Starting /dee2/code/volunteer_pipeline.sh SRR14639624 current disk space = 3058863337472 free memory = 1157513760 SRR14639624 SRAfilesize e33054ab2a33996e9f94fbe12910cb0e SRR14639624.sra SRR14639624.sra file validated SRR14639624 is paired end SRR14639624 is conventional basespace SRR14639624 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14639624_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.74375 32.0 32.0 32.0 32.0 32.0 2 31.5875 32.0 32.0 32.0 32.0 32.0 3 35.3 37.0 32.0 37.0 32.0 37.0 4 36.16375 37.0 37.0 37.0 32.0 37.0 5 36.19625 37.0 37.0 37.0 37.0 37.0 6 39.76725 41.0 41.0 41.0 37.0 41.0 7 39.8935 41.0 41.0 41.0 37.0 41.0 8 40.2035 41.0 41.0 41.0 37.0 41.0 9 40.20025 41.0 41.0 41.0 37.0 41.0 10-14 40.158249999999995 41.0 41.0 41.0 37.0 41.0 15-19 40.2296 41.0 41.0 41.0 39.4 41.0 20-24 40.200450000000004 41.0 41.0 41.0 39.4 41.0 25-29 40.179 41.0 41.0 41.0 40.2 41.0 30-34 40.178399999999996 41.0 41.0 41.0 41.0 41.0 35-39 40.0636 41.0 41.0 41.0 37.0 41.0 40-44 40.0301 41.0 41.0 41.0 37.0 41.0 45-49 40.02795 41.0 41.0 41.0 37.0 41.0 50-54 39.92085 41.0 41.0 41.0 37.0 41.0 55-59 39.8617 41.0 41.0 41.0 37.0 41.0 60-64 39.76975 41.0 41.0 41.0 37.0 41.0 65-69 39.70515 41.0 41.0 41.0 37.0 41.0 70-74 39.51395 41.0 41.0 41.0 37.0 41.0 75-79 39.125099999999996 41.0 40.2 41.0 36.0 41.0 80-84 39.5406 41.0 41.0 41.0 37.0 41.0 85-89 39.504000000000005 41.0 41.0 41.0 37.0 41.0 90-94 39.51695000000001 41.0 41.0 41.0 37.0 41.0 95-99 39.353449999999995 41.0 41.0 41.0 37.0 41.0 100-104 39.2909 41.0 41.0 41.0 37.0 41.0 105-109 39.205149999999996 41.0 41.0 41.0 37.0 41.0 110-114 39.0961 41.0 41.0 41.0 37.0 41.0 115-119 39.1549 41.0 41.0 41.0 37.0 41.0 120-124 39.05225 41.0 41.0 41.0 36.0 41.0 125-129 39.154999999999994 41.0 41.0 41.0 37.0 41.0 130-134 38.8142 41.0 41.0 41.0 32.0 41.0 135-139 38.564949999999996 41.0 41.0 41.0 32.0 41.0 140-144 38.31635 41.0 38.6 41.0 32.0 41.0 145-149 38.0409 41.0 37.0 41.0 32.0 41.0 150 38.0245 41.0 37.0 41.0 32.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 0.0 22 1.0 23 2.0 24 1.0 25 9.0 26 7.0 27 13.0 28 15.0 29 26.0 30 27.0 31 40.0 32 41.0 33 58.0 34 61.0 35 88.0 36 86.0 37 155.0 38 260.0 39 556.0 40 2553.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.675000000000004 13.125 11.275 39.925 2 17.675 11.55 39.050000000000004 31.724999999999998 3 18.8 17.474999999999998 28.249999999999996 35.475 4 24.6 23.75 23.75 27.900000000000002 5 23.75 31.724999999999998 24.625 19.900000000000002 6 18.375 32.225 27.725 21.675 7 16.25 26.875 39.074999999999996 17.8 8 16.075 23.674999999999997 36.85 23.400000000000002 9 17.825 24.825 34.975 22.375 10-14 20.31 28.04 27.47 24.18 15-19 20.535 27.05 27.145000000000003 25.27 20-24 21.26 27.21 27.505000000000003 24.025 25-29 20.855 27.834999999999997 27.389999999999997 23.919999999999998 30-34 20.51 27.465 27.034999999999997 24.990000000000002 35-39 20.990000000000002 27.61 27.165 24.235 40-44 20.915 27.05 27.87 24.165 45-49 20.845 27.750000000000004 27.1 24.305 50-54 20.79 27.67 27.22 24.32 55-59 21.545 27.500000000000004 26.645000000000003 24.310000000000002 60-64 21.275 27.345000000000002 27.525 23.855 65-69 21.6 27.139999999999997 27.224999999999998 24.035 70-74 21.85 27.24 27.189999999999998 23.72 75-79 21.515 27.515 27.015 23.955000000000002 80-84 21.68 27.27 26.56 24.490000000000002 85-89 21.490000000000002 27.855 26.75 23.905 90-94 21.63 27.075 26.979999999999997 24.315 95-99 22.015 27.205000000000002 26.88 23.9 100-104 22.065 27.435 26.884999999999998 23.615 105-109 21.779355871174236 27.495499099819966 26.840368073614723 23.88477695539108 110-114 22.065 27.255000000000003 26.924999999999997 23.755000000000003 115-119 21.715 27.145000000000003 27.400000000000002 23.74 120-124 21.86 27.200000000000003 27.060000000000002 23.880000000000003 125-129 21.83 27.49 26.490000000000002 24.19 130-134 22.3 27.21 26.229999999999997 24.26 135-139 22.48 27.0 26.834999999999997 23.685000000000002 140-144 22.155538884721178 27.051762940735184 26.716679169792446 24.07601900475119 145-149 22.175 27.26 26.6 23.965 150 22.725 26.05 25.5 25.724999999999998 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 1.0 19 1.5 20 1.0 21 1.0 22 1.5 23 2.0 24 3.0 25 6.5 26 10.0 27 8.5 28 10.0 29 13.0 30 16.0 31 19.5 32 27.5 33 35.5 34 41.5 35 54.0 36 73.0 37 100.0 38 112.5 39 121.5 40 140.0 41 181.5 42 224.0 43 240.0 44 242.0 45 226.0 46 215.5 47 212.0 48 218.0 49 226.0 50 201.5 51 163.5 52 139.5 53 121.5 54 107.5 55 88.5 56 74.0 57 63.0 58 43.5 59 37.5 60 33.5 61 23.0 62 22.5 63 20.0 64 13.5 65 13.0 66 9.5 67 7.0 68 7.0 69 7.0 70 5.0 71 1.0 72 1.5 73 2.5 74 2.0 75 0.5 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.5 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.02 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.025 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.8 #Duplication Level Percentage of deduplicated Percentage of total 1 95.77244258872652 91.75 2 4.07098121085595 7.8 3 0.15657620041753653 0.44999999999999996 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.0875 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1125 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.16249999999999998 0.0 0.0 0.0 0.0 98-99 0.175 0.0 0.0 0.0 0.0 100-101 0.21250000000000002 0.0 0.0 0.0 0.0 102-103 0.2625 0.0 0.0 0.0 0.0 104-105 0.275 0.0 0.0 0.0 0.0 106-107 0.275 0.0 0.0 0.0 0.0 108-109 0.35 0.0 0.0 0.0 0.0 110-111 0.5375 0.0 0.0 0.0 0.0 112-113 0.6499999999999999 0.0 0.0 0.0 0.0 114-115 0.7625 0.0 0.0 0.0 0.0 116-117 0.8625 0.0 0.0 0.0 0.0 118-119 0.9624999999999999 0.0 0.0 0.0 0.0 120-121 1.0375 0.0 0.0 0.0 0.0 122-123 1.125 0.0 0.0 0.0 0.0 124-125 1.2375 0.0 0.0 0.0 0.0 126-127 1.425 0.0 0.0 0.0 0.0 128-129 1.7125 0.0 0.0 0.0 0.0 130-131 1.9125 0.0 0.0 0.0 0.0 132-133 2.075 0.0 0.0 0.0 0.0 134-135 2.2625 0.0 0.0 0.0 0.0 136-137 2.55 0.0 0.0 0.0 0.0 138 2.75 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTCTGCT 15 1.1730364E-4 144.0 1 ATGGCGT 10 0.006973645 144.0 8 >>END_MODULE SRR14639624 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14639624_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.9275 32.0 32.0 32.0 32.0 32.0 2 30.84125 32.0 32.0 32.0 32.0 32.0 3 33.56 37.0 32.0 37.0 27.0 37.0 4 35.13 37.0 37.0 37.0 32.0 37.0 5 35.30125 37.0 37.0 37.0 32.0 37.0 6 38.6795 41.0 41.0 41.0 32.0 41.0 7 38.396 41.0 41.0 41.0 32.0 41.0 8 38.5555 41.0 41.0 41.0 32.0 41.0 9 38.82225 41.0 41.0 41.0 37.0 41.0 10-14 38.86775 41.0 41.0 41.0 36.0 41.0 15-19 38.548 41.0 41.0 41.0 32.0 41.0 20-24 38.544 41.0 41.0 41.0 32.0 41.0 25-29 38.243550000000006 41.0 39.4 41.0 31.0 41.0 30-34 38.2595 41.0 41.0 41.0 32.0 41.0 35-39 38.03025 41.0 37.8 41.0 31.0 41.0 40-44 37.97775 41.0 37.0 41.0 30.0 41.0 45-49 37.9547 41.0 37.0 41.0 29.0 41.0 50-54 37.80669999999999 41.0 37.0 41.0 28.0 41.0 55-59 37.826299999999996 41.0 37.0 41.0 27.0 41.0 60-64 37.773849999999996 41.0 37.0 41.0 28.0 41.0 65-69 37.59755 41.0 37.0 41.0 27.0 41.0 70-74 37.312599999999996 41.0 37.0 41.0 27.0 41.0 75-79 36.6074 40.2 36.0 41.0 24.0 41.0 80-84 37.50695 41.0 37.0 41.0 27.0 41.0 85-89 37.57215 41.0 37.0 41.0 27.0 41.0 90-94 37.21935 41.0 37.0 41.0 24.0 41.0 95-99 37.3786 41.0 37.0 41.0 27.0 41.0 100-104 37.18815 41.0 37.0 41.0 25.0 41.0 105-109 37.186400000000006 41.0 37.0 41.0 26.0 41.0 110-114 37.084500000000006 41.0 37.0 41.0 25.0 41.0 115-119 36.7528 41.0 37.0 41.0 23.0 41.0 120-124 36.7967 41.0 37.0 41.0 22.0 41.0 125-129 36.27595 41.0 37.0 41.0 22.0 41.0 130-134 36.23765 41.0 37.0 41.0 22.0 41.0 135-139 35.716750000000005 41.0 35.0 41.0 20.0 41.0 140-144 35.548550000000006 41.0 35.0 41.0 20.0 41.0 145-149 35.34465 41.0 36.0 41.0 18.0 41.0 150 34.9085 41.0 32.0 41.0 12.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 2.0 16 3.0 17 13.0 18 24.0 19 26.0 20 26.0 21 19.0 22 33.0 23 33.0 24 30.0 25 34.0 26 40.0 27 32.0 28 58.0 29 44.0 30 64.0 31 81.0 32 70.0 33 102.0 34 115.0 35 117.0 36 186.0 37 223.0 38 329.0 39 603.0 40 1693.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.5081555834379 24.441656210790462 9.73651191969887 30.31367628607277 2 19.5 26.950000000000003 35.199999999999996 18.35 3 17.599999999999998 26.875 32.6 22.925 4 22.075 32.05 23.525 22.35 5 23.7 37.6 21.4 17.299999999999997 6 19.425 35.525 24.275 20.775 7 20.225 23.674999999999997 34.775 21.325 8 18.075 24.375 31.8 25.75 9 20.325 24.55 29.225 25.900000000000002 10-14 22.67 27.435 26.090000000000003 23.805 15-19 22.23 27.034999999999997 27.544999999999998 23.189999999999998 20-24 22.505 27.21 27.339999999999996 22.945 25-29 22.175 27.800000000000004 27.150000000000002 22.875 30-34 21.81 27.47 27.055 23.665 35-39 22.7 26.68 27.425 23.195 40-44 22.5 27.37 27.16 22.97 45-49 22.455 26.325 27.939999999999998 23.28 50-54 22.78 26.634999999999998 27.735 22.85 55-59 22.509999999999998 27.634999999999998 27.07 22.785 60-64 23.075000000000003 26.995 27.805000000000003 22.125 65-69 23.3 26.6 26.68 23.419999999999998 70-74 22.81 27.58 27.04 22.57 75-79 23.169999999999998 26.855 26.784999999999997 23.189999999999998 80-84 23.080000000000002 26.745 27.685 22.49 85-89 23.599999999999998 27.04 26.889999999999997 22.470000000000002 90-94 22.895 26.779999999999998 27.155 23.169999999999998 95-99 23.0 26.845000000000002 27.310000000000002 22.845 100-104 23.41 27.439999999999998 26.865 22.285 105-109 23.405 26.815 26.32 23.46 110-114 23.535 26.875 26.88 22.71 115-119 24.099999999999998 26.650000000000002 26.6 22.650000000000002 120-124 24.05 26.875 26.740000000000002 22.335 125-129 23.674999999999997 27.125 26.525 22.675 130-134 24.65 26.655 26.13 22.564999999999998 135-139 24.165 27.16 26.14 22.535 140-144 24.515 27.150000000000002 26.119999999999997 22.215 145-149 24.38 27.24 26.025 22.355 150 24.25 26.724999999999998 27.224999999999998 21.8 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.5 20 1.0 21 1.5 22 1.5 23 2.0 24 2.5 25 3.5 26 4.5 27 3.0 28 7.0 29 9.0 30 11.5 31 18.5 32 21.5 33 31.5 34 41.5 35 56.5 36 79.0 37 95.5 38 113.0 39 134.0 40 167.5 41 197.0 42 212.5 43 224.0 44 237.5 45 254.0 46 234.0 47 229.0 48 234.0 49 203.0 50 178.5 51 167.0 52 151.5 53 119.5 54 92.5 55 81.5 56 71.0 57 55.0 58 51.5 59 44.5 60 32.5 61 30.5 62 22.0 63 13.5 64 11.5 65 12.5 66 10.0 67 5.5 68 7.0 69 5.0 70 1.0 71 1.0 72 1.0 73 1.0 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.375 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.075 #Duplication Level Percentage of deduplicated Percentage of total 1 96.12282071298465 92.35 2 3.721051262034868 7.1499999999999995 3 0.13010668748373666 0.375 4 0.0 0.0 5 0.026021337496747333 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CAGCAAGAAAAGCAAACTAGAATCTTCCTCTCTAGCTTTCAAAGGGTCTT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0125 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.0625 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.0875 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.1125 0.0 0.0 0.0 0.0 98-99 0.125 0.0 0.0 0.0 0.0 100-101 0.1375 0.0 0.0 0.0 0.0 102-103 0.1875 0.0 0.0 0.0 0.0 104-105 0.2 0.0 0.0 0.0 0.0 106-107 0.2 0.0 0.0 0.0 0.0 108-109 0.25 0.0 0.0 0.0 0.0 110-111 0.425 0.0 0.0 0.0 0.0 112-113 0.4875 0.0 0.0 0.0 0.0 114-115 0.5375000000000001 0.0 0.0 0.0 0.0 116-117 0.6375 0.0 0.0 0.0 0.0 118-119 0.7375 0.0 0.0 0.0 0.0 120-121 0.8 0.0 0.0 0.0 0.0 122-123 0.8999999999999999 0.0 0.0 0.0 0.0 124-125 1.0 0.0 0.0 0.0 0.0 126-127 1.1 0.0 0.0 0.0 0.0 128-129 1.35 0.0 0.0 0.0 0.0 130-131 1.575 0.0 0.0 0.0 0.0 132-133 1.7125 0.0 0.0 0.0 0.0 134-135 1.9125 0.0 0.0 0.0 0.0 136-137 2.1875 0.0 0.0 0.0 0.0 138 2.325 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TAATTCC 10 0.006973645 144.0 2 CCCCCCC 20 0.006139246 28.8 120-124 >>END_MODULE Read 1099286 spots for SRR14639624.sra Written 1099286 spots for SRR14639624.sra Read 1099286 spots for SRR14639624.sra Written 1099286 spots for SRR14639624.sra Read 1099286 spots for SRR14639624.sra Written 1099286 spots for SRR14639624.sra Read 1099286 spots for SRR14639624.sra Written 1099286 spots for SRR14639624.sra Read 1099286 spots for SRR14639624.sra Written 1099286 spots for SRR14639624.sra Read 1099286 spots for SRR14639624.sra Written 1099286 spots for SRR14639624.sra Read 1099286 spots for SRR14639624.sra Written 1099286 spots for SRR14639624.sra Read 1099301 spots for SRR14639624.sra Written 1099301 spots for SRR14639624.sra Read 1099286 spots for SRR14639624.sra Written 1099286 spots for SRR14639624.sra Read 1099286 spots for SRR14639624.sra Written 1099286 spots for SRR14639624.sra Read 1099286 spots for SRR14639624.sra Written 1099286 spots for SRR14639624.sra Read 1099286 spots for SRR14639624.sra Written 1099286 spots for SRR14639624.sra Read 1099286 spots for SRR14639624.sra Written 1099286 spots for SRR14639624.sra Read 1099286 spots for SRR14639624.sra Written 1099286 spots for SRR14639624.sra Read 1099286 spots for SRR14639624.sra Written 1099286 spots for SRR14639624.sra Read 1099286 spots for SRR14639624.sra Written 1099286 spots for SRR14639624.sra Read 1099286 spots for SRR14639624.sra Written 1099286 spots for SRR14639624.sra Read 1099286 spots for SRR14639624.sra Written 1099286 spots for SRR14639624.sra Read 1099286 spots for SRR14639624.sra Written 1099286 spots for SRR14639624.sra Read 1099286 spots for SRR14639624.sra Written 1099286 spots for SRR14639624.sra SRR ids: ['SRR14639624.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_qnjcf6ty SRR14639624.sra spots: 21985735 blocks: [[1, 1099286], [1099287, 2198572], [2198573, 3297858], [3297859, 4397144], [4397145, 5496430], [5496431, 6595716], [6595717, 7695002], [7695003, 8794288], [8794289, 9893574], [9893575, 10992860], [10992861, 12092146], [12092147, 13191432], [13191433, 14290718], [14290719, 15390004], [15390005, 16489290], [16489291, 17588576], [17588577, 18687862], [18687863, 19787148], [19787149, 20886434], [20886435, 21985735]] SRR14639624 file size 8137997 SRR14639624 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR14639624 SRR14639624_1.fastq SRR14639624_2.fastq Input file: SRR14639624_1.fastq Paired file: SRR14639624_2.fastq trimmed: SRR14639624-trimmed-pair1.fastq, SRR14639624-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 14:27:50 2025 >> started Mon Feb 10 14:28:18 2025 >> done (27.896s) 21985735 read pairs processed; of these: 84 ( 0.00%) short read pairs filtered out after trimming by size control 52 ( 0.00%) empty read pairs filtered out after trimming by size control 21985599 (100.00%) read pairs available; of these: 1709093 ( 7.77%) trimmed read pairs available after processing 20276506 (92.23%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 26 0.00% 19 15 0.00% 20 26 0.00% 21 43 0.00% 22 42 0.00% 23 48 0.00% 24 47 0.00% 25 40 0.00% 26 49 0.00% 27 52 0.00% 28 55 0.00% 29 71 0.00% 30 77 0.00% 31 85 0.00% 32 73 0.00% 33 73 0.00% 34 68 0.00% 35 82 0.00% 36 81 0.00% 37 75 0.00% 38 88 0.00% 39 91 0.00% 40 113 0.00% 41 116 0.00% 42 118 0.00% 43 142 0.00% 44 115 0.00% 45 107 0.00% 46 131 0.00% 47 155 0.00% 48 128 0.00% 49 101 0.00% 50 159 0.00% 51 114 0.00% 52 141 0.00% 53 141 0.00% 54 150 0.00% 55 178 0.00% 56 195 0.00% 57 204 0.00% 58 186 0.00% 59 209 0.00% 60 214 0.00% 61 255 0.00% 62 250 0.00% 63 270 0.00% 64 279 0.00% 65 275 0.00% 66 310 0.00% 67 330 0.00% 68 352 0.00% 69 373 0.00% 70 439 0.00% 71 454 0.00% 72 502 0.00% 73 540 0.00% 74 575 0.00% 75 560 0.00% 76 662 0.00% 77 698 0.00% 78 745 0.00% 79 756 0.00% 80 899 0.00% 81 957 0.00% 82 1068 0.00% 83 1141 0.01% 84 1218 0.01% 85 1304 0.01% 86 1454 0.01% 87 1564 0.01% 88 1686 0.01% 89 1729 0.01% 90 2109 0.01% 91 2215 0.01% 92 2394 0.01% 93 2668 0.01% 94 2933 0.01% 95 3322 0.02% 96 3523 0.02% 97 3796 0.02% 98 4121 0.02% 99 4389 0.02% 100 4936 0.02% 101 5326 0.02% 102 5759 0.03% 103 6180 0.03% 104 6828 0.03% 105 7356 0.03% 106 8030 0.04% 107 8576 0.04% 108 9285 0.04% 109 9908 0.05% 110 10610 0.05% 111 11532 0.05% 112 12168 0.06% 113 12914 0.06% 114 13957 0.06% 115 14950 0.07% 116 16186 0.07% 117 16966 0.08% 118 18060 0.08% 119 18620 0.08% 120 20227 0.09% 121 21445 0.10% 122 22159 0.10% 123 23605 0.11% 124 25277 0.11% 125 26321 0.12% 126 28423 0.13% 127 29385 0.13% 128 30408 0.14% 129 32405 0.15% 130 32716 0.15% 131 34606 0.16% 132 35248 0.16% 133 36466 0.17% 134 37360 0.17% 135 39286 0.18% 136 40088 0.18% 137 41188 0.19% 138 42806 0.19% 139 44672 0.20% 140 44940 0.20% 141 46434 0.21% 142 48164 0.22% 143 48996 0.22% 144 50387 0.23% 145 51351 0.23% 146 52842 0.24% 147 56574 0.26% 148 70726 0.32% 149 318902 1.45% 150 20276506 92.23% 21985599 reads passed initial QC criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=3.03 fanout-score-rank=20 prefix-density=0.25 prefix-fanout=3.0 sequence=CCACATTTGCAGCCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=19.77 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=2.2 sequence=CGCATCGCCGGCCCCCATCCACTTCCCTCCCGACAATTTCAAGCACTCTTTGACTCTCTTTTCAAAGTCCTTTTCATCTTTCCCTCGCGGTACTTGTTTGCTATCGGTCTCTCGCCCGTATTTAGCCTTGGACGGAATTTACCGCCCGATTGGGGCTGCATTCCCAAACAACCCGACTCGCAGACAGCGCCTCGTGGTGCGGCAGGGTCCAGCCACGACGGGGCTCTCACCCTCTCCGGCGCCCCTTTCCAGGGGACTTGGGCCTGGTCCGCCGCTGAGGACGCTTCTCCAGACTACAATTCGGACGCCGCAGGCGCCAGATTCTCAAGCTGGGCATTTCCCGGTTCGCTCGCCGTTACTAGGGG criterion=sequence-density sequence-density=0.34 sequence-density-rank=1 fanout-score=2.06 fanout-score-rank=24 prefix-density=0.34 prefix-fanout=2.0 sequence=ATGTACCCTGACTT criterion=fanout-score sequence-density=0.12 sequence-density-rank=22 fanout-score=17.28 fanout-score-rank=1 prefix-density=0.27 prefix-fanout=7.5 sequence=AAGGCCAAGATCCAGGACAAGGA SRR14639624 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 14:29:38 Started mapping on | Feb 10 14:29:38 Finished on | Feb 10 14:43:20 Mapping speed, Million of reads per hour | 96.29 Number of input reads | 21985599 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 14678267 Uniquely mapped reads % | 66.76% Average mapped length | 295.67 Number of splices: Total | 12361819 Number of splices: Annotated (sjdb) | 12107182 Number of splices: GT/AG | 12160924 Number of splices: GC/AG | 149464 Number of splices: AT/AC | 11267 Number of splices: Non-canonical | 40164 Mismatch rate per base, % | 0.49% Deletion rate per base | 0.03% Deletion average length | 2.94 Insertion rate per base | 0.02% Insertion average length | 2.58 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 454175 % of reads mapped to multiple loci | 2.07% Number of reads mapped to too many loci | 224089 % of reads mapped to too many loci | 1.02% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 29.47% % of reads unmapped: other | 0.68% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 6853157 6853157 6853157 N_multimapping 454175 454175 454175 N_noFeature 447279 14559687 501382 N_ambiguous 163663 883 98672 UnstrandedReadsAssigned:14067325 PositiveStrandReadsAssigned:117697 NegativeStrandReadsAssigned:14078213 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR14639624 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR14639624-trimmed-pair1.fastq SRR14639624-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,985,599 reads, 14,830,207 reads pseudoaligned [quant] estimated average fragment length: 282.732 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,143 rounds 52401 SRR14639624.ke.tsv 34699 SRR14639624.se.tsv 87100 total ==> SRR14639624.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1736.27 3171 110.368 Potri.005G024800.1.v4.1 1035 753.268 279 22.383 Potri.004G059700.1.v4.1 961 679.562 138 12.272 Potri.007G009000.2.v4.1 1416 1134.27 0 0 Potri.003G141000.2.v4.1 2943 2661.27 709 16.0998 Potri.016G087400.1.v4.1 270 78.0453 997 771.992 Potri.015G069301.1.v4.1 564 302.981 0 0 Potri.010G195200.1.v4.1 1773 1491.27 24 0.972567 Potri.012G127500.1.v4.1 977 695.418 2111 183.445 ==> SRR14639624.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 31 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 280 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 11 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 311 SRR14639624 completed mapping pipeline successfully