Starting /dee2/code/volunteer_pipeline.sh SRR14639627 current disk space = 3059099361280 free memory = 1538199924 SRR14639627 SRAfilesize 6cff0cb3505685048be4cd771b928bf5 SRR14639627.sra SRR14639627.sra file validated SRR14639627 is paired end SRR14639627 is conventional basespace SRR14639627 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14639627_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.70875 32.0 32.0 32.0 32.0 32.0 2 31.58125 32.0 32.0 32.0 32.0 32.0 3 35.1475 37.0 32.0 37.0 32.0 37.0 4 36.11375 37.0 37.0 37.0 32.0 37.0 5 36.16 37.0 37.0 37.0 37.0 37.0 6 39.737 41.0 41.0 41.0 37.0 41.0 7 39.65575 41.0 41.0 41.0 37.0 41.0 8 39.958 41.0 41.0 41.0 37.0 41.0 9 40.04375 41.0 41.0 41.0 37.0 41.0 10-14 40.11615 41.0 41.0 41.0 37.0 41.0 15-19 40.1499 41.0 41.0 41.0 37.0 41.0 20-24 40.112199999999994 41.0 41.0 41.0 37.0 41.0 25-29 40.08295 41.0 41.0 41.0 37.0 41.0 30-34 40.073699999999995 41.0 41.0 41.0 37.0 41.0 35-39 39.98645 41.0 41.0 41.0 37.0 41.0 40-44 39.918949999999995 41.0 41.0 41.0 37.0 41.0 45-49 39.84015000000001 41.0 41.0 41.0 37.0 41.0 50-54 39.765100000000004 41.0 41.0 41.0 37.0 41.0 55-59 39.6821 41.0 41.0 41.0 37.0 41.0 60-64 39.6222 41.0 41.0 41.0 37.0 41.0 65-69 39.45855 41.0 41.0 41.0 37.0 41.0 70-74 39.2986 41.0 41.0 41.0 37.0 41.0 75-79 38.605450000000005 41.0 39.4 41.0 34.0 41.0 80-84 39.1738 41.0 41.0 41.0 37.0 41.0 85-89 39.04855 41.0 41.0 41.0 37.0 41.0 90-94 38.9966 41.0 41.0 41.0 37.0 41.0 95-99 38.7992 41.0 41.0 41.0 32.0 41.0 100-104 38.72025 41.0 41.0 41.0 32.0 41.0 105-109 38.5489 41.0 41.0 41.0 32.0 41.0 110-114 38.51605 41.0 41.0 41.0 32.0 41.0 115-119 38.4045 41.0 40.2 41.0 32.0 41.0 120-124 38.25064999999999 41.0 37.0 41.0 32.0 41.0 125-129 38.1957 41.0 38.6 41.0 32.0 41.0 130-134 37.7326 41.0 37.0 41.0 29.0 41.0 135-139 37.38835 41.0 37.0 41.0 27.0 41.0 140-144 36.980650000000004 41.0 37.0 41.0 27.0 41.0 145-149 36.64535 41.0 37.0 41.0 25.0 41.0 150 36.27875 41.0 37.0 41.0 22.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 5.0 23 6.0 24 10.0 25 8.0 26 20.0 27 25.0 28 15.0 29 23.0 30 25.0 31 48.0 32 50.0 33 66.0 34 89.0 35 115.0 36 137.0 37 226.0 38 319.0 39 688.0 40 2124.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.38359589897475 14.328582145536384 13.978494623655912 37.30932733183296 2 16.900000000000002 10.7 39.375 33.025 3 17.8 17.825 29.299999999999997 35.075 4 23.175 25.05 25.4 26.375 5 23.1 30.625000000000004 26.85 19.425 6 17.075000000000003 32.074999999999996 27.700000000000003 23.150000000000002 7 15.925 27.875 39.825 16.375 8 15.6 24.55 36.275 23.575 9 17.175 25.8 33.300000000000004 23.724999999999998 10-14 19.685 28.48 28.37 23.465 15-19 19.765 28.110000000000003 28.249999999999996 23.875 20-24 19.830000000000002 27.975 28.105000000000004 24.09 25-29 20.119999999999997 28.08 27.495000000000005 24.305 30-34 20.54 27.810000000000002 27.33 24.32 35-39 19.68 28.1 28.084999999999997 24.135 40-44 20.64 27.855 27.529999999999998 23.974999999999998 45-49 20.505000000000003 27.67 27.655 24.169999999999998 50-54 21.11 27.435 27.275 24.18 55-59 20.455000000000002 27.005000000000003 28.065 24.474999999999998 60-64 20.215 27.415 27.560000000000002 24.81 65-69 21.09 27.35 27.125 24.435000000000002 70-74 21.65 27.994999999999997 26.995 23.36 75-79 20.625 28.285 27.05 24.04 80-84 20.979999999999997 27.32 27.295 24.404999999999998 85-89 21.465 27.97 27.005000000000003 23.56 90-94 20.395 28.055000000000003 27.08 24.47 95-99 21.235 27.83 26.71 24.224999999999998 100-104 21.37 27.99 26.834999999999997 23.805 105-109 20.687068706870686 27.577757775777577 27.40774077407741 24.327432743274326 110-114 21.015 27.810000000000002 26.99 24.185000000000002 115-119 21.345 27.88 27.045 23.73 120-124 21.055 27.16 27.339999999999996 24.445 125-129 20.794999999999998 27.139999999999997 27.295 24.77 130-134 21.035 27.295 27.639999999999997 24.03 135-139 20.765 28.065 26.895000000000003 24.275 140-144 20.943141471220684 27.46411961794269 27.56413462019303 24.028604290643596 145-149 21.43 28.02 26.584999999999997 23.965 150 19.85 27.150000000000002 27.675 25.324999999999996 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 2.0 1 1.0 2 0.0 3 1.5 4 2.5 5 1.0 6 0.0 7 0.5 8 1.0 9 1.0 10 0.5 11 0.0 12 0.5 13 0.5 14 0.5 15 0.5 16 0.0 17 1.5 18 2.0 19 2.0 20 1.5 21 1.0 22 1.5 23 2.0 24 4.0 25 5.0 26 5.5 27 9.5 28 11.5 29 15.0 30 23.5 31 24.5 32 20.5 33 28.5 34 49.0 35 61.0 36 76.5 37 105.5 38 124.5 39 153.0 40 177.0 41 199.5 42 234.5 43 237.5 44 235.0 45 239.5 46 235.5 47 236.0 48 227.0 49 193.5 50 167.5 51 154.5 52 125.0 53 99.5 54 88.5 55 81.5 56 69.5 57 51.0 58 42.0 59 39.5 60 28.0 61 19.0 62 18.5 63 15.0 64 9.0 65 7.0 66 8.5 67 9.0 68 5.5 69 2.5 70 2.0 71 0.0 72 1.0 73 1.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.01 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.015 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.425 #Duplication Level Percentage of deduplicated Percentage of total 1 94.89012443738417 89.60000000000001 2 4.898067249139529 9.25 3 0.15885623510722796 0.44999999999999996 4 0.0 0.0 5 0.0 0.0 6 0.026476039184537992 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.026476039184537992 0.5499999999999999 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ATCGGAAGAGCACACGTCTGAACTCCAGTCACAGCGATAGATCTCGTATG 22 0.5499999999999999 TruSeq Adapter, Index 1 (97% over 35bp) TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0125 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.0875 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.1 0.0 0.0 0.0 0.0 104-105 0.1 0.0 0.0 0.0 0.0 106-107 0.1 0.0 0.0 0.0 0.0 108-109 0.1 0.0 0.0 0.0 0.0 110-111 0.125 0.0 0.0 0.0 0.0 112-113 0.16249999999999998 0.0 0.0 0.0 0.0 114-115 0.175 0.0 0.0 0.0 0.0 116-117 0.225 0.0 0.0 0.0 0.0 118-119 0.2375 0.0 0.0 0.0 0.0 120-121 0.25 0.0 0.0 0.0 0.0 122-123 0.275 0.0 0.0 0.0 0.0 124-125 0.275 0.0 0.0 0.0 0.0 126-127 0.275 0.0 0.0 0.0 0.0 128-129 0.275 0.0 0.0 0.0 0.0 130-131 0.275 0.0 0.0 0.0 0.0 132-133 0.3 0.0 0.0 0.0 0.0 134-135 0.3125 0.0 0.0 0.0 0.0 136-137 0.3375 0.0 0.0 0.0 0.0 138 0.375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCGGAAG 10 0.006973645 144.0 2 GAGCACA 10 0.006973645 144.0 8 AGAGCAC 10 0.006973645 144.0 7 ATCGGAA 10 0.006973645 144.0 1 AGCACAC 10 0.006973645 144.0 9 TCACTCG 10 0.006973645 144.0 3 AAAAAAA 90 1.164226E-6 16.0 65-69 >>END_MODULE SRR14639627 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14639627_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.565 32.0 32.0 32.0 27.0 32.0 2 30.5675 32.0 32.0 32.0 27.0 32.0 3 33.76625 37.0 32.0 37.0 32.0 37.0 4 34.68125 37.0 37.0 37.0 32.0 37.0 5 34.67 37.0 37.0 37.0 32.0 37.0 6 37.81675 41.0 37.0 41.0 32.0 41.0 7 37.71725 41.0 37.0 41.0 32.0 41.0 8 37.87675 41.0 37.0 41.0 27.0 41.0 9 38.1455 41.0 41.0 41.0 32.0 41.0 10-14 38.0986 41.0 40.2 41.0 30.0 41.0 15-19 37.883599999999994 41.0 38.6 41.0 27.0 41.0 20-24 37.618849999999995 41.0 37.0 41.0 27.0 41.0 25-29 37.1389 41.0 37.0 41.0 26.0 41.0 30-34 37.154999999999994 41.0 37.0 41.0 26.0 41.0 35-39 37.110350000000004 41.0 37.0 41.0 27.0 41.0 40-44 36.95785 41.0 37.0 41.0 25.0 41.0 45-49 36.80955 41.0 37.0 41.0 25.0 41.0 50-54 36.7279 41.0 37.0 41.0 23.0 41.0 55-59 36.6714 41.0 37.0 41.0 22.0 41.0 60-64 36.54095 41.0 37.0 41.0 22.0 41.0 65-69 36.256299999999996 41.0 37.0 41.0 22.0 41.0 70-74 35.9867 41.0 37.0 41.0 22.0 41.0 75-79 35.2737 40.2 34.0 41.0 22.0 41.0 80-84 36.142900000000004 41.0 37.0 41.0 22.0 41.0 85-89 36.12545 41.0 37.0 41.0 22.0 41.0 90-94 35.902499999999996 41.0 36.0 41.0 22.0 41.0 95-99 35.924749999999996 41.0 37.0 41.0 22.0 41.0 100-104 35.6707 41.0 35.0 41.0 20.0 41.0 105-109 35.63965 41.0 33.0 41.0 22.0 41.0 110-114 35.626999999999995 41.0 34.0 41.0 22.0 41.0 115-119 35.2287 41.0 32.0 41.0 20.0 41.0 120-124 35.27605 41.0 32.0 41.0 18.0 41.0 125-129 34.67805 41.0 32.0 41.0 14.0 41.0 130-134 34.586400000000005 41.0 32.0 41.0 12.0 41.0 135-139 34.116200000000006 39.4 30.0 41.0 12.0 41.0 140-144 33.78055 37.0 28.0 41.0 12.0 41.0 145-149 33.67075 37.0 31.0 41.0 12.0 41.0 150 33.236 37.0 27.0 41.0 12.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 8.0 16 13.0 17 17.0 18 40.0 19 41.0 20 35.0 21 35.0 22 30.0 23 43.0 24 45.0 25 55.0 26 55.0 27 62.0 28 89.0 29 88.0 30 99.0 31 92.0 32 106.0 33 106.0 34 147.0 35 177.0 36 167.0 37 235.0 38 353.0 39 540.0 40 1322.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 33.842685370741485 28.707414829659317 11.297595190380761 26.152304609218437 2 19.25 25.3 35.775 19.675 3 17.075000000000003 26.974999999999998 35.275 20.674999999999997 4 23.175 31.35 24.45 21.025 5 22.3 38.15 23.125 16.425 6 18.075 35.725 24.775 21.425 7 18.075 23.9 35.9 22.125 8 17.575 23.974999999999998 31.574999999999996 26.875 9 19.025 27.275 29.95 23.75 10-14 22.85 28.105000000000004 26.150000000000002 22.895 15-19 22.505 27.485 27.474999999999998 22.535 20-24 22.065 28.29 27.67 21.975 25-29 22.439999999999998 27.76 27.005000000000003 22.795 30-34 22.36 27.54 27.534999999999997 22.564999999999998 35-39 22.05 26.47 27.73 23.75 40-44 22.8 27.46 27.315 22.425 45-49 22.495 26.915 27.705000000000002 22.884999999999998 50-54 22.54 26.955000000000002 27.425 23.080000000000002 55-59 22.715 27.425 26.775 23.085 60-64 22.935 27.83 26.77 22.465 65-69 22.634999999999998 27.805000000000003 27.18 22.38 70-74 22.975 27.889999999999997 26.22 22.915 75-79 23.18 27.66 26.945000000000004 22.215 80-84 22.93 27.794999999999998 26.5 22.775000000000002 85-89 23.035 27.455000000000002 26.735 22.775000000000002 90-94 23.215 27.224999999999998 26.83 22.73 95-99 23.72 27.61 26.565 22.105 100-104 23.265 28.065 26.085 22.585 105-109 23.875 27.57 26.740000000000002 21.815 110-114 23.435 27.575 26.72 22.27 115-119 23.98 27.245 26.450000000000003 22.325 120-124 23.97 28.345 26.19 21.495 125-129 23.200000000000003 27.525 26.27 23.005 130-134 23.59 27.48 26.215 22.715 135-139 23.724999999999998 26.985 26.57 22.720000000000002 140-144 23.575 27.755000000000003 26.16 22.509999999999998 145-149 23.585 27.250000000000004 26.05 23.115 150 23.825 27.200000000000003 27.375 21.6 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 1.0 17 0.0 18 1.0 19 1.0 20 0.0 21 1.0 22 1.0 23 1.0 24 2.0 25 6.0 26 9.0 27 8.5 28 9.0 29 11.0 30 14.5 31 16.0 32 22.0 33 33.5 34 48.0 35 63.0 36 73.5 37 97.0 38 120.0 39 135.5 40 174.5 41 217.5 42 237.0 43 248.5 44 256.5 45 251.5 46 244.0 47 231.5 48 206.0 49 171.0 50 147.5 51 149.0 52 132.5 53 109.0 54 100.0 55 83.5 56 70.5 57 63.5 58 54.5 59 38.5 60 29.0 61 28.0 62 17.0 63 11.5 64 12.5 65 9.0 66 8.0 67 6.5 68 3.5 69 2.0 70 2.0 71 2.5 72 1.5 73 0.5 74 1.0 75 0.5 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.2 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.625 #Duplication Level Percentage of deduplicated Percentage of total 1 96.05228758169935 91.85 2 3.8169934640522873 7.3 3 0.10457516339869283 0.3 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.026143790849673207 0.5499999999999999 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTGCCTCTATGTGTAGATCTC 22 0.5499999999999999 Illumina Single End PCR Primer 1 (96% over 31bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1125 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.1375 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.175 0.0 0.0 0.0 0.0 96-97 0.2 0.0 0.0 0.0 0.0 98-99 0.2 0.0 0.0 0.0 0.0 100-101 0.2 0.0 0.0 0.0 0.0 102-103 0.2 0.0 0.0 0.0 0.0 104-105 0.2 0.0 0.0 0.0 0.0 106-107 0.2 0.0 0.0 0.0 0.0 108-109 0.2 0.0 0.0 0.0 0.0 110-111 0.21250000000000002 0.0 0.0 0.0 0.0 112-113 0.2625 0.0 0.0 0.0 0.0 114-115 0.275 0.0 0.0 0.0 0.0 116-117 0.325 0.0 0.0 0.0 0.0 118-119 0.325 0.0 0.0 0.0 0.0 120-121 0.325 0.0 0.0 0.0 0.0 122-123 0.35 0.0 0.0 0.0 0.0 124-125 0.35 0.0 0.0 0.0 0.0 126-127 0.3625 0.0 0.0 0.0 0.0 128-129 0.4 0.0 0.0 0.0 0.0 130-131 0.4 0.0 0.0 0.0 0.0 132-133 0.45 0.0 0.0 0.0 0.0 134-135 0.4875 0.0 0.0 0.0 0.0 136-137 0.5375000000000001 0.0 0.0 0.0 0.0 138 0.575 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCGGAAG 10 0.006973645 144.0 2 CGGAAGA 10 0.006973645 144.0 3 ATCGGAA 10 0.006973645 144.0 1 AGCGTCG 10 0.006973645 144.0 9 TTTTTTT 115 1.47922165E-5 12.521738 45-49 AAAAAAA 215 0.0077926423 6.6976743 70-74 >>END_MODULE Read 1036235 spots for SRR14639627.sra Written 1036235 spots for SRR14639627.sra Read 1036235 spots for SRR14639627.sra Written 1036235 spots for SRR14639627.sra Read 1036235 spots for SRR14639627.sra Written 1036235 spots for SRR14639627.sra Read 1036235 spots for SRR14639627.sra Written 1036235 spots for SRR14639627.sra Read 1036235 spots for SRR14639627.sra Written 1036235 spots for SRR14639627.sra Read 1036235 spots for SRR14639627.sra Written 1036235 spots for SRR14639627.sra Read 1036235 spots for SRR14639627.sra Written 1036235 spots for SRR14639627.sra Read 1036235 spots for SRR14639627.sra Written 1036235 spots for SRR14639627.sra Read 1036235 spots for SRR14639627.sra Written 1036235 spots for SRR14639627.sra Read 1036235 spots for SRR14639627.sra Written 1036235 spots for SRR14639627.sra Read 1036235 spots for SRR14639627.sra Written 1036235 spots for SRR14639627.sra Read 1036243 spots for SRR14639627.sra Written 1036243 spots for SRR14639627.sra Read 1036235 spots for SRR14639627.sra Written 1036235 spots for SRR14639627.sra Read 1036235 spots for SRR14639627.sra Written 1036235 spots for SRR14639627.sra Read 1036235 spots for SRR14639627.sra Written 1036235 spots for SRR14639627.sra Read 1036235 spots for SRR14639627.sra Written 1036235 spots for SRR14639627.sra Read 1036235 spots for SRR14639627.sra Written 1036235 spots for SRR14639627.sra Read 1036235 spots for SRR14639627.sra Written 1036235 spots for SRR14639627.sra Read 1036235 spots for SRR14639627.sra Written 1036235 spots for SRR14639627.sra Read 1036235 spots for SRR14639627.sra Written 1036235 spots for SRR14639627.sra SRR ids: ['SRR14639627.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_2j38g3ad SRR14639627.sra spots: 20724708 blocks: [[1, 1036235], [1036236, 2072470], [2072471, 3108705], [3108706, 4144940], [4144941, 5181175], [5181176, 6217410], [6217411, 7253645], [7253646, 8289880], [8289881, 9326115], [9326116, 10362350], [10362351, 11398585], [11398586, 12434820], [12434821, 13471055], [13471056, 14507290], [14507291, 15543525], [15543526, 16579760], [16579761, 17615995], [17615996, 18652230], [18652231, 19688465], [19688466, 20724708]] SRR14639627 file size 7670566 SRR14639627 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR14639627 SRR14639627_1.fastq SRR14639627_2.fastq Input file: SRR14639627_1.fastq Paired file: SRR14639627_2.fastq trimmed: SRR14639627-trimmed-pair1.fastq, SRR14639627-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 15:33:20 2025 >> started Mon Feb 10 15:33:54 2025 >> done (34.194s) 20724708 read pairs processed; of these: 120 ( 0.00%) short read pairs filtered out after trimming by size control 688 ( 0.00%) empty read pairs filtered out after trimming by size control 20723900 (100.00%) read pairs available; of these: 641000 ( 3.09%) trimmed read pairs available after processing 20082900 (96.91%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 16 0.00% 19 17 0.00% 20 22 0.00% 21 31 0.00% 22 22 0.00% 23 28 0.00% 24 41 0.00% 25 40 0.00% 26 35 0.00% 27 58 0.00% 28 58 0.00% 29 56 0.00% 30 57 0.00% 31 51 0.00% 32 54 0.00% 33 71 0.00% 34 97 0.00% 35 90 0.00% 36 83 0.00% 37 110 0.00% 38 118 0.00% 39 116 0.00% 40 117 0.00% 41 107 0.00% 42 141 0.00% 43 149 0.00% 44 145 0.00% 45 149 0.00% 46 155 0.00% 47 186 0.00% 48 161 0.00% 49 211 0.00% 50 226 0.00% 51 194 0.00% 52 204 0.00% 53 218 0.00% 54 253 0.00% 55 300 0.00% 56 255 0.00% 57 271 0.00% 58 289 0.00% 59 315 0.00% 60 404 0.00% 61 387 0.00% 62 406 0.00% 63 409 0.00% 64 417 0.00% 65 451 0.00% 66 492 0.00% 67 441 0.00% 68 494 0.00% 69 528 0.00% 70 604 0.00% 71 593 0.00% 72 615 0.00% 73 668 0.00% 74 658 0.00% 75 709 0.00% 76 742 0.00% 77 824 0.00% 78 858 0.00% 79 835 0.00% 80 887 0.00% 81 921 0.00% 82 1017 0.00% 83 1053 0.01% 84 1077 0.01% 85 1052 0.01% 86 1083 0.01% 87 1199 0.01% 88 1188 0.01% 89 1213 0.01% 90 1346 0.01% 91 1330 0.01% 92 1326 0.01% 93 1531 0.01% 94 1537 0.01% 95 1588 0.01% 96 1614 0.01% 97 1706 0.01% 98 1708 0.01% 99 1689 0.01% 100 1883 0.01% 101 1920 0.01% 102 2052 0.01% 103 2067 0.01% 104 2140 0.01% 105 2285 0.01% 106 2297 0.01% 107 2309 0.01% 108 2405 0.01% 109 2470 0.01% 110 2625 0.01% 111 2681 0.01% 112 2744 0.01% 113 2781 0.01% 114 2875 0.01% 115 2989 0.01% 116 3195 0.02% 117 3143 0.02% 118 3361 0.02% 119 3411 0.02% 120 3634 0.02% 121 3638 0.02% 122 3719 0.02% 123 3848 0.02% 124 3997 0.02% 125 4111 0.02% 126 4207 0.02% 127 4306 0.02% 128 4441 0.02% 129 4620 0.02% 130 4761 0.02% 131 4748 0.02% 132 4475 0.02% 133 4674 0.02% 134 4641 0.02% 135 4798 0.02% 136 4895 0.02% 137 5126 0.02% 138 5205 0.03% 139 5378 0.03% 140 5383 0.03% 141 5644 0.03% 142 5780 0.03% 143 5872 0.03% 144 5977 0.03% 145 6469 0.03% 146 7378 0.04% 147 10596 0.05% 148 31148 0.15% 149 372981 1.80% 150 20082900 96.91% 20723900 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=3.40 fanout-score-rank=21 prefix-density=0.26 prefix-fanout=2.9 sequence=GTTTTCTCATTTGCA criterion=fanout-score sequence-density=0.09 sequence-density-rank=19 fanout-score=18.87 fanout-score-rank=1 prefix-density=0.26 prefix-fanout=6.3 sequence=AGCACCAAGTGGAGGGTGGACTCCTTCTGGATGTTGTA criterion=sequence-density sequence-density=0.28 sequence-density-rank=1 fanout-score=4.04 fanout-score-rank=12 prefix-density=0.37 prefix-fanout=3.1 sequence=CTGCAAATGTGG criterion=fanout-score sequence-density=0.11 sequence-density-rank=18 fanout-score=26.99 fanout-score-rank=1 prefix-density=0.36 prefix-fanout=8.2 sequence=TGATTTTGATCT SRR14639627 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 15:35:02 Started mapping on | Feb 10 15:35:02 Finished on | Feb 10 15:46:11 Mapping speed, Million of reads per hour | 111.52 Number of input reads | 20723900 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 14548897 Uniquely mapped reads % | 70.20% Average mapped length | 296.73 Number of splices: Total | 12192637 Number of splices: Annotated (sjdb) | 11945773 Number of splices: GT/AG | 11995492 Number of splices: GC/AG | 146223 Number of splices: AT/AC | 10954 Number of splices: Non-canonical | 39968 Mismatch rate per base, % | 0.59% Deletion rate per base | 0.03% Deletion average length | 2.96 Insertion rate per base | 0.02% Insertion average length | 2.61 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 461845 % of reads mapped to multiple loci | 2.23% Number of reads mapped to too many loci | 32580 % of reads mapped to too many loci | 0.16% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 27.20% % of reads unmapped: other | 0.21% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 5713158 5713158 5713158 N_multimapping 461845 461845 461845 N_noFeature 401044 14426830 447304 N_ambiguous 184770 905 108537 UnstrandedReadsAssigned:13963083 PositiveStrandReadsAssigned:121162 NegativeStrandReadsAssigned:13993056 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR14639627 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR14639627-trimmed-pair1.fastq SRR14639627-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,723,900 reads, 14,766,485 reads pseudoaligned [quant] estimated average fragment length: 355.745 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,079 rounds 52401 SRR14639627.ke.tsv 34699 SRR14639627.se.tsv 87100 total ==> SRR14639627.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1663.25 3610 124.864 Potri.005G024800.1.v4.1 1035 680.255 770 65.1189 Potri.004G059700.1.v4.1 961 606.699 159 15.0769 Potri.007G009000.2.v4.1 1416 1061.25 0 0 Potri.003G141000.2.v4.1 2943 2588.25 698 15.5145 Potri.016G087400.1.v4.1 270 52.9895 989 1073.73 Potri.015G069301.1.v4.1 564 240.308 0 0 Potri.010G195200.1.v4.1 1773 1418.25 23 0.932957 Potri.012G127500.1.v4.1 977 622.494 1826 168.754 ==> SRR14639627.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 26 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 172 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 4 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 240 SRR14639627 completed mapping pipeline successfully