113s) 21820113 read pairs processed; of these: 74 ( 0.00%) short read pairs filtered out after trimming by size control 70 ( 0.00%) empty read pairs filtered out after trimming by size control 21819969 (100.00%) read pairs available; of these: 1515347 ( 6.94%) trimmed read pairs available after processing 20304622 (93.06%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 10 0.00% 19 16 0.00% 20 17 0.00% 21 29 0.00% 22 27 0.00% 23 16 0.00% 24 43 0.00% 25 39 0.00% 26 34 0.00% 27 39 0.00% 28 38 0.00% 29 31 0.00% 30 46 0.00% 31 57 0.00% 32 53 0.00% 33 50 0.00% 34 54 0.00% 35 54 0.00% 36 65 0.00% 37 60 0.00% 38 63 0.00% 39 60 0.00% 40 67 0.00% 41 73 0.00% 42 73 0.00% 43 92 0.00% 44 68 0.00% 45 84 0.00% 46 86 0.00% 47 94 0.00% 48 86 0.00% 49 124 0.00% 50 133 0.00% 51 124 0.00% 52 125 0.00% 53 132 0.00% 54 135 0.00% 55 129 0.00% 56 155 0.00% 57 160 0.00% 58 194 0.00% 59 204 0.00% 60 189 0.00% 61 199 0.00% 62 226 0.00% 63 240 0.00% 64 272 0.00% 65 271 0.00% 66 259 0.00% 67 310 0.00% 68 299 0.00% 69 330 0.00% 70 413 0.00% 71 410 0.00% 72 467 0.00% 73 502 0.00% 74 505 0.00% 75 560 0.00% 76 599 0.00% 77 634 0.00% 78 689 0.00% 79 730 0.00% 80 757 0.00% 81 887 0.00% 82 973 0.00% 83 1073 0.00% 84 1163 0.01% 85 1211 0.01% 86 1369 0.01% 87 1471 0.01% 88 1628 0.01% 89 1700 0.01% 90 1810 0.01% 91 2050 0.01% 92 2178 0.01% 93 2408 0.01% 94 2644 0.01% 95 2863 0.01% 96 3054 0.01% 97 3432 0.02% 98 3518 0.02% 99 3837 0.02% 100 4192 0.02% 101 4497 0.02% 102 4889 0.02% 103 5302 0.02% 104 5633 0.03% 105 6282 0.03% 106 6635 0.03% 107 7251 0.03% 108 7562 0.03% 109 8176 0.04% 110 8654 0.04% 111 9443 0.04% 112 9879 0.05% 113 10701 0.05% 114 11475 0.05% 115 12444 0.06% 116 13019 0.06% 117 13813 0.06% 118 14750 0.07% 119 15824 0.07% 120 16708 0.08% 121 17396 0.08% 122 18365 0.08% 123 19590 0.09% 124 20622 0.09% 125 21738 0.10% 126 23176 0.11% 127 24496 0.11% 128 25557 0.12% 129 26762 0.12% 130 27437 0.13% 131 28613 0.13% 132 27474 0.13% 133 28519 0.13% 134 29167 0.13% 135 30587 0.14% 136 31651 0.15% 137 32168 0.15% 138 33794 0.15% 139 34774 0.16% 140 36030 0.17% 141 37016 0.17% 142 37986 0.17% 143 39413 0.18% 144 40028 0.18% 145 40791 0.19% 146 42162 0.19% 147 47618 0.22% 148 67888 0.31% 149 376031 1.72% 150 20304622 93.06% 21819969 reads passed initial QC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=6.30 fanout-score-rank=9 prefix-density=0.28 prefix-fanout=4.2 sequence=GCAGCTGCTTTCCTGCCACCCCTGTGTTTTCGACCGCGGCCGTGACG criterion=fanout-score sequence-density=0.07 sequence-density-rank=26 fanout-score=14.03 fanout-score-rank=1 prefix-density=0.32 prefix-fanout=3.0 sequence=GCCTCCTTCTTTGCAAC criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=4.27 fanout-score-rank=10 prefix-density=0.35 prefix-fanout=3.2 sequence=CTGCAAATGTGG criterion=fanout-score sequence-density=0.09 sequence-density-rank=23 fanout-score=20.97 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=7.8 sequence=AAGGCCAAGATCCAGGACAAGGA SRR14639621 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 14:20:34 Started mapping on | Feb 10 14:20:35 Finished on | Feb 10 14:34:29 Mapping speed, Million of reads per hour | 94.19 Number of input reads | 21819969 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 14069237 Uniquely mapped reads % | 64.48% Average mapped length | 295.63 Number of splices: Total | 11768554 Number of splices: Annotated (sjdb) | 11513735 Number of splices: GT/AG | 11577533 Number of splices: GC/AG | 142018 Number of splices: AT/AC | 10261 Number of splices: Non-canonical | 38742 Mismatch rate per base, % | 0.53% Deletion rate per base | 0.03% Deletion average length | 2.91 Insertion rate per base | 0.02% Insertion average length | 2.58 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 440646 % of reads mapped to multiple loci | 2.02% Number of reads mapped to too many loci | 127822 % of reads mapped to too many loci | 0.59% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 32.35% % of reads unmapped: other | 0.57% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 7310086 7310086 7310086 N_multimapping 440646 440646 440646 N_noFeature 462353 13955459 510220 N_ambiguous 162563 814 96241 UnstrandedReadsAssigned:13444321 PositiveStrandReadsAssigned:112964 NegativeStrandReadsAssigned:13462776 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR14639621 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR14639621-trimmed-pair1.fastq SRR14639621-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,819,969 reads, 14,491,399 reads pseudoaligned [quant] estimated average fragment length: 286.304 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,187 rounds 52401 SRR14639621.ke.tsv 34699 SRR14639621.se.tsv 87100 total ==> SRR14639621.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1732.7 3105 113.554 Potri.005G024800.1.v4.1 1035 749.696 896 75.7329 Potri.004G059700.1.v4.1 961 675.987 125 11.7175 Potri.007G009000.2.v4.1 1416 1130.7 0 0 Potri.003G141000.2.v4.1 2943 2657.7 732.665 17.4687 Potri.016G087400.1.v4.1 270 76.6273 806 666.52 Potri.015G069301.1.v4.1 564 299.697 0 0 Potri.010G195200.1.v4.1 1773 1487.7 30 1.27782 Potri.012G127500.1.v4.1 977 691.815 1311 120.081 ==> SRR14639621.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 41 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 179 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 6 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 186 SRR14639621 completed mapping pipeline successfully