Starting /dee2/code/volunteer_pipeline.sh SRR14639622 current disk space = 3059037929472 free memory = 1580111988 SRR14639622 SRAfilesize 49227652cb59c9950898b3301a9d75b7 SRR14639622.sra SRR14639622.sra file validated SRR14639622 is paired end SRR14639622 is conventional basespace SRR14639622 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14639622_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.63375 32.0 32.0 32.0 32.0 32.0 2 31.5625 32.0 32.0 32.0 32.0 32.0 3 35.18625 37.0 32.0 37.0 32.0 37.0 4 36.22875 37.0 37.0 37.0 37.0 37.0 5 36.18875 37.0 37.0 37.0 37.0 37.0 6 39.7655 41.0 41.0 41.0 37.0 41.0 7 39.6615 41.0 41.0 41.0 37.0 41.0 8 39.94125 41.0 41.0 41.0 37.0 41.0 9 39.969 41.0 41.0 41.0 37.0 41.0 10-14 40.0869 41.0 41.0 41.0 37.0 41.0 15-19 40.105650000000004 41.0 41.0 41.0 37.0 41.0 20-24 40.1228 41.0 41.0 41.0 37.0 41.0 25-29 40.0908 41.0 41.0 41.0 37.0 41.0 30-34 40.0895 41.0 41.0 41.0 38.6 41.0 35-39 39.94825 41.0 41.0 41.0 37.0 41.0 40-44 39.942949999999996 41.0 41.0 41.0 37.0 41.0 45-49 39.8783 41.0 41.0 41.0 37.0 41.0 50-54 39.822950000000006 41.0 41.0 41.0 37.0 41.0 55-59 39.77235 41.0 41.0 41.0 37.0 41.0 60-64 39.6871 41.0 41.0 41.0 37.0 41.0 65-69 39.56015 41.0 41.0 41.0 37.0 41.0 70-74 39.39065 41.0 41.0 41.0 37.0 41.0 75-79 38.96815 41.0 40.2 41.0 36.0 41.0 80-84 39.380849999999995 41.0 41.0 41.0 37.0 41.0 85-89 39.39465 41.0 41.0 41.0 37.0 41.0 90-94 39.29944999999999 41.0 41.0 41.0 37.0 41.0 95-99 39.2199 41.0 41.0 41.0 37.0 41.0 100-104 39.15214999999999 41.0 41.0 41.0 37.0 41.0 105-109 39.0708 41.0 41.0 41.0 37.0 41.0 110-114 39.0658 41.0 41.0 41.0 37.0 41.0 115-119 39.08025 41.0 41.0 41.0 36.0 41.0 120-124 38.9678 41.0 41.0 41.0 35.0 41.0 125-129 38.95625 41.0 41.0 41.0 35.0 41.0 130-134 38.71055 41.0 41.0 41.0 32.0 41.0 135-139 38.4886 41.0 40.2 41.0 32.0 41.0 140-144 38.242999999999995 41.0 37.8 41.0 32.0 41.0 145-149 37.9673 41.0 37.0 41.0 32.0 41.0 150 37.86475 41.0 37.0 41.0 32.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 2.0 22 4.0 23 5.0 24 5.0 25 9.0 26 12.0 27 13.0 28 16.0 29 18.0 30 25.0 31 33.0 32 55.0 33 55.0 34 73.0 35 104.0 36 113.0 37 161.0 38 269.0 39 499.0 40 2529.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.98374593648413 13.15328832208052 16.029007251812956 35.83395848962241 2 16.325 11.375 39.725 32.574999999999996 3 19.575 19.15 26.674999999999997 34.599999999999994 4 22.900000000000002 24.8 24.775 27.525 5 24.474999999999998 31.775 26.0 17.75 6 18.85 30.85 28.975 21.325 7 17.025000000000002 26.1 39.125 17.75 8 15.125 23.5 38.05 23.325000000000003 9 18.3 26.0 33.324999999999996 22.375 10-14 20.53 28.29 27.38 23.799999999999997 15-19 21.09 26.935 27.725 24.25 20-24 21.060000000000002 27.875 27.145000000000003 23.919999999999998 25-29 20.685000000000002 26.900000000000002 27.77 24.645 30-34 20.845 26.935 27.395000000000003 24.825 35-39 20.825 27.57 27.265 24.34 40-44 21.335 28.185 26.445 24.035 45-49 21.605 27.055 27.27 24.07 50-54 21.235 27.515 27.034999999999997 24.215 55-59 20.895 27.425 26.77 24.91 60-64 21.435000000000002 26.72 27.235 24.610000000000003 65-69 21.349999999999998 27.465 27.05 24.135 70-74 21.34 27.175 27.55 23.935000000000002 75-79 22.145 27.575 26.845000000000002 23.435 80-84 21.985 27.595 26.905 23.515 85-89 21.05 27.794999999999998 27.275 23.880000000000003 90-94 22.115000000000002 26.915 26.900000000000002 24.07 95-99 21.68 27.060000000000002 26.950000000000003 24.310000000000002 100-104 21.38 27.339999999999996 26.72 24.560000000000002 105-109 21.586079303965196 27.876393819690986 26.941347067353366 23.59617980899045 110-114 22.325 27.639999999999997 26.365 23.669999999999998 115-119 22.525000000000002 26.840000000000003 26.740000000000002 23.895 120-124 22.045 27.365000000000002 26.38 24.21 125-129 22.27 27.095000000000002 26.815 23.82 130-134 22.48 27.045 26.6 23.875 135-139 22.29 27.395000000000003 26.255 24.060000000000002 140-144 22.607260726072607 26.782678267826782 26.232623262326232 24.377437743774376 145-149 22.345000000000002 27.48 26.21 23.965 150 23.150000000000002 25.724999999999998 26.200000000000003 24.925 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 6.0 1 3.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.5 12 1.0 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 1.0 22 2.0 23 2.5 24 1.5 25 2.5 26 6.0 27 10.0 28 9.0 29 10.0 30 16.0 31 24.0 32 33.0 33 36.0 34 41.5 35 55.0 36 75.5 37 85.5 38 106.0 39 140.5 40 169.0 41 189.5 42 202.0 43 213.5 44 227.0 45 230.0 46 225.5 47 238.0 48 218.5 49 192.0 50 178.5 51 163.0 52 152.0 53 139.5 54 112.5 55 88.0 56 76.0 57 68.5 58 55.0 59 38.5 60 32.5 61 22.5 62 19.0 63 19.0 64 17.0 65 10.5 66 7.0 67 5.5 68 5.0 69 3.5 70 1.5 71 1.5 72 4.5 73 4.5 74 1.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.005 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.01 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.6 #Duplication Level Percentage of deduplicated Percentage of total 1 95.94665271966527 91.725 2 3.7395397489539746 7.1499999999999995 3 0.2615062761506276 0.75 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.02615062761506276 0.17500000000000002 8 0.02615062761506276 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ATCGGAAGAGCACACGTCTGAACTCCAGTCACTCTCGCGCATCTCGTATG 8 0.2 TruSeq Adapter, Index 8 (97% over 35bp) TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.037500000000000006 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.125 0.0 0.0 0.0 0.0 102-103 0.175 0.0 0.0 0.0 0.0 104-105 0.21250000000000002 0.0 0.0 0.0 0.0 106-107 0.2875 0.0 0.0 0.0 0.0 108-109 0.4375 0.0 0.0 0.0 0.0 110-111 0.4625 0.0 0.0 0.0 0.0 112-113 0.5 0.0 0.0 0.0 0.0 114-115 0.575 0.0 0.0 0.0 0.0 116-117 0.65 0.0 0.0 0.0 0.0 118-119 0.875 0.0 0.0 0.0 0.0 120-121 0.9625 0.0 0.0 0.0 0.0 122-123 1.15 0.0 0.0 0.0 0.0 124-125 1.325 0.0 0.0 0.0 0.0 126-127 1.5625 0.0 0.0 0.0 0.0 128-129 1.6875 0.0 0.0 0.0 0.0 130-131 1.9375 0.0 0.0 0.0 0.0 132-133 2.1125 0.0 0.0 0.0 0.0 134-135 2.3875 0.0 0.0 0.0 0.0 136-137 2.6500000000000004 0.0 0.0 0.0 0.0 138 2.9 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR14639622 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14639622_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.9275 32.0 32.0 32.0 32.0 32.0 2 30.94375 32.0 32.0 32.0 32.0 32.0 3 33.7175 37.0 32.0 37.0 32.0 37.0 4 35.0725 37.0 37.0 37.0 32.0 37.0 5 35.195 37.0 37.0 37.0 32.0 37.0 6 38.672 41.0 41.0 41.0 32.0 41.0 7 38.3645 41.0 41.0 41.0 32.0 41.0 8 38.465 41.0 41.0 41.0 32.0 41.0 9 38.70225 41.0 41.0 41.0 32.0 41.0 10-14 38.745450000000005 41.0 41.0 41.0 33.0 41.0 15-19 38.527049999999996 41.0 41.0 41.0 32.0 41.0 20-24 38.5289 41.0 41.0 41.0 32.0 41.0 25-29 38.28305 41.0 40.2 41.0 31.0 41.0 30-34 38.20870000000001 41.0 41.0 41.0 32.0 41.0 35-39 38.036950000000004 41.0 38.6 41.0 29.0 41.0 40-44 37.99405 41.0 38.6 41.0 31.0 41.0 45-49 37.882999999999996 41.0 37.0 41.0 28.0 41.0 50-54 37.720600000000005 41.0 37.0 41.0 27.0 41.0 55-59 37.733850000000004 41.0 37.0 41.0 27.0 41.0 60-64 37.7862 41.0 37.0 41.0 28.0 41.0 65-69 37.56564999999999 41.0 37.0 41.0 27.0 41.0 70-74 37.291250000000005 41.0 37.0 41.0 27.0 41.0 75-79 36.5595 40.2 36.0 41.0 24.0 41.0 80-84 37.35995 41.0 37.0 41.0 27.0 41.0 85-89 37.459 41.0 37.0 41.0 27.0 41.0 90-94 37.15585 41.0 37.0 41.0 24.0 41.0 95-99 37.263250000000006 41.0 37.0 41.0 26.0 41.0 100-104 37.1151 41.0 37.0 41.0 24.0 41.0 105-109 37.07075 41.0 37.0 41.0 24.0 41.0 110-114 37.00079999999999 41.0 37.0 41.0 22.0 41.0 115-119 36.7469 41.0 37.0 41.0 22.0 41.0 120-124 36.77625 41.0 37.0 41.0 22.0 41.0 125-129 36.2416 41.0 37.0 41.0 22.0 41.0 130-134 36.30285000000001 41.0 37.0 41.0 22.0 41.0 135-139 35.8714 41.0 36.0 41.0 22.0 41.0 140-144 35.59795 41.0 36.0 41.0 18.0 41.0 145-149 35.48765000000001 41.0 36.0 41.0 16.0 41.0 150 35.26925 41.0 37.0 41.0 12.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 7.0 16 5.0 17 16.0 18 33.0 19 19.0 20 26.0 21 24.0 22 29.0 23 26.0 24 33.0 25 24.0 26 38.0 27 47.0 28 66.0 29 61.0 30 57.0 31 62.0 32 82.0 33 96.0 34 120.0 35 129.0 36 150.0 37 213.0 38 290.0 39 528.0 40 1818.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 33.36675858611181 27.550764602657306 12.484331912760089 26.598144898470792 2 20.4 25.775 34.65 19.175 3 17.9 25.924999999999997 33.45 22.725 4 22.275 32.6 23.075000000000003 22.05 5 23.75 37.925 22.025 16.3 6 17.9 35.4 25.15 21.55 7 19.6 22.575 35.375 22.45 8 17.299999999999997 23.75 32.025 26.924999999999997 9 22.825 24.275 29.325000000000003 23.575 10-14 22.345000000000002 27.505000000000003 26.169999999999998 23.98 15-19 22.264999999999997 27.1 27.575 23.06 20-24 22.41 27.175 27.575 22.84 25-29 22.23 27.43 27.275 23.064999999999998 30-34 23.41 27.029999999999998 27.005000000000003 22.555 35-39 22.465 27.450000000000003 27.21 22.875 40-44 22.8 27.165 27.16 22.875 45-49 22.994999999999997 26.650000000000002 27.315 23.04 50-54 22.85 26.619999999999997 27.755000000000003 22.775000000000002 55-59 23.135 26.634999999999998 27.339999999999996 22.89 60-64 23.625 26.31 27.224999999999998 22.84 65-69 23.02 26.72 27.33 22.93 70-74 23.485 26.900000000000002 26.96 22.655 75-79 23.505000000000003 26.700000000000003 26.729999999999997 23.064999999999998 80-84 23.330000000000002 27.155 26.93 22.585 85-89 24.060000000000002 27.375 26.200000000000003 22.365 90-94 23.549999999999997 27.275 26.479999999999997 22.695 95-99 23.150000000000002 26.86 27.584999999999997 22.405 100-104 23.315 27.095000000000002 26.650000000000002 22.939999999999998 105-109 23.69 27.075 26.91 22.325 110-114 23.7 27.435 26.27 22.595000000000002 115-119 24.135 27.13 25.795 22.939999999999998 120-124 24.215 26.834999999999997 26.875 22.075 125-129 23.825 26.86 26.640000000000004 22.675 130-134 24.72 27.42 25.775 22.085 135-139 24.675 27.295 26.314999999999998 21.715 140-144 24.635 27.445000000000004 26.115 21.805 145-149 24.795 27.125 25.86 22.220000000000002 150 24.925 26.474999999999998 26.325 22.275 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 1.0 21 2.5 22 3.5 23 4.0 24 3.5 25 2.5 26 2.5 27 3.0 28 7.0 29 10.5 30 13.5 31 19.5 32 25.5 33 36.0 34 50.0 35 65.5 36 80.5 37 92.5 38 107.5 39 127.5 40 158.0 41 180.5 42 187.5 43 212.5 44 232.0 45 247.5 46 257.0 47 236.5 48 215.0 49 202.5 50 191.5 51 158.5 52 135.0 53 124.0 54 102.5 55 83.5 56 70.5 57 68.0 58 56.0 59 45.5 60 33.0 61 27.0 62 28.0 63 20.0 64 16.5 65 13.5 66 8.0 67 7.5 68 6.5 69 5.0 70 5.0 71 2.0 72 1.0 73 0.0 74 0.0 75 0.5 76 0.5 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.27499999999999997 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.95 #Duplication Level Percentage of deduplicated Percentage of total 1 96.27410109431996 92.375 2 3.361125586242835 6.45 3 0.3126628452318916 0.8999999999999999 4 0.02605523710265763 0.1 5 0.0 0.0 6 0.0 0.0 7 0.02605523710265763 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTCTTCGCCTGTGTAGATCTC 7 0.17500000000000002 Illumina Single End PCR Primer 1 (96% over 31bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.037500000000000006 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.125 0.0 0.0 0.0 0.0 102-103 0.1375 0.0 0.0 0.0 0.0 104-105 0.175 0.0 0.0 0.0 0.0 106-107 0.275 0.0 0.0 0.0 0.0 108-109 0.44999999999999996 0.0 0.0 0.0 0.0 110-111 0.475 0.0 0.0 0.0 0.0 112-113 0.5125 0.0 0.0 0.0 0.0 114-115 0.5625 0.0 0.0 0.0 0.0 116-117 0.6125 0.0 0.0 0.0 0.0 118-119 0.75 0.0 0.0 0.0 0.0 120-121 0.8625 0.0 0.0 0.0 0.0 122-123 1.075 0.0 0.0 0.0 0.0 124-125 1.225 0.0 0.0 0.0 0.0 126-127 1.4874999999999998 0.0 0.0 0.0 0.0 128-129 1.625 0.0 0.0 0.0 0.0 130-131 1.825 0.0 0.0 0.0 0.0 132-133 1.9874999999999998 0.0 0.0 0.0 0.0 134-135 2.1875 0.0 0.0 0.0 0.0 136-137 2.4000000000000004 0.0 0.0 0.0 0.0 138 2.65 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTGTCTC 10 0.0069754543 143.9875 8 >>END_MODULE Read 1127084 spots for SRR14639622.sra Written 1127084 spots for SRR14639622.sra Read 1127084 spots for SRR14639622.sra Written 1127084 spots for SRR14639622.sra Read 1127084 spots for SRR14639622.sra Written 1127084 spots for SRR14639622.sra Read 1127084 spots for SRR14639622.sra Written 1127084 spots for SRR14639622.sra Read 1127084 spots for SRR14639622.sra Written 1127084 spots for SRR14639622.sra Read 1127084 spots for SRR14639622.sra Written 1127084 spots for SRR14639622.sra Read 1127084 spots for SRR14639622.sra Written 1127084 spots for SRR14639622.sra Read 1127084 spots for SRR14639622.sra Written 1127084 spots for SRR14639622.sra Read 1127084 spots for SRR14639622.sra Written 1127084 spots for SRR14639622.sra Read 1127084 spots for SRR14639622.sra Written 1127084 spots for SRR14639622.sra Read 1127084 spots for SRR14639622.sra Written 1127084 spots for SRR14639622.sra Read 1127084 spots for SRR14639622.sra Written 1127084 spots for SRR14639622.sra Read 1127084 spots for SRR14639622.sra Written 1127084 spots for SRR14639622.sra Read 1127084 spots for SRR14639622.sra Written 1127084 spots for SRR14639622.sra Read 1127084 spots for SRR14639622.sra Written 1127084 spots for SRR14639622.sra Read 1127084 spots for SRR14639622.sra Written 1127084 spots for SRR14639622.sra Read 1127084 spots for SRR14639622.sra Written 1127084 spots for SRR14639622.sra Read 1127084 spots for SRR14639622.sra Written 1127084 spots for SRR14639622.sra Read 1127102 spots for SRR14639622.sra Written 1127102 spots for SRR14639622.sra Read 1127084 spots for SRR14639622.sra Written 1127084 spots for SRR14639622.sra SRR ids: ['SRR14639622.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_oinxdsm_ SRR14639622.sra spots: 22541698 blocks: [[1, 1127084], [1127085, 2254168], [2254169, 3381252], [3381253, 4508336], [4508337, 5635420], [5635421, 6762504], [6762505, 7889588], [7889589, 9016672], [9016673, 10143756], [10143757, 11270840], [11270841, 12397924], [12397925, 13525008], [13525009, 14652092], [14652093, 15779176], [15779177, 16906260], [16906261, 18033344], [18033345, 19160428], [19160429, 20287512], [20287513, 21414596], [21414597, 22541698]] SRR14639622 file size 8344004 SRR14639622 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR14639622 SRR14639622_1.fastq SRR14639622_2.fastq Input file: SRR14639622_1.fastq Paired file: SRR14639622_2.fastq trimmed: SRR14639622-trimmed-pair1.fastq, SRR14639622-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 15:35:15 2025 >> started Mon Feb 10 15:35:41 2025 >> done (25.940s) 22541698 read pairs processed; of these: 77 ( 0.00%) short read pairs filtered out after trimming by size control 74 ( 0.00%) empty read pairs filtered out after trimming by size control 22541547 (100.00%) read pairs available; of these: 1947794 ( 8.64%) trimmed read pairs available after processing 20593753 (91.36%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 20 0.00% 19 25 0.00% 20 20 0.00% 21 24 0.00% 22 25 0.00% 23 28 0.00% 24 24 0.00% 25 31 0.00% 26 44 0.00% 27 36 0.00% 28 41 0.00% 29 57 0.00% 30 57 0.00% 31 45 0.00% 32 48 0.00% 33 63 0.00% 34 69 0.00% 35 75 0.00% 36 60 0.00% 37 64 0.00% 38 82 0.00% 39 83 0.00% 40 74 0.00% 41 79 0.00% 42 80 0.00% 43 93 0.00% 44 97 0.00% 45 100 0.00% 46 98 0.00% 47 92 0.00% 48 98 0.00% 49 105 0.00% 50 139 0.00% 51 116 0.00% 52 117 0.00% 53 122 0.00% 54 133 0.00% 55 157 0.00% 56 155 0.00% 57 172 0.00% 58 160 0.00% 59 182 0.00% 60 209 0.00% 61 203 0.00% 62 223 0.00% 63 204 0.00% 64 240 0.00% 65 246 0.00% 66 237 0.00% 67 268 0.00% 68 307 0.00% 69 348 0.00% 70 372 0.00% 71 373 0.00% 72 468 0.00% 73 523 0.00% 74 546 0.00% 75 619 0.00% 76 626 0.00% 77 709 0.00% 78 762 0.00% 79 831 0.00% 80 892 0.00% 81 1036 0.00% 82 1127 0.00% 83 1195 0.01% 84 1386 0.01% 85 1525 0.01% 86 1729 0.01% 87 1837 0.01% 88 2080 0.01% 89 2229 0.01% 90 2385 0.01% 91 2550 0.01% 92 2933 0.01% 93 3204 0.01% 94 3563 0.02% 95 3891 0.02% 96 4461 0.02% 97 4659 0.02% 98 5124 0.02% 99 5631 0.02% 100 6048 0.03% 101 6569 0.03% 102 7301 0.03% 103 7816 0.03% 104 8339 0.04% 105 9367 0.04% 106 10112 0.04% 107 10874 0.05% 108 11448 0.05% 109 12559 0.06% 110 13579 0.06% 111 14537 0.06% 112 15342 0.07% 113 16473 0.07% 114 17653 0.08% 115 18789 0.08% 116 20051 0.09% 117 21086 0.09% 118 22326 0.10% 119 23734 0.11% 120 25145 0.11% 121 26468 0.12% 122 27700 0.12% 123 29590 0.13% 124 30798 0.14% 125 32471 0.14% 126 34056 0.15% 127 35400 0.16% 128 37418 0.17% 129 38635 0.17% 130 40213 0.18% 131 41668 0.18% 132 39536 0.18% 133 40304 0.18% 134 40524 0.18% 135 43017 0.19% 136 43643 0.19% 137 44767 0.20% 138 46030 0.20% 139 47211 0.21% 140 48012 0.21% 141 49589 0.22% 142 50470 0.22% 143 51425 0.23% 144 52651 0.23% 145 53196 0.24% 146 54410 0.24% 147 59066 0.26% 148 78299 0.35% 149 366938 1.63% 150 20593753 91.36% 22541547 reads passed initial QC criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=2.94 fanout-score-rank=16 prefix-density=0.25 prefix-fanout=2.9 sequence=CCACATTTGCAGCCA criterion=fanout-score sequence-density=0.02 sequence-density-rank=40 fanout-score=22.33 fanout-score-rank=1 prefix-density=0.19 prefix-fanout=2.2 sequence=CGCATCGCCGGCCCCCATCCACTTCCCTCCCGACAATTTCAAGCACTCTTTGACTCTCTTTTCAAAGTCCTTTTCATCTTTCCCTCGCGGTACTTGTTTGCTATCGGTCTCTCGCCCGTATTTAGCCTTGGACGGAATTTACCGCCCGATTGGGGCTGCATTCCCAAACAACCCGACTCGCAGACAGCGCCTCGTGGTGCGGCAGGGTCCAGCCACGACGGGGCTCTCACCCTCTCCGGCGCCCCTTTCCAGGGGACTTGGGCCTGGTCCGCCGCTGAGGACGCTTCTCCAGACTACAATTCGGACGCCGCAGGCGCCAGATTCTCAAGCTGGGCATTTCCCGGTTCGCTCGCCGTTACTAGGGG criterion=sequence-density sequence-density=0.37 sequence-density-rank=1 fanout-score=3.83 fanout-score-rank=11 prefix-density=0.48 prefix-fanout=3.0 sequence=CTGCAAATGTGG criterion=fanout-score sequence-density=0.08 sequence-density-rank=28 fanout-score=35.16 fanout-score-rank=1 prefix-density=0.43 prefix-fanout=7.0 sequence=GAAAAGAAACTTACAAGGATTCCCCTAGTAACGGCGAGCGAACCGGGAAATGCCCAGCTTGAGAATCTGGCGCCTGCGGCGTCCGAATTGTAGTCTGGAGAAGCGTCCTCAGCGGCGGACCAGGCCCAAGTCCCCTGGAAAGGGGCGCCGGAGAGGGTGAGAGCCCCGTCGTGGCTGGACCCTGCCGCACCACGAGGCGCTGTCTGCGAGTCGGGTTGTTTGGGA SRR14639622 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 15:36:56 Started mapping on | Feb 10 15:36:56 Finished on | Feb 10 15:51:11 Mapping speed, Million of reads per hour | 94.91 Number of input reads | 22541547 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 14067763 Uniquely mapped reads % | 62.41% Average mapped length | 294.98 Number of splices: Total | 11791924 Number of splices: Annotated (sjdb) | 11548615 Number of splices: GT/AG | 11599291 Number of splices: GC/AG | 142163 Number of splices: AT/AC | 11129 Number of splices: Non-canonical | 39341 Mismatch rate per base, % | 0.51% Deletion rate per base | 0.03% Deletion average length | 2.90 Insertion rate per base | 0.02% Insertion average length | 2.58 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 450691 % of reads mapped to multiple loci | 2.00% Number of reads mapped to too many loci | 432955 % of reads mapped to too many loci | 1.92% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 32.31% % of reads unmapped: other | 1.36% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 8023093 8023093 8023093 N_multimapping 450691 450691 450691 N_noFeature 450971 13953285 501458 N_ambiguous 159909 933 95360 UnstrandedReadsAssigned:13456883 PositiveStrandReadsAssigned:113545 NegativeStrandReadsAssigned:13470945 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR14639622 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR14639622-trimmed-pair1.fastq SRR14639622-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,541,547 reads, 14,733,213 reads pseudoaligned [quant] estimated average fragment length: 275.374 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,181 rounds 52401 SRR14639622.ke.tsv 34699 SRR14639622.se.tsv 87100 total ==> SRR14639622.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1743.63 3095 108.701 Potri.005G024800.1.v4.1 1035 760.626 426 34.2975 Potri.004G059700.1.v4.1 961 686.906 173 15.4232 Potri.007G009000.2.v4.1 1416 1141.63 0 0 Potri.003G141000.2.v4.1 2943 2668.63 733.219 16.8256 Potri.016G087400.1.v4.1 270 80.211 907 692.465 Potri.015G069301.1.v4.1 564 308.129 0 0 Potri.010G195200.1.v4.1 1773 1498.63 23 0.939851 Potri.012G127500.1.v4.1 977 702.761 2004 174.628 ==> SRR14639622.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 26 Potri.001G233950.v4.1 3 Potri.001G122700.v4.1 204 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 13 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 296 SRR14639622 completed mapping pipeline successfully