Starting /dee2/code/volunteer_pipeline.sh SRR14639625 current disk space = 3058986762240 free memory = 1580075544 SRR14639625 SRAfilesize d7847c0d0072bc70110f5c2a03e0a822 SRR14639625.sra SRR14639625.sra file validated SRR14639625 is paired end SRR14639625 is conventional basespace SRR14639625 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14639625_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.61875 32.0 32.0 32.0 32.0 32.0 2 31.5925 32.0 32.0 32.0 32.0 32.0 3 35.22625 37.0 32.0 37.0 32.0 37.0 4 36.24375 37.0 37.0 37.0 37.0 37.0 5 36.31125 37.0 37.0 37.0 37.0 37.0 6 39.8185 41.0 41.0 41.0 37.0 41.0 7 39.91425 41.0 41.0 41.0 37.0 41.0 8 40.10975 41.0 41.0 41.0 37.0 41.0 9 40.1965 41.0 41.0 41.0 37.0 41.0 10-14 40.1957 41.0 41.0 41.0 38.6 41.0 15-19 40.23285 41.0 41.0 41.0 40.2 41.0 20-24 40.1705 41.0 41.0 41.0 37.8 41.0 25-29 40.17645 41.0 41.0 41.0 37.8 41.0 30-34 40.11215 41.0 41.0 41.0 38.6 41.0 35-39 40.067449999999994 41.0 41.0 41.0 37.0 41.0 40-44 39.9773 41.0 41.0 41.0 37.0 41.0 45-49 39.914750000000005 41.0 41.0 41.0 37.0 41.0 50-54 39.8926 41.0 41.0 41.0 37.0 41.0 55-59 39.83025 41.0 41.0 41.0 37.0 41.0 60-64 39.718849999999996 41.0 41.0 41.0 37.0 41.0 65-69 39.6274 41.0 41.0 41.0 37.0 41.0 70-74 39.44615 41.0 41.0 41.0 37.0 41.0 75-79 39.06 41.0 40.2 41.0 36.0 41.0 80-84 39.49375 41.0 41.0 41.0 37.0 41.0 85-89 39.43845 41.0 41.0 41.0 37.0 41.0 90-94 39.41775 41.0 41.0 41.0 37.0 41.0 95-99 39.298649999999995 41.0 41.0 41.0 37.0 41.0 100-104 39.2062 41.0 41.0 41.0 37.0 41.0 105-109 39.1571 41.0 41.0 41.0 37.0 41.0 110-114 39.1142 41.0 41.0 41.0 37.0 41.0 115-119 39.03335 41.0 41.0 41.0 36.0 41.0 120-124 38.9651 41.0 41.0 41.0 35.0 41.0 125-129 38.99645 41.0 41.0 41.0 36.0 41.0 130-134 38.72805 41.0 41.0 41.0 32.0 41.0 135-139 38.45335 41.0 40.2 41.0 32.0 41.0 140-144 38.27945 41.0 39.4 41.0 32.0 41.0 145-149 37.9177 41.0 37.0 41.0 32.0 41.0 150 37.82875 41.0 37.0 41.0 32.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 1.0 18 0.0 19 0.0 20 0.0 21 1.0 22 4.0 23 2.0 24 4.0 25 8.0 26 4.0 27 12.0 28 15.0 29 19.0 30 27.0 31 43.0 32 50.0 33 55.0 34 60.0 35 81.0 36 119.0 37 160.0 38 283.0 39 538.0 40 2514.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.045522761380695 13.906953476738368 11.030515257628814 34.017008504252125 2 21.05 12.125 34.775 32.05 3 21.825 18.925 25.074999999999996 34.175 4 25.75 24.15 23.9 26.200000000000003 5 23.225 31.1 25.724999999999998 19.950000000000003 6 19.85 33.525 24.55 22.075 7 17.5 27.0 39.074999999999996 16.425 8 17.0 24.3 34.55 24.15 9 18.125 24.275 34.9 22.7 10-14 20.830000000000002 29.404999999999998 26.915 22.85 15-19 21.4 27.485 27.49 23.625 20-24 21.01 28.294999999999998 27.245 23.45 25-29 20.705000000000002 28.449999999999996 27.455000000000002 23.39 30-34 21.69 26.974999999999998 27.35 23.985 35-39 21.26 27.845 26.900000000000002 23.995 40-44 21.07 27.994999999999997 27.16 23.775 45-49 20.724999999999998 27.67 27.735 23.87 50-54 21.4 27.455000000000002 26.745 24.4 55-59 21.575 27.91 26.979999999999997 23.535 60-64 21.515 27.205000000000002 27.05 24.23 65-69 21.475 27.99 26.884999999999998 23.65 70-74 21.29 28.415000000000003 27.175 23.119999999999997 75-79 21.349999999999998 27.91 27.650000000000002 23.09 80-84 21.61 27.584999999999997 26.515 24.29 85-89 21.3 27.865000000000002 27.07 23.765 90-94 21.415 27.694999999999997 26.765 24.125 95-99 21.4 27.72 26.795 24.085 100-104 21.335 27.589999999999996 27.205000000000002 23.87 105-109 21.899379875975196 27.140428085617124 27.285457091418287 23.6747349469894 110-114 21.654999999999998 27.265 26.845000000000002 24.235 115-119 21.565 28.215 26.705000000000002 23.515 120-124 21.515 27.855 26.605 24.025 125-129 22.275 27.355 26.775 23.595 130-134 22.435 27.634999999999998 26.3 23.630000000000003 135-139 22.384999999999998 26.865 26.840000000000003 23.91 140-144 22.275568892223056 27.426856714178545 26.196549137284318 24.10102525631408 145-149 21.755 27.85 26.39 24.005000000000003 150 22.875 26.900000000000002 26.424999999999997 23.799999999999997 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.5 3 0.5 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.5 10 0.5 11 0.5 12 1.0 13 1.0 14 0.5 15 0.5 16 1.0 17 0.5 18 1.0 19 1.5 20 1.5 21 1.5 22 2.0 23 3.0 24 3.5 25 3.5 26 3.0 27 4.5 28 10.0 29 11.5 30 12.5 31 16.5 32 29.0 33 43.0 34 46.0 35 57.0 36 72.5 37 96.0 38 118.0 39 145.0 40 177.5 41 200.5 42 209.5 43 220.5 44 245.0 45 245.0 46 244.0 47 237.0 48 207.5 49 198.5 50 177.0 51 134.0 52 115.5 53 105.0 54 101.5 55 96.0 56 84.5 57 66.5 58 49.0 59 46.0 60 40.0 61 30.5 62 18.5 63 10.0 64 9.5 65 11.0 66 10.0 67 6.5 68 4.0 69 3.0 70 1.0 71 1.5 72 2.0 73 0.5 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.02 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.025 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.92500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 96.06463382851186 92.15 2 3.674745895230649 7.049999999999999 3 0.20849622100599427 0.6 4 0.05212405525149857 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0125 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.037500000000000006 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.07500000000000001 0.0 0.0 0.0 0.0 96-97 0.1375 0.0 0.0 0.0 0.0 98-99 0.175 0.0 0.0 0.0 0.0 100-101 0.175 0.0 0.0 0.0 0.0 102-103 0.175 0.0 0.0 0.0 0.0 104-105 0.21250000000000002 0.0 0.0 0.0 0.0 106-107 0.25 0.0 0.0 0.0 0.0 108-109 0.3125 0.0 0.0 0.0 0.0 110-111 0.4375 0.0 0.0 0.0 0.0 112-113 0.4625 0.0 0.0 0.0 0.0 114-115 0.5625 0.0 0.0 0.0 0.0 116-117 0.6875 0.0 0.0 0.0 0.0 118-119 0.875 0.0 0.0 0.0 0.0 120-121 1.0125 0.0 0.0 0.0 0.0 122-123 1.1124999999999998 0.0 0.0 0.0 0.0 124-125 1.3624999999999998 0.0 0.0 0.0 0.0 126-127 1.5125000000000002 0.0 0.0 0.0 0.0 128-129 1.8375 0.0 0.0 0.0 0.0 130-131 2.1125 0.0 0.0 0.0 0.0 132-133 2.2625 0.0 0.0 0.0 0.0 134-135 2.55 0.0 0.0 0.0 0.0 136-137 2.875 0.0 0.0 0.0 0.0 138 2.975 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCTGGTA 10 0.006973645 144.0 7 TCCAAAT 10 0.006973645 144.0 7 AGATTCA 10 0.006973645 144.0 6 >>END_MODULE SRR14639625 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14639625_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.94375 32.0 32.0 32.0 32.0 32.0 2 30.76 32.0 32.0 32.0 32.0 32.0 3 33.59625 37.0 32.0 37.0 27.0 37.0 4 34.9625 37.0 37.0 37.0 32.0 37.0 5 35.19375 37.0 37.0 37.0 32.0 37.0 6 38.452 41.0 41.0 41.0 32.0 41.0 7 38.21775 41.0 37.0 41.0 32.0 41.0 8 38.37925 41.0 41.0 41.0 32.0 41.0 9 38.537 41.0 41.0 41.0 32.0 41.0 10-14 38.67059999999999 41.0 41.0 41.0 33.0 41.0 15-19 38.4159 41.0 41.0 41.0 32.0 41.0 20-24 38.37875 41.0 41.0 41.0 32.0 41.0 25-29 38.11130000000001 41.0 39.4 41.0 30.0 41.0 30-34 38.08015 41.0 40.2 41.0 30.0 41.0 35-39 37.9091 41.0 37.8 41.0 28.0 41.0 40-44 37.73245 41.0 37.0 41.0 27.0 41.0 45-49 37.717150000000004 41.0 37.0 41.0 27.0 41.0 50-54 37.6071 41.0 37.0 41.0 27.0 41.0 55-59 37.61725 41.0 37.0 41.0 27.0 41.0 60-64 37.71495 41.0 37.0 41.0 27.0 41.0 65-69 37.321250000000006 41.0 37.0 41.0 27.0 41.0 70-74 37.037 41.0 37.0 41.0 26.0 41.0 75-79 36.42785 40.2 36.0 41.0 24.0 41.0 80-84 37.2812 41.0 37.0 41.0 26.0 41.0 85-89 37.3053 41.0 37.0 41.0 26.0 41.0 90-94 37.134 41.0 37.0 41.0 24.0 41.0 95-99 37.09115 41.0 37.0 41.0 22.0 41.0 100-104 36.94515 41.0 37.0 41.0 25.0 41.0 105-109 37.02015 41.0 37.0 41.0 23.0 41.0 110-114 36.80915 41.0 37.0 41.0 22.0 41.0 115-119 36.51545 41.0 37.0 41.0 22.0 41.0 120-124 36.68685 41.0 37.0 41.0 22.0 41.0 125-129 36.15995 41.0 37.0 41.0 22.0 41.0 130-134 36.09025 41.0 37.0 41.0 22.0 41.0 135-139 35.606300000000005 41.0 35.0 41.0 20.0 41.0 140-144 35.44075 41.0 32.0 41.0 20.0 41.0 145-149 35.282900000000005 41.0 36.0 41.0 18.0 41.0 150 34.74175 41.0 32.0 41.0 12.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 3.0 16 16.0 17 11.0 18 25.0 19 25.0 20 25.0 21 20.0 22 22.0 23 32.0 24 36.0 25 36.0 26 41.0 27 43.0 28 38.0 29 61.0 30 62.0 31 85.0 32 93.0 33 101.0 34 127.0 35 148.0 36 181.0 37 250.0 38 316.0 39 542.0 40 1660.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.67243541509907 24.128417356408328 10.785051417105592 27.414095811387007 2 22.325 26.724999999999998 33.050000000000004 17.9 3 21.55 26.625 31.25 20.575 4 25.85 30.65 21.349999999999998 22.15 5 25.35 37.7 20.175 16.775000000000002 6 19.975 36.15 22.025 21.85 7 19.175 21.175 38.25 21.4 8 18.3 24.3 29.775000000000002 27.625 9 19.5 24.349999999999998 30.15 26.0 10-14 22.235 28.73 26.369999999999997 22.665 15-19 22.18 26.729999999999997 27.61 23.48 20-24 22.16 27.85 27.455000000000002 22.535 25-29 22.61 27.16 27.16 23.07 30-34 22.295 27.334999999999997 27.46 22.91 35-39 22.735 27.16 27.32 22.785 40-44 22.73 26.595000000000002 27.68 22.994999999999997 45-49 22.39 26.625 27.810000000000002 23.175 50-54 22.66 26.540000000000003 28.065 22.735 55-59 22.835 26.555 27.58 23.03 60-64 23.395 26.484999999999996 27.560000000000002 22.56 65-69 22.86 26.16 28.02 22.96 70-74 23.48 27.24 26.72 22.56 75-79 22.58 27.255000000000003 27.295 22.869999999999997 80-84 22.845 27.450000000000003 27.389999999999997 22.314999999999998 85-89 23.169999999999998 27.029999999999998 26.905 22.895 90-94 23.59 27.005000000000003 27.224999999999998 22.18 95-99 22.99 27.165 27.485 22.36 100-104 23.244999999999997 27.169999999999998 27.189999999999998 22.395 105-109 23.29 27.215 27.345000000000002 22.15 110-114 23.990000000000002 27.005000000000003 26.8 22.205 115-119 24.175 27.095000000000002 26.8 21.93 120-124 24.095 26.745 27.11 22.05 125-129 23.895 26.935 26.8 22.37 130-134 24.779999999999998 26.540000000000003 27.05 21.63 135-139 24.215 26.534999999999997 27.24 22.009999999999998 140-144 24.27 26.47 26.76 22.5 145-149 24.875 27.1 25.95 22.075 150 25.624999999999996 26.450000000000003 26.224999999999998 21.7 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 1.0 12 1.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 0.5 22 1.0 23 2.5 24 2.0 25 2.0 26 3.5 27 5.5 28 7.5 29 12.0 30 20.5 31 26.0 32 25.0 33 33.0 34 46.0 35 56.0 36 68.0 37 93.5 38 115.5 39 127.0 40 161.0 41 209.5 42 225.0 43 220.0 44 218.5 45 215.0 46 243.0 47 257.0 48 219.5 49 199.5 50 197.0 51 167.5 52 124.5 53 109.0 54 103.0 55 91.0 56 84.5 57 67.5 58 52.5 59 45.0 60 36.5 61 22.5 62 15.5 63 18.0 64 15.0 65 9.0 66 7.5 67 5.0 68 2.0 69 3.0 70 2.5 71 1.5 72 1.0 73 0.0 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.325 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.275 #Duplication Level Percentage of deduplicated Percentage of total 1 96.41651519085951 92.825 2 3.323811996883926 6.4 3 0.23370553103090105 0.675 4 0.025967281225655673 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.0875 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1125 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.15 0.0 0.0 0.0 0.0 100-101 0.15 0.0 0.0 0.0 0.0 102-103 0.16249999999999998 0.0 0.0 0.0 0.0 104-105 0.21250000000000002 0.0 0.0 0.0 0.0 106-107 0.25 0.0 0.0 0.0 0.0 108-109 0.3375 0.0 0.0 0.0 0.0 110-111 0.4625 0.0 0.0 0.0 0.0 112-113 0.4875 0.0 0.0 0.0 0.0 114-115 0.5625 0.0 0.0 0.0 0.0 116-117 0.6875 0.0 0.0 0.0 0.0 118-119 0.875 0.0 0.0 0.0 0.0 120-121 1.0 0.0 0.0 0.0 0.0 122-123 1.1124999999999998 0.0 0.0 0.0 0.0 124-125 1.3375 0.0 0.0 0.0 0.0 126-127 1.475 0.0 0.0 0.0 0.0 128-129 1.7875 0.0 0.0 0.0 0.0 130-131 2.0875 0.0 0.0 0.0 0.0 132-133 2.25 0.0 0.0 0.0 0.0 134-135 2.5 0.0 0.0 0.0 0.0 136-137 2.75 0.0 0.0 0.0 0.0 138 2.85 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAACAGT 10 0.006973645 144.0 2 TATCCTC 10 0.006973645 144.0 8 >>END_MODULE Read 1081986 spots for SRR14639625.sra Written 1081986 spots for SRR14639625.sra Read 1081986 spots for SRR14639625.sra Written 1081986 spots for SRR14639625.sra Read 1081986 spots for SRR14639625.sra Written 1081986 spots for SRR14639625.sra Read 1081986 spots for SRR14639625.sra Written 1081986 spots for SRR14639625.sra Read 1081986 spots for SRR14639625.sra Written 1081986 spots for SRR14639625.sra Read 1081986 spots for SRR14639625.sra Written 1081986 spots for SRR14639625.sra Read 1081986 spots for SRR14639625.sra Written 1081986 spots for SRR14639625.sra Read 1081986 spots for SRR14639625.sra Written 1081986 spots for SRR14639625.sra Read 1081986 spots for SRR14639625.sra Written 1081986 spots for SRR14639625.sra Read 1081986 spots for SRR14639625.sra Written 1081986 spots for SRR14639625.sra Read 1081986 spots for SRR14639625.sra Written 1081986 spots for SRR14639625.sra Read 1081986 spots for SRR14639625.sra Written 1081986 spots for SRR14639625.sra Read 1081986 spots for SRR14639625.sra Written 1081986 spots for SRR14639625.sra Read 1081986 spots for SRR14639625.sra Written 1081986 spots for SRR14639625.sra Read 1081986 spots for SRR14639625.sra Written 1081986 spots for SRR14639625.sra Read 1081986 spots for SRR14639625.sra Written 1081986 spots for SRR14639625.sra Read 1081986 spots for SRR14639625.sra Written 1081986 spots for SRR14639625.sra Read 1081986 spots for SRR14639625.sra Written 1081986 spots for SRR14639625.sra Read 1081986 spots for SRR14639625.sra Written 1081986 spots for SRR14639625.sra Read 1081986 spots for SRR14639625.sra Written 1081986 spots for SRR14639625.sra SRR ids: ['SRR14639625.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_lirfckvt SRR14639625.sra spots: 21639720 blocks: [[1, 1081986], [1081987, 2163972], [2163973, 3245958], [3245959, 4327944], [4327945, 5409930], [5409931, 6491916], [6491917, 7573902], [7573903, 8655888], [8655889, 9737874], [9737875, 10819860], [10819861, 11901846], [11901847, 12983832], [12983833, 14065818], [14065819, 15147804], [15147805, 16229790], [16229791, 17311776], [17311777, 18393762], [18393763, 19475748], [19475749, 20557734], [20557735, 21639720]] SRR14639625 file size 8009702 SRR14639625 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR14639625 SRR14639625_1.fastq SRR14639625_2.fastq Input file: SRR14639625_1.fastq Paired file: SRR14639625_2.fastq trimmed: SRR14639625-trimmed-pair1.fastq, SRR14639625-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 15:44:12 2025 >> started Mon Feb 10 15:44:36 2025 >> done (23.424s) 21639720 read pairs processed; of these: 94 ( 0.00%) short read pairs filtered out after trimming by size control 263 ( 0.00%) empty read pairs filtered out after trimming by size control 21639363 (100.00%) read pairs available; of these: 1619576 ( 7.48%) trimmed read pairs available after processing 20019787 (92.52%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 12 0.00% 19 26 0.00% 20 21 0.00% 21 21 0.00% 22 27 0.00% 23 45 0.00% 24 36 0.00% 25 28 0.00% 26 38 0.00% 27 43 0.00% 28 43 0.00% 29 40 0.00% 30 61 0.00% 31 39 0.00% 32 60 0.00% 33 42 0.00% 34 67 0.00% 35 62 0.00% 36 65 0.00% 37 72 0.00% 38 89 0.00% 39 63 0.00% 40 72 0.00% 41 80 0.00% 42 89 0.00% 43 80 0.00% 44 92 0.00% 45 88 0.00% 46 85 0.00% 47 72 0.00% 48 76 0.00% 49 97 0.00% 50 102 0.00% 51 94 0.00% 52 103 0.00% 53 89 0.00% 54 104 0.00% 55 120 0.00% 56 122 0.00% 57 118 0.00% 58 132 0.00% 59 132 0.00% 60 147 0.00% 61 154 0.00% 62 165 0.00% 63 184 0.00% 64 200 0.00% 65 224 0.00% 66 238 0.00% 67 261 0.00% 68 265 0.00% 69 281 0.00% 70 317 0.00% 71 354 0.00% 72 392 0.00% 73 464 0.00% 74 455 0.00% 75 554 0.00% 76 589 0.00% 77 627 0.00% 78 785 0.00% 79 809 0.00% 80 918 0.00% 81 1058 0.00% 82 1130 0.01% 83 1308 0.01% 84 1380 0.01% 85 1598 0.01% 86 1714 0.01% 87 1953 0.01% 88 2121 0.01% 89 2241 0.01% 90 2554 0.01% 91 2770 0.01% 92 3224 0.01% 93 3329 0.02% 94 3731 0.02% 95 4075 0.02% 96 4468 0.02% 97 5010 0.02% 98 5149 0.02% 99 5720 0.03% 100 5994 0.03% 101 6393 0.03% 102 7006 0.03% 103 7635 0.04% 104 8149 0.04% 105 8927 0.04% 106 9423 0.04% 107 10019 0.05% 108 10792 0.05% 109 11450 0.05% 110 12061 0.06% 111 13079 0.06% 112 13717 0.06% 113 14127 0.07% 114 15196 0.07% 115 16228 0.07% 116 16679 0.08% 117 17832 0.08% 118 18824 0.09% 119 19630 0.09% 120 20232 0.09% 121 21147 0.10% 122 22008 0.10% 123 23094 0.11% 124 24629 0.11% 125 25225 0.12% 126 26482 0.12% 127 27623 0.13% 128 28311 0.13% 129 29783 0.14% 130 30537 0.14% 131 31425 0.15% 132 31474 0.15% 133 31950 0.15% 134 32597 0.15% 135 34415 0.16% 136 35001 0.16% 137 35788 0.17% 138 37146 0.17% 139 37891 0.18% 140 38524 0.18% 141 39646 0.18% 142 40792 0.19% 143 41699 0.19% 144 41614 0.19% 145 43087 0.20% 146 44415 0.21% 147 47328 0.22% 148 62187 0.29% 149 324502 1.50% 150 20019787 92.52% 21639363 reads passed initial QC criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=2.94 fanout-score-rank=22 prefix-density=0.22 prefix-fanout=2.8 sequence=CCACATTTGCAGCCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=25.82 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=4.1 sequence=GAACAAAATTCGAATTCCAACGATCACATCAACTCTCGAAAGTACTAAAAGTCCGCGACATGTCTGCCCGCTGGTGAGTTATCTACTGACCTACAACCAAAATCTTGACCTCTTCGAGGCTCTTGAACACACCCTGCACATTGACCTTATTCGCACTGACATCCACCCTCAAGAACCTCCCTGGGTTAGCAGC criterion=sequence-density sequence-density=0.28 sequence-density-rank=1 fanout-score=3.83 fanout-score-rank=10 prefix-density=0.35 prefix-fanout=3.0 sequence=TGCAAGTGCGGCAGTG criterion=fanout-score sequence-density=0.09 sequence-density-rank=27 fanout-score=39.05 fanout-score-rank=1 prefix-density=0.31 prefix-fanout=11.7 sequence=AAGAAGGAGGCACCCAAACT SRR14639625 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 15:45:56 Started mapping on | Feb 10 15:45:56 Finished on | Feb 10 15:58:21 Mapping speed, Million of reads per hour | 104.57 Number of input reads | 21639363 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 14118889 Uniquely mapped reads % | 65.25% Average mapped length | 295.41 Number of splices: Total | 11778036 Number of splices: Annotated (sjdb) | 11521965 Number of splices: GT/AG | 11579394 Number of splices: GC/AG | 147677 Number of splices: AT/AC | 10673 Number of splices: Non-canonical | 40292 Mismatch rate per base, % | 0.49% Deletion rate per base | 0.03% Deletion average length | 2.96 Insertion rate per base | 0.02% Insertion average length | 2.59 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 418595 % of reads mapped to multiple loci | 1.93% Number of reads mapped to too many loci | 47291 % of reads mapped to too many loci | 0.22% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 32.26% % of reads unmapped: other | 0.34% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 7101879 7101879 7101879 N_multimapping 418595 418595 418595 N_noFeature 485944 14004196 538965 N_ambiguous 162094 831 99980 UnstrandedReadsAssigned:13470851 PositiveStrandReadsAssigned:113862 NegativeStrandReadsAssigned:13479944 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR14639625 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR14639625-trimmed-pair1.fastq SRR14639625-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,639,363 reads, 14,509,978 reads pseudoaligned [quant] estimated average fragment length: 289.904 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,091 rounds 52401 SRR14639625.ke.tsv 34699 SRR14639625.se.tsv 87100 total ==> SRR14639625.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1729.1 2806.67 107.998 Potri.005G024800.1.v4.1 1035 746.096 326 29.0714 Potri.004G059700.1.v4.1 961 672.383 141 13.9523 Potri.007G009000.2.v4.1 1416 1127.1 0 0 Potri.003G141000.2.v4.1 2943 2654.1 801.444 20.0909 Potri.016G087400.1.v4.1 270 77.9163 780 666.054 Potri.015G069301.1.v4.1 564 296.225 0 0 Potri.010G195200.1.v4.1 1773 1484.1 31 1.38977 Potri.012G127500.1.v4.1 977 688.275 1959 189.372 ==> SRR14639625.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 75 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 197 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 10 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 275 SRR14639625 completed mapping pipeline successfully