Starting /dee2/code/volunteer_pipeline.sh SRR14639626 current disk space = 3058988515328 free memory = 1580090712 SRR14639626 SRAfilesize 7b21e1f47c0c7a97c7a6b6268b7424e8 SRR14639626.sra SRR14639626.sra file validated SRR14639626 is paired end SRR14639626 is conventional basespace SRR14639626 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14639626_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.69875 32.0 32.0 32.0 32.0 32.0 2 31.46375 32.0 32.0 32.0 32.0 32.0 3 35.25875 37.0 32.0 37.0 32.0 37.0 4 36.10625 37.0 37.0 37.0 32.0 37.0 5 36.19625 37.0 37.0 37.0 37.0 37.0 6 39.828 41.0 41.0 41.0 37.0 41.0 7 39.78975 41.0 41.0 41.0 37.0 41.0 8 40.05475 41.0 41.0 41.0 37.0 41.0 9 40.2095 41.0 41.0 41.0 37.0 41.0 10-14 40.21040000000001 41.0 41.0 41.0 37.8 41.0 15-19 40.17115 41.0 41.0 41.0 37.0 41.0 20-24 40.165749999999996 41.0 41.0 41.0 37.0 41.0 25-29 40.075900000000004 41.0 41.0 41.0 37.0 41.0 30-34 40.021300000000004 41.0 41.0 41.0 37.0 41.0 35-39 40.0135 41.0 41.0 41.0 37.0 41.0 40-44 39.8866 41.0 41.0 41.0 37.0 41.0 45-49 39.897499999999994 41.0 41.0 41.0 37.0 41.0 50-54 39.74485 41.0 41.0 41.0 37.0 41.0 55-59 39.709450000000004 41.0 41.0 41.0 37.0 41.0 60-64 39.63055 41.0 41.0 41.0 37.0 41.0 65-69 39.43485 41.0 41.0 41.0 37.0 41.0 70-74 39.29645 41.0 41.0 41.0 37.0 41.0 75-79 38.595600000000005 41.0 39.4 41.0 35.0 41.0 80-84 39.186150000000005 41.0 41.0 41.0 37.0 41.0 85-89 39.04644999999999 41.0 41.0 41.0 37.0 41.0 90-94 38.9835 41.0 41.0 41.0 36.0 41.0 95-99 38.89805 41.0 41.0 41.0 34.0 41.0 100-104 38.71155 41.0 41.0 41.0 32.0 41.0 105-109 38.5526 41.0 41.0 41.0 32.0 41.0 110-114 38.56675 41.0 41.0 41.0 32.0 41.0 115-119 38.53005 41.0 41.0 41.0 32.0 41.0 120-124 38.28855 41.0 39.4 41.0 32.0 41.0 125-129 38.12585 41.0 37.0 41.0 32.0 41.0 130-134 37.6557 41.0 37.0 41.0 29.0 41.0 135-139 37.3652 41.0 37.0 41.0 27.0 41.0 140-144 37.0315 41.0 37.0 41.0 27.0 41.0 145-149 36.7288 41.0 37.0 41.0 26.0 41.0 150 36.64075 41.0 37.0 41.0 22.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 6.0 23 4.0 24 4.0 25 10.0 26 17.0 27 21.0 28 23.0 29 30.0 30 36.0 31 39.0 32 53.0 33 78.0 34 80.0 35 98.0 36 144.0 37 196.0 38 347.0 39 661.0 40 2153.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.94971228421316 14.786089567175381 15.161371028271203 37.10282712034025 2 16.05 11.75 37.875 34.325 3 17.25 18.0 28.799999999999997 35.949999999999996 4 23.625 23.474999999999998 25.324999999999996 27.575 5 23.025000000000002 32.9 26.924999999999997 17.150000000000002 6 17.375 31.900000000000002 28.225 22.5 7 17.65 27.375 38.125 16.85 8 15.85 24.3 36.3 23.549999999999997 9 17.2 27.525 34.125 21.15 10-14 19.905 28.384999999999998 28.22 23.49 15-19 19.939999999999998 27.439999999999998 28.134999999999998 24.485 20-24 19.96 28.025 27.79 24.224999999999998 25-29 20.43 27.284999999999997 27.865000000000002 24.42 30-34 20.345 27.905 27.744999999999997 24.005000000000003 35-39 20.544999999999998 27.29 27.77 24.395 40-44 20.355 28.435 27.91 23.3 45-49 20.79 28.005000000000003 27.169999999999998 24.035 50-54 19.939999999999998 27.68 27.13 25.25 55-59 20.375 27.400000000000002 27.894999999999996 24.33 60-64 21.05 27.93 26.895000000000003 24.125 65-69 20.305 28.110000000000003 27.384999999999998 24.2 70-74 21.205 28.095 27.42 23.28 75-79 20.155 27.735 27.189999999999998 24.92 80-84 20.674999999999997 27.35 27.150000000000002 24.825 85-89 21.135 27.775 27.224999999999998 23.865 90-94 20.849999999999998 27.165 27.77 24.215 95-99 21.154999999999998 27.235 27.534999999999997 24.075 100-104 20.815 27.48 27.77 23.935000000000002 105-109 21.152115211521153 27.222722272227223 27.177717771777175 24.44744474447445 110-114 21.12 27.375 27.615000000000002 23.89 115-119 21.065 27.250000000000004 27.560000000000002 24.125 120-124 21.25 27.11 27.1 24.54 125-129 21.415 27.675 27.224999999999998 23.685000000000002 130-134 21.154999999999998 27.189999999999998 27.505000000000003 24.15 135-139 21.255 27.54 27.334999999999997 23.87 140-144 21.388208231234685 26.8440266039906 27.619142871430714 24.148622293344 145-149 21.295 27.650000000000002 27.675 23.380000000000003 150 20.1 26.950000000000003 27.875 25.074999999999996 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 4.0 1 2.0 2 0.5 3 0.5 4 1.0 5 1.5 6 0.5 7 0.5 8 1.0 9 2.0 10 2.0 11 1.0 12 0.5 13 0.5 14 0.5 15 0.5 16 0.5 17 1.0 18 1.5 19 1.0 20 1.0 21 1.5 22 1.0 23 2.5 24 4.0 25 3.5 26 5.5 27 9.0 28 12.5 29 18.0 30 18.5 31 20.0 32 29.0 33 37.5 34 43.5 35 67.5 36 89.0 37 103.0 38 128.5 39 155.0 40 181.5 41 205.5 42 233.5 43 235.0 44 226.0 45 233.5 46 230.5 47 213.0 48 202.0 49 191.0 50 162.0 51 142.0 52 138.5 53 113.5 54 93.0 55 81.0 56 66.5 57 58.0 58 49.0 59 42.0 60 29.5 61 19.5 62 18.0 63 17.5 64 13.0 65 9.0 66 6.0 67 6.0 68 5.5 69 3.5 70 2.0 71 1.5 72 1.0 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.01 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.015 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.5 #Duplication Level Percentage of deduplicated Percentage of total 1 95.15873015873015 89.925 2 4.550264550264551 8.6 3 0.1851851851851852 0.525 4 0.052910052910052914 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.026455026455026457 0.2 9 0.0 0.0 >10 0.026455026455026457 0.5499999999999999 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ATCGGAAGAGCACACGTCTGAACTCCAGTCACAGCGATAGATCTCGTATG 22 0.5499999999999999 TruSeq Adapter, Index 1 (97% over 35bp) TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 8 0.2 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1125 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.175 0.0 0.0 0.0 0.0 100-101 0.2 0.0 0.0 0.0 0.0 102-103 0.21250000000000002 0.0 0.0 0.0 0.0 104-105 0.2375 0.0 0.0 0.0 0.0 106-107 0.25 0.0 0.0 0.0 0.0 108-109 0.275 0.0 0.0 0.0 0.0 110-111 0.3 0.0 0.0 0.0 0.0 112-113 0.3125 0.0 0.0 0.0 0.0 114-115 0.35 0.0 0.0 0.0 0.0 116-117 0.375 0.0 0.0 0.0 0.0 118-119 0.4 0.0 0.0 0.0 0.0 120-121 0.425 0.0 0.0 0.0 0.0 122-123 0.4625 0.0 0.0 0.0 0.0 124-125 0.475 0.0 0.0 0.0 0.0 126-127 0.5125 0.0 0.0 0.0 0.0 128-129 0.525 0.0 0.0 0.0 0.0 130-131 0.55 0.0 0.0 0.0 0.0 132-133 0.55 0.0 0.0 0.0 0.0 134-135 0.575 0.0 0.0 0.0 0.0 136-137 0.6 0.0 0.0 0.0 0.0 138 0.6 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR14639626 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14639626_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.465 32.0 32.0 32.0 27.0 32.0 2 30.61875 32.0 32.0 32.0 32.0 32.0 3 33.63 37.0 32.0 37.0 32.0 37.0 4 34.54625 37.0 37.0 37.0 32.0 37.0 5 34.68625 37.0 37.0 37.0 32.0 37.0 6 37.99925 41.0 37.0 41.0 32.0 41.0 7 37.73425 41.0 37.0 41.0 32.0 41.0 8 37.93525 41.0 37.0 41.0 27.0 41.0 9 37.981 41.0 37.0 41.0 27.0 41.0 10-14 38.007850000000005 41.0 41.0 41.0 29.0 41.0 15-19 37.82645 41.0 38.6 41.0 27.0 41.0 20-24 37.59285 41.0 37.0 41.0 27.0 41.0 25-29 37.181050000000006 41.0 37.0 41.0 26.0 41.0 30-34 37.099849999999996 41.0 37.0 41.0 27.0 41.0 35-39 36.988099999999996 41.0 37.0 41.0 25.0 41.0 40-44 36.93535000000001 41.0 37.0 41.0 26.0 41.0 45-49 36.7124 41.0 37.0 41.0 23.0 41.0 50-54 36.65665 41.0 37.0 41.0 24.0 41.0 55-59 36.54625 41.0 37.0 41.0 22.0 41.0 60-64 36.5315 41.0 37.0 41.0 22.0 41.0 65-69 36.3351 41.0 37.0 41.0 22.0 41.0 70-74 36.079 41.0 36.0 41.0 22.0 41.0 75-79 35.21645 40.2 34.0 41.0 22.0 41.0 80-84 36.01055 41.0 37.0 41.0 22.0 41.0 85-89 36.0741 41.0 37.0 41.0 22.0 41.0 90-94 35.766000000000005 41.0 35.0 41.0 22.0 41.0 95-99 35.82615 41.0 36.0 41.0 22.0 41.0 100-104 35.51615 41.0 34.0 41.0 18.0 41.0 105-109 35.5844 41.0 32.0 41.0 22.0 41.0 110-114 35.498099999999994 41.0 32.0 41.0 22.0 41.0 115-119 35.142250000000004 41.0 32.0 41.0 16.0 41.0 120-124 35.2078 41.0 32.0 41.0 20.0 41.0 125-129 34.69455 41.0 32.0 41.0 16.0 41.0 130-134 34.688 41.0 32.0 41.0 16.0 41.0 135-139 34.3353 39.4 31.0 41.0 12.0 41.0 140-144 33.92255 37.0 31.0 41.0 12.0 41.0 145-149 33.72835 37.8 31.0 41.0 12.0 41.0 150 33.49725 37.0 27.0 41.0 12.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 5.0 15 8.0 16 17.0 17 22.0 18 27.0 19 46.0 20 38.0 21 36.0 22 41.0 23 30.0 24 47.0 25 47.0 26 53.0 27 59.0 28 94.0 29 81.0 30 93.0 31 95.0 32 109.0 33 138.0 34 142.0 35 147.0 36 181.0 37 237.0 38 363.0 39 551.0 40 1293.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 33.04914744232698 28.635907723169506 11.9358074222668 26.37913741223671 2 18.675 25.7 37.275000000000006 18.35 3 16.825000000000003 27.125 33.75 22.3 4 21.475 31.8 25.05 21.675 5 22.425 38.425 21.95 17.2 6 17.549999999999997 37.025000000000006 24.525 20.9 7 19.7 23.400000000000002 35.625 21.275 8 18.125 24.425 30.925000000000004 26.525 9 19.525000000000002 26.924999999999997 28.349999999999998 25.2 10-14 22.400000000000002 28.050000000000004 25.935000000000002 23.615 15-19 22.365 27.534999999999997 27.27 22.830000000000002 20-24 22.07 27.87 26.884999999999998 23.175 25-29 22.03 28.310000000000002 26.915 22.745 30-34 22.31 27.125 27.625 22.939999999999998 35-39 21.759999999999998 27.185 27.85 23.205000000000002 40-44 22.465 26.82 27.99 22.725 45-49 22.285 26.775 28.084999999999997 22.855 50-54 22.285 26.66 28.165000000000003 22.89 55-59 22.02 27.66 27.27 23.05 60-64 22.905 26.61 27.685 22.8 65-69 22.89 27.665 27.12 22.325 70-74 23.365 27.62 26.255 22.759999999999998 75-79 22.32 27.750000000000004 26.97 22.96 80-84 23.095 27.894999999999996 26.72 22.29 85-89 23.335 28.444999999999997 26.369999999999997 21.85 90-94 23.11 28.075 26.1 22.715 95-99 23.630000000000003 27.655 27.02 21.695 100-104 23.095 27.975 26.179999999999996 22.75 105-109 22.96 27.6 26.674999999999997 22.765 110-114 23.575 27.74 26.669999999999998 22.015 115-119 23.28116405820291 27.74638731936597 26.256312815640783 22.716135806790337 120-124 23.64 27.495000000000005 26.174999999999997 22.689999999999998 125-129 23.31 27.815 26.02 22.855 130-134 23.66 27.544999999999998 26.279999999999998 22.515 135-139 24.12 27.284999999999997 25.615 22.98 140-144 23.895 27.16 26.365 22.58 145-149 23.305 27.83 26.66 22.205 150 23.200000000000003 27.450000000000003 27.224999999999998 22.125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.5 19 2.0 20 1.0 21 1.5 22 3.5 23 2.5 24 2.5 25 4.0 26 5.0 27 7.5 28 8.0 29 8.5 30 13.0 31 18.5 32 28.5 33 41.5 34 46.0 35 60.5 36 92.5 37 111.0 38 126.0 39 148.0 40 173.5 41 214.0 42 228.5 43 218.0 44 223.5 45 243.0 46 245.0 47 222.0 48 202.5 49 201.0 50 190.0 51 156.0 52 124.5 53 109.5 54 97.5 55 79.5 56 63.0 57 51.0 58 46.0 59 38.5 60 29.5 61 24.5 62 17.5 63 10.0 64 11.5 65 12.5 66 9.5 67 9.0 68 7.0 69 4.0 70 1.5 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.5 83 0.5 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.3 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.005 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.625 #Duplication Level Percentage of deduplicated Percentage of total 1 96.2875816993464 92.07499999999999 2 3.4248366013071894 6.550000000000001 3 0.1830065359477124 0.525 4 0.0784313725490196 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.026143790849673207 0.5499999999999999 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGGCTATAGTGTAGATCTC 22 0.5499999999999999 Illumina Single End PCR Primer 1 (96% over 33bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.07500000000000001 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.16249999999999998 0.0 0.0 0.0 0.0 96-97 0.2 0.0 0.0 0.0 0.0 98-99 0.2 0.0 0.0 0.0 0.0 100-101 0.225 0.0 0.0 0.0 0.0 102-103 0.225 0.0 0.0 0.0 0.0 104-105 0.225 0.0 0.0 0.0 0.0 106-107 0.225 0.0 0.0 0.0 0.0 108-109 0.225 0.0 0.0 0.0 0.0 110-111 0.25 0.0 0.0 0.0 0.0 112-113 0.2875 0.0 0.0 0.0 0.0 114-115 0.325 0.0 0.0 0.0 0.0 116-117 0.35 0.0 0.0 0.0 0.0 118-119 0.3625 0.0 0.0 0.0 0.0 120-121 0.4 0.0 0.0 0.0 0.0 122-123 0.4625 0.0 0.0 0.0 0.0 124-125 0.475 0.0 0.0 0.0 0.0 126-127 0.5125 0.0 0.0 0.0 0.0 128-129 0.525 0.0 0.0 0.0 0.0 130-131 0.5375000000000001 0.0 0.0 0.0 0.0 132-133 0.5874999999999999 0.0 0.0 0.0 0.0 134-135 0.625 0.0 0.0 0.0 0.0 136-137 0.65 0.0 0.0 0.0 0.0 138 0.65 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTTTTT 80 0.0021206664 12.599999 55-59 >>END_MODULE Read 961763 spots for SRR14639626.sra Written 961763 spots for SRR14639626.sra Read 961781 spots for SRR14639626.sra Written 961781 spots for SRR14639626.sra Read 961763 spots for SRR14639626.sra Written 961763 spots for SRR14639626.sra Read 961763 spots for SRR14639626.sra Written 961763 spots for SRR14639626.sra Read 961763 spots for SRR14639626.sra Written 961763 spots for SRR14639626.sra Read 961763 spots for SRR14639626.sra Written 961763 spots for SRR14639626.sra Read 961763 spots for SRR14639626.sra Written 961763 spots for SRR14639626.sra Read 961763 spots for SRR14639626.sra Written 961763 spots for SRR14639626.sra Read 961763 spots for SRR14639626.sra Written 961763 spots for SRR14639626.sra Read 961763 spots for SRR14639626.sra Written 961763 spots for SRR14639626.sra Read 961763 spots for SRR14639626.sra Written 961763 spots for SRR14639626.sra Read 961763 spots for SRR14639626.sra Written 961763 spots for SRR14639626.sra Read 961763 spots for SRR14639626.sra Written 961763 spots for SRR14639626.sra Read 961763 spots for SRR14639626.sra Written 961763 spots for SRR14639626.sra Read 961763 spots for SRR14639626.sra Written 961763 spots for SRR14639626.sra Read 961763 spots for SRR14639626.sra Written 961763 spots for SRR14639626.sra Read 961763 spots for SRR14639626.sra Written 961763 spots for SRR14639626.sra Read 961763 spots for SRR14639626.sra Written 961763 spots for SRR14639626.sra Read 961763 spots for SRR14639626.sra Written 961763 spots for SRR14639626.sra Read 961763 spots for SRR14639626.sra Written 961763 spots for SRR14639626.sra SRR ids: ['SRR14639626.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_xe4zw6zv SRR14639626.sra spots: 19235278 blocks: [[1, 961763], [961764, 1923526], [1923527, 2885289], [2885290, 3847052], [3847053, 4808815], [4808816, 5770578], [5770579, 6732341], [6732342, 7694104], [7694105, 8655867], [8655868, 9617630], [9617631, 10579393], [10579394, 11541156], [11541157, 12502919], [12502920, 13464682], [13464683, 14426445], [14426446, 15388208], [15388209, 16349971], [16349972, 17311734], [17311735, 18273497], [18273498, 19235278]] SRR14639626 file size 7118517 SRR14639626 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR14639626 SRR14639626_1.fastq SRR14639626_2.fastq Input file: SRR14639626_1.fastq Paired file: SRR14639626_2.fastq trimmed: SRR14639626-trimmed-pair1.fastq, SRR14639626-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 15:37:56 2025 >> started Mon Feb 10 15:38:23 2025 >> done (26.786s) 19235278 read pairs processed; of these: 161 ( 0.00%) short read pairs filtered out after trimming by size control 2402 ( 0.01%) empty read pairs filtered out after trimming by size control 19232715 (99.99%) read pairs available; of these: 656007 ( 3.41%) trimmed read pairs available after processing 18576708 (96.59%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 35 0.00% 19 38 0.00% 20 43 0.00% 21 53 0.00% 22 45 0.00% 23 58 0.00% 24 74 0.00% 25 62 0.00% 26 89 0.00% 27 94 0.00% 28 88 0.00% 29 75 0.00% 30 94 0.00% 31 96 0.00% 32 97 0.00% 33 130 0.00% 34 127 0.00% 35 139 0.00% 36 121 0.00% 37 135 0.00% 38 171 0.00% 39 158 0.00% 40 161 0.00% 41 172 0.00% 42 167 0.00% 43 184 0.00% 44 199 0.00% 45 229 0.00% 46 222 0.00% 47 239 0.00% 48 255 0.00% 49 266 0.00% 50 312 0.00% 51 306 0.00% 52 311 0.00% 53 356 0.00% 54 366 0.00% 55 365 0.00% 56 384 0.00% 57 411 0.00% 58 404 0.00% 59 449 0.00% 60 529 0.00% 61 478 0.00% 62 565 0.00% 63 532 0.00% 64 606 0.00% 65 635 0.00% 66 653 0.00% 67 698 0.00% 68 714 0.00% 69 763 0.00% 70 846 0.00% 71 847 0.00% 72 906 0.00% 73 985 0.01% 74 938 0.00% 75 993 0.01% 76 1001 0.01% 77 1129 0.01% 78 1108 0.01% 79 1089 0.01% 80 1172 0.01% 81 1282 0.01% 82 1394 0.01% 83 1373 0.01% 84 1485 0.01% 85 1459 0.01% 86 1605 0.01% 87 1569 0.01% 88 1597 0.01% 89 1731 0.01% 90 1741 0.01% 91 1827 0.01% 92 1875 0.01% 93 2017 0.01% 94 2134 0.01% 95 2172 0.01% 96 2210 0.01% 97 2264 0.01% 98 2265 0.01% 99 2512 0.01% 100 2364 0.01% 101 2493 0.01% 102 2572 0.01% 103 2686 0.01% 104 2768 0.01% 105 2899 0.02% 106 2844 0.01% 107 2904 0.02% 108 3070 0.02% 109 3159 0.02% 110 3237 0.02% 111 3367 0.02% 112 3392 0.02% 113 3456 0.02% 114 3642 0.02% 115 3605 0.02% 116 3916 0.02% 117 3996 0.02% 118 3937 0.02% 119 4025 0.02% 120 4208 0.02% 121 4316 0.02% 122 4308 0.02% 123 4606 0.02% 124 4610 0.02% 125 4727 0.02% 126 4898 0.03% 127 4986 0.03% 128 5131 0.03% 129 5185 0.03% 130 5171 0.03% 131 5231 0.03% 132 4853 0.03% 133 5058 0.03% 134 5101 0.03% 135 5279 0.03% 136 5353 0.03% 137 5450 0.03% 138 5535 0.03% 139 5764 0.03% 140 5592 0.03% 141 5994 0.03% 142 5998 0.03% 143 6070 0.03% 144 6134 0.03% 145 6461 0.03% 146 7135 0.04% 147 10555 0.05% 148 29785 0.15% 149 348702 1.81% 150 18576708 96.59% 19232715 reads passed initial QC criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=3.01 fanout-score-rank=19 prefix-density=0.29 prefix-fanout=2.7 sequence=GTTTTCTCATTTGCA criterion=fanout-score sequence-density=0.08 sequence-density-rank=19 fanout-score=22.07 fanout-score-rank=1 prefix-density=0.22 prefix-fanout=8.1 sequence=ATCAACCTCTGCTGGTCTGG criterion=sequence-density sequence-density=0.34 sequence-density-rank=1 fanout-score=4.06 fanout-score-rank=13 prefix-density=0.45 prefix-fanout=3.1 sequence=CTGCAAATGTGG criterion=fanout-score sequence-density=0.10 sequence-density-rank=22 fanout-score=28.04 fanout-score-rank=1 prefix-density=0.32 prefix-fanout=8.6 sequence=TGATTTTGATCT SRR14639626 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 15:39:36 Started mapping on | Feb 10 15:39:36 Finished on | Feb 10 15:50:43 Mapping speed, Million of reads per hour | 103.80 Number of input reads | 19232715 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 13191442 Uniquely mapped reads % | 68.59% Average mapped length | 296.49 Number of splices: Total | 11085748 Number of splices: Annotated (sjdb) | 10863543 Number of splices: GT/AG | 10905161 Number of splices: GC/AG | 134131 Number of splices: AT/AC | 10579 Number of splices: Non-canonical | 35877 Mismatch rate per base, % | 0.58% Deletion rate per base | 0.03% Deletion average length | 2.94 Insertion rate per base | 0.02% Insertion average length | 2.60 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 418825 % of reads mapped to multiple loci | 2.18% Number of reads mapped to too many loci | 40273 % of reads mapped to too many loci | 0.21% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 28.77% % of reads unmapped: other | 0.26% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 5622448 5622448 5622448 N_multimapping 418825 418825 418825 N_noFeature 348267 13083305 390384 N_ambiguous 162113 786 95685 UnstrandedReadsAssigned:12681062 PositiveStrandReadsAssigned:107351 NegativeStrandReadsAssigned:12705373 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR14639626 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR14639626-trimmed-pair1.fastq SRR14639626-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,232,715 reads, 13,417,205 reads pseudoaligned [quant] estimated average fragment length: 357.447 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,130 rounds 52401 SRR14639626.ke.tsv 34699 SRR14639626.se.tsv 87100 total ==> SRR14639626.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1661.55 3014 113.575 Potri.005G024800.1.v4.1 1035 678.553 455 41.9837 Potri.004G059700.1.v4.1 961 605.065 164 16.9705 Potri.007G009000.2.v4.1 1416 1059.55 0 0 Potri.003G141000.2.v4.1 2943 2586.55 699.228 16.9259 Potri.016G087400.1.v4.1 270 55.7511 882.673 991.288 Potri.015G069301.1.v4.1 564 240.036 0 0 Potri.010G195200.1.v4.1 1773 1416.55 12 0.530398 Potri.012G127500.1.v4.1 977 620.809 1147 115.68 ==> SRR14639626.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 24 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 170 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 12 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 195 SRR14639626 completed mapping pipeline successfully