Starting /dee2/code/volunteer_pipeline.sh SRR14639623 current disk space = 3058901819392 free memory = 1056551568 SRR14639623 SRAfilesize b796fc766e5eda2497b667afd93b341d SRR14639623.sra SRR14639623.sra file validated SRR14639623 is paired end SRR14639623 is conventional basespace SRR14639623 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14639623_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.67125 32.0 32.0 32.0 32.0 32.0 2 31.6625 32.0 32.0 32.0 32.0 32.0 3 35.3525 37.0 37.0 37.0 32.0 37.0 4 36.2075 37.0 37.0 37.0 37.0 37.0 5 36.32375 37.0 37.0 37.0 37.0 37.0 6 39.9355 41.0 41.0 41.0 37.0 41.0 7 40.06475 41.0 41.0 41.0 37.0 41.0 8 40.10925 41.0 41.0 41.0 37.0 41.0 9 40.17375 41.0 41.0 41.0 37.0 41.0 10-14 40.289199999999994 41.0 41.0 41.0 41.0 41.0 15-19 40.2544 41.0 41.0 41.0 38.6 41.0 20-24 40.23774999999999 41.0 41.0 41.0 40.2 41.0 25-29 40.15175 41.0 41.0 41.0 39.4 41.0 30-34 40.096450000000004 41.0 41.0 41.0 37.8 41.0 35-39 40.01815 41.0 41.0 41.0 37.8 41.0 40-44 39.9718 41.0 41.0 41.0 37.0 41.0 45-49 39.98695 41.0 41.0 41.0 37.0 41.0 50-54 39.896249999999995 41.0 41.0 41.0 37.0 41.0 55-59 39.781150000000004 41.0 41.0 41.0 37.0 41.0 60-64 39.792649999999995 41.0 41.0 41.0 37.0 41.0 65-69 39.63440000000001 41.0 41.0 41.0 37.0 41.0 70-74 39.504599999999996 41.0 41.0 41.0 37.0 41.0 75-79 39.080999999999996 41.0 40.2 41.0 35.0 41.0 80-84 39.443949999999994 41.0 41.0 41.0 37.0 41.0 85-89 39.4405 41.0 41.0 41.0 37.0 41.0 90-94 39.35895 41.0 41.0 41.0 37.0 41.0 95-99 39.338 41.0 41.0 41.0 37.0 41.0 100-104 39.20625 41.0 41.0 41.0 37.0 41.0 105-109 39.0446 41.0 41.0 41.0 37.0 41.0 110-114 39.1118 41.0 41.0 41.0 36.0 41.0 115-119 39.0477 41.0 41.0 41.0 37.0 41.0 120-124 38.98745 41.0 41.0 41.0 36.0 41.0 125-129 39.02315 41.0 41.0 41.0 34.0 41.0 130-134 38.82655 41.0 41.0 41.0 33.0 41.0 135-139 38.510149999999996 41.0 41.0 41.0 32.0 41.0 140-144 38.29315 41.0 38.6 41.0 32.0 41.0 145-149 38.110350000000004 41.0 37.0 41.0 32.0 41.0 150 38.025 41.0 37.0 41.0 32.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 2.0 21 4.0 22 3.0 23 5.0 24 3.0 25 7.0 26 17.0 27 10.0 28 16.0 29 21.0 30 28.0 31 38.0 32 40.0 33 46.0 34 68.0 35 89.0 36 116.0 37 144.0 38 231.0 39 493.0 40 2619.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.06753376688344 13.556778389194598 16.833416708354175 34.54227113556778 2 16.875 11.275 38.25 33.6 3 18.2 20.625 27.700000000000003 33.475 4 22.7 26.075 26.575 24.65 5 22.025 32.375 26.900000000000002 18.7 6 17.224999999999998 31.55 30.5 20.724999999999998 7 17.1 24.75 39.5 18.65 8 14.774999999999999 23.875 37.85 23.5 9 17.1 26.1 33.825 22.975 10-14 20.080000000000002 28.24 28.105000000000004 23.575 15-19 20.25 27.800000000000004 28.349999999999998 23.599999999999998 20-24 20.06 27.900000000000002 28.050000000000004 23.990000000000002 25-29 20.674999999999997 27.665 27.950000000000003 23.71 30-34 19.8 28.144999999999996 28.115000000000002 23.94 35-39 20.625 27.92 27.485 23.97 40-44 20.75 28.51 27.21 23.53 45-49 20.84 27.805000000000003 27.700000000000003 23.655 50-54 20.895 27.975 27.355 23.775 55-59 20.424999999999997 27.685 27.605 24.285 60-64 20.925 27.400000000000002 28.075 23.599999999999998 65-69 20.305 27.779999999999998 28.125 23.79 70-74 21.135 27.77 27.284999999999997 23.810000000000002 75-79 20.735 28.215 27.685 23.365 80-84 20.655 28.065 27.61 23.669999999999998 85-89 21.23 27.834999999999997 27.334999999999997 23.599999999999998 90-94 20.915 27.345000000000002 28.21 23.53 95-99 21.349999999999998 27.725 27.605 23.32 100-104 21.445 27.474999999999998 27.439999999999998 23.64 105-109 21.706085304265212 28.376418820941048 27.161358067903397 22.756137806890344 110-114 21.029999999999998 27.169999999999998 27.765 24.035 115-119 21.62 28.075 27.02 23.285 120-124 21.36 27.944999999999997 26.82 23.875 125-129 22.03 27.384999999999998 26.834999999999997 23.75 130-134 21.310000000000002 27.37 27.12 24.2 135-139 22.1 27.689999999999998 26.565 23.645 140-144 21.488223233485023 28.00920138020703 26.704005600840127 23.798569785467823 145-149 22.21 27.16 26.695 23.935000000000002 150 22.275 27.275 26.174999999999997 24.275 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 6.0 1 3.0 2 0.0 3 0.5 4 0.5 5 0.0 6 1.0 7 1.5 8 1.5 9 1.0 10 0.5 11 0.5 12 0.5 13 1.5 14 1.0 15 0.5 16 1.0 17 1.5 18 1.0 19 1.0 20 1.5 21 2.0 22 3.0 23 2.0 24 1.0 25 2.5 26 5.0 27 10.0 28 19.0 29 17.5 30 17.0 31 27.0 32 33.0 33 40.5 34 52.0 35 63.5 36 83.5 37 112.0 38 125.5 39 139.5 40 175.0 41 209.5 42 228.0 43 238.0 44 237.5 45 239.5 46 255.0 47 257.5 48 229.0 49 180.0 50 157.0 51 146.5 52 133.0 53 112.0 54 84.0 55 66.0 56 56.5 57 52.0 58 35.5 59 25.0 60 21.5 61 17.5 62 14.5 63 10.5 64 8.0 65 8.0 66 7.0 67 4.5 68 4.5 69 4.0 70 2.0 71 1.0 72 0.5 73 0.0 74 0.0 75 0.5 76 1.0 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.005 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.015 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.0 #Duplication Level Percentage of deduplicated Percentage of total 1 96.27604166666667 92.425 2 3.4375000000000004 6.6000000000000005 3 0.234375 0.675 4 0.0 0.0 5 0.026041666666666668 0.125 6 0.0 0.0 7 0.026041666666666668 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 7 0.17500000000000002 No Hit ATCGGAAGAGCACACGTCTGAACTCCAGTCACTCTCGCGCATCTCGTATG 5 0.125 TruSeq Adapter, Index 8 (97% over 35bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.1125 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.175 0.0 0.0 0.0 0.0 96-97 0.25 0.0 0.0 0.0 0.0 98-99 0.2875 0.0 0.0 0.0 0.0 100-101 0.325 0.0 0.0 0.0 0.0 102-103 0.375 0.0 0.0 0.0 0.0 104-105 0.525 0.0 0.0 0.0 0.0 106-107 0.575 0.0 0.0 0.0 0.0 108-109 0.6625 0.0 0.0 0.0 0.0 110-111 0.8375 0.0 0.0 0.0 0.0 112-113 1.0375 0.0 0.0 0.0 0.0 114-115 1.15 0.0 0.0 0.0 0.0 116-117 1.3125 0.0 0.0 0.0 0.0 118-119 1.5625 0.0 0.0 0.0 0.0 120-121 1.65 0.0 0.0 0.0 0.0 122-123 1.7625000000000002 0.0 0.0 0.0 0.0 124-125 1.9375 0.0 0.0 0.0 0.0 126-127 2.1875 0.0 0.0 0.0 0.0 128-129 2.4749999999999996 0.0 0.0 0.0 0.0 130-131 2.6500000000000004 0.0 0.0 0.0 0.0 132-133 2.8625 0.0 0.0 0.0 0.0 134-135 3.1625 0.0 0.0 0.0 0.0 136-137 3.4875 0.0 0.0 0.0 0.0 138 3.875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGCTAAT 10 0.006973645 144.0 6 >>END_MODULE SRR14639623 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14639623_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.88375 32.0 32.0 32.0 32.0 32.0 2 30.98875 32.0 32.0 32.0 32.0 32.0 3 33.73625 37.0 32.0 37.0 32.0 37.0 4 34.94 37.0 37.0 37.0 32.0 37.0 5 35.215 37.0 37.0 37.0 32.0 37.0 6 38.457 41.0 41.0 41.0 32.0 41.0 7 38.15975 41.0 41.0 41.0 32.0 41.0 8 38.3745 41.0 41.0 41.0 32.0 41.0 9 38.53425 41.0 41.0 41.0 32.0 41.0 10-14 38.6107 41.0 41.0 41.0 33.0 41.0 15-19 38.5253 41.0 41.0 41.0 32.0 41.0 20-24 38.518699999999995 41.0 41.0 41.0 32.0 41.0 25-29 38.173249999999996 41.0 40.2 41.0 30.0 41.0 30-34 38.197449999999996 41.0 41.0 41.0 30.0 41.0 35-39 38.015 41.0 38.6 41.0 29.0 41.0 40-44 37.84255 41.0 37.0 41.0 28.0 41.0 45-49 37.803749999999994 41.0 37.8 41.0 27.0 41.0 50-54 37.71835 41.0 37.0 41.0 28.0 41.0 55-59 37.7876 41.0 37.0 41.0 27.0 41.0 60-64 37.72435 41.0 37.0 41.0 27.0 41.0 65-69 37.60080000000001 41.0 37.0 41.0 27.0 41.0 70-74 37.33445 41.0 37.0 41.0 27.0 41.0 75-79 36.59054999999999 40.2 36.0 41.0 24.0 41.0 80-84 37.42975 41.0 37.0 41.0 26.0 41.0 85-89 37.49215 41.0 37.0 41.0 27.0 41.0 90-94 37.3972 41.0 37.0 41.0 25.0 41.0 95-99 37.401399999999995 41.0 37.0 41.0 27.0 41.0 100-104 37.12165 41.0 37.0 41.0 24.0 41.0 105-109 37.12595 41.0 37.0 41.0 24.0 41.0 110-114 37.1494 41.0 37.0 41.0 26.0 41.0 115-119 36.8054 41.0 37.0 41.0 23.0 41.0 120-124 36.908249999999995 41.0 37.0 41.0 22.0 41.0 125-129 36.463 41.0 37.0 41.0 22.0 41.0 130-134 36.41905 41.0 37.0 41.0 22.0 41.0 135-139 35.96205 41.0 36.0 41.0 22.0 41.0 140-144 35.7156 41.0 37.0 41.0 20.0 41.0 145-149 35.6517 41.0 36.0 41.0 20.0 41.0 150 35.292 41.0 32.0 41.0 12.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 0.0 15 4.0 16 9.0 17 18.0 18 33.0 19 32.0 20 28.0 21 25.0 22 22.0 23 29.0 24 40.0 25 28.0 26 31.0 27 42.0 28 32.0 29 56.0 30 59.0 31 63.0 32 73.0 33 87.0 34 113.0 35 127.0 36 173.0 37 200.0 38 322.0 39 554.0 40 1799.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 34.101728890002505 27.411676271611125 14.282134803307441 24.204460035078927 2 19.525000000000002 25.5 36.425000000000004 18.55 3 19.975 26.3 34.075 19.650000000000002 4 24.0 32.025 24.25 19.725 5 22.45 38.074999999999996 22.625 16.85 6 17.849999999999998 33.95 28.249999999999996 19.950000000000003 7 19.5 23.375 33.925 23.200000000000003 8 17.224999999999998 23.425 33.725 25.624999999999996 9 20.625 25.85 29.975 23.549999999999997 10-14 22.134999999999998 28.465 26.314999999999998 23.085 15-19 22.595000000000002 27.275 27.694999999999997 22.435 20-24 22.12 27.42 27.435 23.025000000000002 25-29 22.585 26.939999999999998 27.675 22.8 30-34 22.505 27.689999999999998 27.115000000000002 22.689999999999998 35-39 22.0 27.52 27.894999999999996 22.585 40-44 22.185 27.045 28.38 22.39 45-49 22.025 27.435 28.175 22.365 50-54 22.785 26.669999999999998 28.57 21.975 55-59 22.41 27.384999999999998 27.765 22.439999999999998 60-64 23.369999999999997 27.195000000000004 27.715 21.72 65-69 23.02 27.58 27.54 21.86 70-74 23.565 27.455000000000002 27.095000000000002 21.884999999999998 75-79 23.369999999999997 27.555000000000003 27.439999999999998 21.634999999999998 80-84 23.3 27.229999999999997 27.905 21.565 85-89 23.375 27.415 27.275 21.935 90-94 23.73 27.235 27.16 21.875 95-99 23.115 27.235 27.884999999999998 21.765 100-104 23.35 27.48 27.334999999999997 21.834999999999997 105-109 23.715 26.965 27.785 21.535 110-114 23.65 27.605 27.224999999999998 21.52 115-119 23.794999999999998 27.765 26.724999999999998 21.715 120-124 24.77 26.99 26.845000000000002 21.395 125-129 23.87 27.43 27.33 21.37 130-134 24.47 27.705000000000002 26.645000000000003 21.18 135-139 25.040000000000003 27.41 26.52 21.029999999999998 140-144 24.365000000000002 27.49 27.025 21.12 145-149 24.7 27.544999999999998 26.529999999999998 21.224999999999998 150 24.65 28.525 25.75 21.075 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 0.5 20 0.5 21 1.5 22 2.5 23 2.5 24 2.5 25 2.5 26 4.0 27 8.0 28 10.0 29 10.5 30 14.0 31 27.5 32 36.5 33 37.5 34 50.0 35 69.0 36 91.0 37 103.5 38 127.0 39 162.0 40 191.0 41 215.5 42 230.0 43 245.0 44 236.0 45 223.0 46 239.5 47 234.5 48 199.5 49 185.0 50 169.5 51 139.5 52 118.0 53 108.0 54 95.5 55 85.0 56 76.5 57 54.5 58 37.0 59 30.5 60 23.0 61 17.0 62 15.0 63 15.0 64 12.5 65 8.0 66 7.0 67 4.0 68 3.0 69 2.5 70 3.0 71 3.0 72 0.5 73 0.0 74 0.5 75 1.5 76 1.5 77 1.0 78 1.0 79 0.5 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.22499999999999998 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.42500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 96.6554316826549 93.2 2 3.11122634171636 6.0 3 0.18148820326678766 0.525 4 0.0 0.0 5 0.025926886180969663 0.125 6 0.025926886180969663 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTTAAGATTAGTGTAGATCTC 6 0.15 Illumina Single End PCR Primer 1 (96% over 31bp) GTTAGGCTTGAGCAGATTCATTCGCCAACTAACCCTTTAATTTATCCTAT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.1625 0.0 0.0 0.0 0.0 98-99 0.21250000000000002 0.0 0.0 0.0 0.0 100-101 0.25 0.0 0.0 0.0 0.0 102-103 0.3125 0.0 0.0 0.0 0.0 104-105 0.4125 0.0 0.0 0.0 0.0 106-107 0.45 0.0 0.0 0.0 0.0 108-109 0.55 0.0 0.0 0.0 0.0 110-111 0.5874999999999999 0.0 0.0 0.0 0.0 112-113 0.7375 0.0 0.0 0.0 0.0 114-115 0.8 0.0 0.0 0.0 0.0 116-117 0.9624999999999999 0.0 0.0 0.0 0.0 118-119 1.15 0.0 0.0 0.0 0.0 120-121 1.2 0.0 0.0 0.0 0.0 122-123 1.2875 0.0 0.0 0.0 0.0 124-125 1.4 0.0 0.0 0.0 0.0 126-127 1.6 0.0 0.0 0.0 0.0 128-129 1.8875000000000002 0.0 0.0 0.0 0.0 130-131 1.975 0.0 0.0 0.0 0.0 132-133 2.125 0.0 0.0 0.0 0.0 134-135 2.3125 0.0 0.0 0.0 0.0 136-137 2.5375 0.0 0.0 0.0 0.0 138 2.9 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAAATCT 10 0.006973645 144.0 1 TCCTACG 10 0.006973645 144.0 2 >>END_MODULE Read 975958 spots for SRR14639623.sra Written 975958 spots for SRR14639623.sra Read 975958 spots for SRR14639623.sra Written 975958 spots for SRR14639623.sra Read 975958 spots for SRR14639623.sra Written 975958 spots for SRR14639623.sra Read 975958 spots for SRR14639623.sra Written 975958 spots for SRR14639623.sra Read 975958 spots for SRR14639623.sra Written 975958 spots for SRR14639623.sra Read 975958 spots for SRR14639623.sra Written 975958 spots for SRR14639623.sra Read 975958 spots for SRR14639623.sra Written 975958 spots for SRR14639623.sra Read 975958 spots for SRR14639623.sra Written 975958 spots for SRR14639623.sra Read 975958 spots for SRR14639623.sra Written 975958 spots for SRR14639623.sra Read 975958 spots for SRR14639623.sra Written 975958 spots for SRR14639623.sra Read 975958 spots for SRR14639623.sra Written 975958 spots for SRR14639623.sra Read 975958 spots for SRR14639623.sra Written 975958 spots for SRR14639623.sra Read 975958 spots for SRR14639623.sra Written 975958 spots for SRR14639623.sra Read 975958 spots for SRR14639623.sra Written 975958 spots for SRR14639623.sra Read 975958 spots for SRR14639623.sra Written 975958 spots for SRR14639623.sra Read 975958 spots for SRR14639623.sra Written 975958 spots for SRR14639623.sra Read 975958 spots for SRR14639623.sra Written 975958 spots for SRR14639623.sra Read 975958 spots for SRR14639623.sra Written 975958 spots for SRR14639623.sra Read 975961 spots for SRR14639623.sra Written 975961 spots for SRR14639623.sra Read 975958 spots for SRR14639623.sra Written 975958 spots for SRR14639623.sra SRR ids: ['SRR14639623.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_1__7z1ro SRR14639623.sra spots: 19519163 blocks: [[1, 975958], [975959, 1951916], [1951917, 2927874], [2927875, 3903832], [3903833, 4879790], [4879791, 5855748], [5855749, 6831706], [6831707, 7807664], [7807665, 8783622], [8783623, 9759580], [9759581, 10735538], [10735539, 11711496], [11711497, 12687454], [12687455, 13663412], [13663413, 14639370], [14639371, 15615328], [15615329, 16591286], [16591287, 17567244], [17567245, 18543202], [18543203, 19519163]] SRR14639623 file size 7223709 SRR14639623 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR14639623 SRR14639623_1.fastq SRR14639623_2.fastq Input file: SRR14639623_1.fastq Paired file: SRR14639623_2.fastq trimmed: SRR14639623-trimmed-pair1.fastq, SRR14639623-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 14:23:33 2025 >> started Mon Feb 10 14:23:55 2025 >> done (21.371s) 19519163 read pairs processed; of these: 69 ( 0.00%) short read pairs filtered out after trimming by size control 31 ( 0.00%) empty read pairs filtered out after trimming by size control 19519063 (100.00%) read pairs available; of these: 2033343 (10.42%) trimmed read pairs available after processing 17485720 (89.58%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 17 0.00% 19 10 0.00% 20 6 0.00% 21 19 0.00% 22 18 0.00% 23 19 0.00% 24 24 0.00% 25 28 0.00% 26 22 0.00% 27 33 0.00% 28 36 0.00% 29 24 0.00% 30 31 0.00% 31 26 0.00% 32 37 0.00% 33 34 0.00% 34 40 0.00% 35 35 0.00% 36 50 0.00% 37 49 0.00% 38 54 0.00% 39 39 0.00% 40 41 0.00% 41 48 0.00% 42 57 0.00% 43 55 0.00% 44 56 0.00% 45 47 0.00% 46 64 0.00% 47 66 0.00% 48 73 0.00% 49 89 0.00% 50 113 0.00% 51 102 0.00% 52 93 0.00% 53 85 0.00% 54 117 0.00% 55 123 0.00% 56 132 0.00% 57 131 0.00% 58 153 0.00% 59 162 0.00% 60 177 0.00% 61 194 0.00% 62 222 0.00% 63 224 0.00% 64 243 0.00% 65 255 0.00% 66 299 0.00% 67 357 0.00% 68 393 0.00% 69 424 0.00% 70 470 0.00% 71 562 0.00% 72 592 0.00% 73 687 0.00% 74 777 0.00% 75 821 0.00% 76 992 0.01% 77 1070 0.01% 78 1180 0.01% 79 1322 0.01% 80 1519 0.01% 81 1671 0.01% 82 1889 0.01% 83 2102 0.01% 84 2340 0.01% 85 2765 0.01% 86 2951 0.02% 87 3222 0.02% 88 3758 0.02% 89 3973 0.02% 90 4447 0.02% 91 4932 0.03% 92 5181 0.03% 93 5994 0.03% 94 6590 0.03% 95 7143 0.04% 96 7739 0.04% 97 8404 0.04% 98 8984 0.05% 99 9812 0.05% 100 10395 0.05% 101 11198 0.06% 102 12120 0.06% 103 13053 0.07% 104 14037 0.07% 105 14813 0.08% 106 15915 0.08% 107 16880 0.09% 108 17700 0.09% 109 18909 0.10% 110 19445 0.10% 111 20844 0.11% 112 21936 0.11% 113 23386 0.12% 114 24200 0.12% 115 25379 0.13% 116 26810 0.14% 117 27832 0.14% 118 28863 0.15% 119 30117 0.15% 120 31051 0.16% 121 31853 0.16% 122 33492 0.17% 123 34640 0.18% 124 35903 0.18% 125 36996 0.19% 126 38702 0.20% 127 39301 0.20% 128 41261 0.21% 129 41580 0.21% 130 42636 0.22% 131 43643 0.22% 132 40497 0.21% 133 41844 0.21% 134 41368 0.21% 135 42356 0.22% 136 42897 0.22% 137 43363 0.22% 138 44686 0.23% 139 45215 0.23% 140 45588 0.23% 141 46740 0.24% 142 47343 0.24% 143 47987 0.25% 144 48156 0.25% 145 48380 0.25% 146 49148 0.25% 147 52928 0.27% 148 67176 0.34% 149 283646 1.45% 150 17485720 89.58% 19519063 reads passed initial QC criterion=sequence-density sequence-density=0.32 sequence-density-rank=1 fanout-score=3.05 fanout-score-rank=18 prefix-density=0.32 prefix-fanout=3.0 sequence=CCACATTTGCAGCCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=20.43 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=2.4 sequence=CGCATCGCCGGCCCCCATCCACTTCCCTCCCGACAATTTCAAGCACTCTTTGACTCTCTTTTCAAAGTCCTTTTCATCTTTCCCTCGCGGTACTTGTTTGCTATCGGTCTCTCGCCCGTATTTAGCCTTGGACGGAATTTACCGCCCGATTGGGGCTGCATTCCCAAACAACCCGACTCGCAGACAGCGCCTCGTGGTGCGGCAGGGTCCAGCCACGACGGGGCTCTCACCCTCTCCGGCGCCCCTTTCCAGGGGACTTGGGCCTGGTCCGCCGCTGAGGACGCTTCTCCAGACTACAATTCGGACGCCGCAGGCGCCAGATTCTCAAGCTGGGCATTTCCCGGTTCGCTCGCCGTTACTAGGGGAATCCTTGTAAGTTTCTTTTC criterion=sequence-density sequence-density=0.48 sequence-density-rank=1 fanout-score=4.06 fanout-score-rank=11 prefix-density=0.63 prefix-fanout=3.1 sequence=CTGCAAATGTGG criterion=fanout-score sequence-density=0.10 sequence-density-rank=24 fanout-score=39.37 fanout-score-rank=1 prefix-density=0.32 prefix-fanout=11.6 sequence=CTCTCTCTTTCTCTTAAGTTAGCAATTCACCCTCCTTCTCTCCCGAGATTCAGATCAAATAAAGCAGGTCCGATGGCACTAG SRR14639623 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 14:24:56 Started mapping on | Feb 10 14:24:56 Finished on | Feb 10 14:33:22 Mapping speed, Million of reads per hour | 138.87 Number of input reads | 19519063 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 14184245 Uniquely mapped reads % | 72.67% Average mapped length | 293.50 Number of splices: Total | 11805181 Number of splices: Annotated (sjdb) | 11547855 Number of splices: GT/AG | 11608058 Number of splices: GC/AG | 145813 Number of splices: AT/AC | 10956 Number of splices: Non-canonical | 40354 Mismatch rate per base, % | 0.50% Deletion rate per base | 0.03% Deletion average length | 2.95 Insertion rate per base | 0.02% Insertion average length | 2.55 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 421805 % of reads mapped to multiple loci | 2.16% Number of reads mapped to too many loci | 226193 % of reads mapped to too many loci | 1.16% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 23.32% % of reads unmapped: other | 0.69% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 4913013 4913013 4913013 N_multimapping 421805 421805 421805 N_noFeature 509509 14065464 565513 N_ambiguous 161495 987 98130 UnstrandedReadsAssigned:13513241 PositiveStrandReadsAssigned:117794 NegativeStrandReadsAssigned:13520602 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR14639623 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR14639623-trimmed-pair1.fastq SRR14639623-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,519,063 reads, 14,425,074 reads pseudoaligned [quant] estimated average fragment length: 266.372 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,121 rounds 52401 SRR14639623.ke.tsv 34699 SRR14639623.se.tsv 87100 total ==> SRR14639623.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1752.63 2805 106.574 Potri.005G024800.1.v4.1 1035 769.628 280 24.2262 Potri.004G059700.1.v4.1 961 695.859 132 12.6317 Potri.007G009000.2.v4.1 1416 1150.63 0 0 Potri.003G141000.2.v4.1 2943 2677.63 722.917 17.9782 Potri.016G087400.1.v4.1 270 85.0045 949 743.416 Potri.015G069301.1.v4.1 564 314.752 0 0 Potri.010G195200.1.v4.1 1773 1507.63 29 1.28089 Potri.012G127500.1.v4.1 977 711.767 1436 134.346 ==> SRR14639623.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 32 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 219 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 6 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 376 SRR14639623 completed mapping pipeline successfully