Starting /dee2/code/volunteer_pipeline.sh SRR14639628 current disk space = 3059046825984 free memory = 1128293384 SRR14639628 SRAfilesize 37ab5616e38e5a2ae1acba912a84df61 SRR14639628.sra SRR14639628.sra file validated SRR14639628 is paired end SRR14639628 is conventional basespace SRR14639628 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14639628_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.64 32.0 32.0 32.0 32.0 32.0 2 31.56 32.0 32.0 32.0 32.0 32.0 3 35.08625 37.0 32.0 37.0 32.0 37.0 4 35.9925 37.0 37.0 37.0 32.0 37.0 5 36.21625 37.0 37.0 37.0 37.0 37.0 6 39.75675 41.0 41.0 41.0 37.0 41.0 7 39.738 41.0 41.0 41.0 37.0 41.0 8 40.071 41.0 41.0 41.0 37.0 41.0 9 40.1165 41.0 41.0 41.0 37.0 41.0 10-14 40.089150000000004 41.0 41.0 41.0 37.0 41.0 15-19 40.07985 41.0 41.0 41.0 37.0 41.0 20-24 40.14 41.0 41.0 41.0 37.0 41.0 25-29 40.0814 41.0 41.0 41.0 37.0 41.0 30-34 40.016400000000004 41.0 41.0 41.0 37.0 41.0 35-39 39.900850000000005 41.0 41.0 41.0 37.0 41.0 40-44 39.78875000000001 41.0 41.0 41.0 37.0 41.0 45-49 39.741 41.0 41.0 41.0 37.0 41.0 50-54 39.7178 41.0 41.0 41.0 37.0 41.0 55-59 39.61355 41.0 41.0 41.0 37.0 41.0 60-64 39.52525 41.0 41.0 41.0 37.0 41.0 65-69 39.425650000000005 41.0 41.0 41.0 37.0 41.0 70-74 39.175149999999995 41.0 41.0 41.0 37.0 41.0 75-79 38.51405 41.0 39.4 41.0 34.0 41.0 80-84 38.96875 41.0 41.0 41.0 35.0 41.0 85-89 38.894600000000004 41.0 41.0 41.0 33.0 41.0 90-94 38.7667 41.0 41.0 41.0 32.0 41.0 95-99 38.76175 41.0 41.0 41.0 32.0 41.0 100-104 38.54475 41.0 41.0 41.0 32.0 41.0 105-109 38.51795 41.0 41.0 41.0 32.0 41.0 110-114 38.42505 41.0 41.0 41.0 32.0 41.0 115-119 38.34655 41.0 38.6 41.0 32.0 41.0 120-124 38.23205 41.0 37.0 41.0 32.0 41.0 125-129 38.04265 41.0 37.8 41.0 32.0 41.0 130-134 37.69835 41.0 37.0 41.0 29.0 41.0 135-139 37.26115 41.0 37.0 41.0 27.0 41.0 140-144 36.91085 41.0 37.0 41.0 26.0 41.0 145-149 36.5194 41.0 37.0 41.0 23.0 41.0 150 36.11 41.0 37.0 41.0 22.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 5.0 22 4.0 23 1.0 24 7.0 25 3.0 26 15.0 27 22.0 28 29.0 29 33.0 30 38.0 31 50.0 32 64.0 33 72.0 34 88.0 35 117.0 36 161.0 37 216.0 38 331.0 39 610.0 40 2134.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.15 14.099999999999998 14.499999999999998 30.25 2 18.65 11.375 37.275000000000006 32.7 3 19.25 19.25 27.950000000000003 33.550000000000004 4 23.7 23.625 26.200000000000003 26.474999999999998 5 24.45 30.675 26.575 18.3 6 17.549999999999997 30.375000000000004 29.099999999999998 22.975 7 17.075000000000003 27.750000000000004 37.925 17.25 8 16.175 24.575 37.125 22.125 9 18.099999999999998 26.05 33.775 22.075 10-14 20.865000000000002 27.85 27.785 23.5 15-19 20.46 27.98 27.715 23.845 20-24 20.8 28.044999999999998 27.82 23.335 25-29 20.59 27.589999999999996 28.134999999999998 23.685000000000002 30-34 20.925 28.04 27.13 23.905 35-39 20.794999999999998 27.325 27.98 23.9 40-44 20.76 27.58 27.82 23.84 45-49 21.395 27.42 27.51 23.674999999999997 50-54 21.265 27.169999999999998 27.36 24.205 55-59 21.01 27.584999999999997 27.74 23.665 60-64 20.974999999999998 26.815 28.134999999999998 24.075 65-69 20.674999999999997 27.800000000000004 27.815 23.71 70-74 20.69 27.595 27.735 23.98 75-79 21.279999999999998 27.800000000000004 27.415 23.505000000000003 80-84 20.84 27.405 27.97 23.785 85-89 21.4 27.37 27.24 23.990000000000002 90-94 21.62 27.105 26.72 24.555 95-99 21.16 27.694999999999997 27.235 23.91 100-104 21.175 27.49 27.72 23.615 105-109 21.365000000000002 27.21 27.32 24.104999999999997 110-114 21.72 26.85 27.384999999999998 24.044999999999998 115-119 21.015 27.134999999999998 27.644999999999996 24.205 120-124 21.495 27.089999999999996 27.22 24.195 125-129 22.115000000000002 27.18 27.295 23.41 130-134 21.4 27.515 27.37 23.715 135-139 21.89 27.005000000000003 27.495000000000005 23.61 140-144 21.404280856171233 27.125425085017003 27.425485097019404 24.04480896179236 145-149 21.43 27.425 27.400000000000002 23.745 150 22.35 27.450000000000003 26.75 23.45 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 5.0 1 3.0 2 0.5 3 0.0 4 0.0 5 1.0 6 1.0 7 1.0 8 1.5 9 1.5 10 1.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 0.5 18 0.0 19 0.0 20 0.5 21 2.5 22 2.5 23 2.0 24 2.5 25 3.5 26 4.0 27 4.0 28 9.0 29 14.0 30 18.5 31 23.0 32 34.0 33 45.0 34 54.0 35 68.0 36 85.5 37 117.5 38 125.0 39 133.0 40 168.5 41 189.0 42 198.5 43 229.5 44 249.5 45 247.0 46 251.5 47 242.0 48 206.0 49 177.0 50 163.5 51 140.5 52 127.0 53 107.0 54 89.0 55 78.5 56 63.0 57 60.0 58 58.0 59 42.0 60 33.0 61 28.0 62 17.5 63 11.5 64 10.5 65 10.0 66 7.5 67 9.0 68 8.5 69 6.0 70 3.0 71 1.5 72 2.0 73 1.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.02 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.72500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 95.59250461863289 90.55 2 4.038004750593824 7.6499999999999995 3 0.2903140670361573 0.8250000000000001 4 0.026392187912377938 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.052784375824755876 0.8750000000000001 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ATCGGAAGAGCACACGTCTGAACTCCAGTCACAGCGATAGATCTCGTATG 22 0.5499999999999999 TruSeq Adapter, Index 1 (97% over 35bp) TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 13 0.325 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0125 0.0 0.0 0.0 18-19 0.0 0.025 0.0 0.0 0.0 20-21 0.0 0.025 0.0 0.0 0.0 22-23 0.0 0.025 0.0 0.0 0.0 24-25 0.0 0.025 0.0 0.0 0.0 26-27 0.0 0.025 0.0 0.0 0.0 28-29 0.0 0.025 0.0 0.0 0.0 30-31 0.0 0.025 0.0 0.0 0.0 32-33 0.0 0.025 0.0 0.0 0.0 34-35 0.0 0.025 0.0 0.0 0.0 36-37 0.0 0.025 0.0 0.0 0.0 38-39 0.0 0.025 0.0 0.0 0.0 40-41 0.0 0.025 0.0 0.0 0.0 42-43 0.0 0.025 0.0 0.0 0.0 44-45 0.0 0.025 0.0 0.0 0.0 46-47 0.0 0.025 0.0 0.0 0.0 48-49 0.0 0.025 0.0 0.0 0.0 50-51 0.0 0.025 0.0 0.0 0.0 52-53 0.0 0.025 0.0 0.0 0.0 54-55 0.0 0.025 0.0 0.0 0.0 56-57 0.0 0.025 0.0 0.0 0.0 58-59 0.0 0.025 0.0 0.0 0.0 60-61 0.0 0.025 0.0 0.0 0.0 62-63 0.0 0.025 0.0 0.0 0.0 64-65 0.0 0.025 0.0 0.0 0.0 66-67 0.025 0.025 0.0 0.0 0.0 68-69 0.025 0.025 0.0 0.0 0.0 70-71 0.025 0.025 0.0 0.0 0.0 72-73 0.037500000000000006 0.025 0.0 0.0 0.0 74-75 0.05 0.025 0.0 0.0 0.0 76-77 0.05 0.025 0.0 0.0 0.0 78-79 0.05 0.025 0.0 0.0 0.0 80-81 0.075 0.025 0.0 0.0 0.0 82-83 0.075 0.025 0.0 0.0 0.0 84-85 0.075 0.025 0.0 0.0 0.0 86-87 0.075 0.025 0.0 0.0 0.0 88-89 0.1 0.025 0.0 0.0 0.0 90-91 0.1 0.025 0.0 0.0 0.0 92-93 0.1 0.025 0.0 0.0 0.0 94-95 0.1 0.025 0.0 0.0 0.0 96-97 0.1 0.025 0.0 0.0 0.0 98-99 0.1 0.025 0.0 0.0 0.0 100-101 0.1125 0.025 0.0 0.0 0.0 102-103 0.15 0.025 0.0 0.0 0.0 104-105 0.15 0.025 0.0 0.0 0.0 106-107 0.175 0.025 0.0 0.0 0.0 108-109 0.2 0.025 0.0 0.0 0.0 110-111 0.2 0.025 0.0 0.0 0.0 112-113 0.2375 0.025 0.0 0.0 0.0 114-115 0.2625 0.025 0.0 0.0 0.0 116-117 0.275 0.025 0.0 0.0 0.0 118-119 0.275 0.025 0.0 0.0 0.0 120-121 0.3 0.025 0.0 0.0 0.0 122-123 0.325 0.025 0.0 0.0 0.0 124-125 0.3375 0.025 0.0 0.0 0.0 126-127 0.375 0.025 0.0 0.0 0.0 128-129 0.375 0.025 0.0 0.0 0.0 130-131 0.3875 0.025 0.0 0.0 0.0 132-133 0.48750000000000004 0.025 0.0 0.0 0.0 134-135 0.575 0.025 0.0 0.0 0.0 136-137 0.6125 0.025 0.0 0.0 0.0 138 0.65 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CACGAAG 10 0.006973645 144.0 4 >>END_MODULE SRR14639628 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14639628_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.2925 32.0 32.0 32.0 27.0 32.0 2 30.44375 32.0 32.0 32.0 27.0 32.0 3 33.37125 37.0 32.0 37.0 27.0 37.0 4 34.31125 37.0 37.0 37.0 32.0 37.0 5 34.44375 37.0 37.0 37.0 27.0 37.0 6 37.4935 41.0 37.0 41.0 32.0 41.0 7 37.48275 41.0 37.0 41.0 32.0 41.0 8 37.3865 41.0 37.0 41.0 27.0 41.0 9 37.626 41.0 37.0 41.0 27.0 41.0 10-14 37.63185 41.0 37.0 41.0 27.0 41.0 15-19 37.392399999999995 41.0 37.0 41.0 27.0 41.0 20-24 37.170100000000005 41.0 37.0 41.0 26.0 41.0 25-29 36.691250000000004 41.0 37.0 41.0 23.0 41.0 30-34 36.78335 41.0 37.0 41.0 23.0 41.0 35-39 36.6658 41.0 37.0 41.0 22.0 41.0 40-44 36.417249999999996 41.0 37.0 41.0 22.0 41.0 45-49 36.3827 41.0 37.0 41.0 22.0 41.0 50-54 36.2404 41.0 37.0 41.0 22.0 41.0 55-59 36.246300000000005 41.0 37.0 41.0 22.0 41.0 60-64 36.0755 41.0 37.0 41.0 22.0 41.0 65-69 35.84905 41.0 36.0 41.0 20.0 41.0 70-74 35.6562 41.0 34.0 41.0 22.0 41.0 75-79 34.8581 40.2 32.0 41.0 20.0 41.0 80-84 35.7179 41.0 34.0 41.0 22.0 41.0 85-89 35.698699999999995 41.0 36.0 41.0 20.0 41.0 90-94 35.39209999999999 41.0 33.0 41.0 18.0 41.0 95-99 35.49215 41.0 33.0 41.0 16.0 41.0 100-104 35.1715 41.0 33.0 41.0 16.0 41.0 105-109 35.2243 41.0 32.0 41.0 18.0 41.0 110-114 35.12205 41.0 32.0 41.0 12.0 41.0 115-119 34.78815 41.0 32.0 41.0 14.0 41.0 120-124 34.8366 41.0 32.0 41.0 12.0 41.0 125-129 34.3484 41.0 32.0 41.0 12.0 41.0 130-134 34.3549 41.0 32.0 41.0 12.0 41.0 135-139 33.82115 39.4 30.0 41.0 12.0 41.0 140-144 33.5325 37.0 28.0 41.0 12.0 41.0 145-149 33.33485 37.0 28.0 41.0 12.0 41.0 150 32.99825 37.0 27.0 41.0 12.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 5.0 15 10.0 16 18.0 17 32.0 18 34.0 19 52.0 20 51.0 21 51.0 22 41.0 23 49.0 24 55.0 25 57.0 26 61.0 27 55.0 28 88.0 29 68.0 30 95.0 31 109.0 32 113.0 33 124.0 34 143.0 35 151.0 36 176.0 37 231.0 38 311.0 39 535.0 40 1285.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.34170854271356 26.457286432160803 13.06532663316583 22.135678391959797 2 19.425 26.375 34.699999999999996 19.5 3 18.95 26.75 33.125 21.175 4 23.875 30.475 23.0 22.650000000000002 5 22.400000000000002 37.7 23.200000000000003 16.7 6 18.775 34.075 26.224999999999998 20.925 7 19.900000000000002 23.65 34.35 22.1 8 17.7 24.15 32.625 25.525 9 19.5 25.874999999999996 29.125 25.5 10-14 22.564999999999998 27.744999999999997 26.85 22.84 15-19 22.235 27.584999999999997 27.49 22.689999999999998 20-24 22.53 28.645 26.815 22.009999999999998 25-29 22.715 27.83 26.965 22.49 30-34 23.005 27.855 26.47 22.67 35-39 22.46 27.43 27.18 22.93 40-44 22.845 27.325 27.52 22.31 45-49 22.85 27.55 26.625 22.975 50-54 22.695 27.405 26.924999999999997 22.975 55-59 23.025000000000002 27.395000000000003 26.68 22.900000000000002 60-64 22.634999999999998 27.435 27.08 22.85 65-69 22.825 27.169999999999998 27.589999999999996 22.415 70-74 23.765 27.55 26.340000000000003 22.345000000000002 75-79 23.235 27.875 26.284999999999997 22.605 80-84 23.22 28.28 25.915 22.585 85-89 23.43 28.134999999999998 26.07 22.365 90-94 23.36 27.55 27.055 22.035 95-99 23.335 27.51 26.924999999999997 22.23 100-104 23.585 27.93 26.334999999999997 22.15 105-109 22.95 28.315 26.424999999999997 22.31 110-114 22.915 28.37 26.58 22.134999999999998 115-119 23.200000000000003 27.685 25.81 23.305 120-124 22.95 27.735 25.85 23.465 125-129 23.765 27.155 26.155 22.925 130-134 23.32 27.345000000000002 26.384999999999998 22.95 135-139 22.765 27.22 26.365 23.65 140-144 23.150000000000002 27.72 26.395000000000003 22.735 145-149 23.41 27.68 26.185000000000002 22.725 150 24.425 27.825 26.0 21.75 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 1.0 15 1.0 16 0.5 17 1.0 18 0.5 19 0.0 20 1.0 21 1.5 22 1.0 23 2.0 24 2.0 25 1.0 26 3.5 27 7.0 28 8.5 29 12.0 30 18.5 31 23.5 32 22.5 33 34.5 34 49.5 35 71.5 36 85.5 37 102.5 38 115.0 39 123.5 40 155.0 41 186.5 42 210.0 43 228.5 44 243.0 45 248.5 46 255.5 47 241.0 48 209.5 49 190.5 50 165.5 51 143.0 52 140.0 53 128.5 54 105.0 55 87.5 56 77.0 57 60.0 58 54.0 59 45.0 60 31.5 61 25.5 62 19.0 63 13.5 64 9.5 65 7.5 66 5.0 67 5.5 68 5.5 69 3.0 70 2.5 71 2.0 72 1.0 73 1.0 74 0.5 75 0.0 76 0.0 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.7 #Duplication Level Percentage of deduplicated Percentage of total 1 96.36886102403344 92.225 2 3.3176593521421105 6.35 3 0.2612330198537095 0.75 4 0.026123301985370953 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.026123301985370953 0.575 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGGATAGGGTGTAGATCTC 23 0.575 Illumina Single End PCR Primer 1 (96% over 33bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.125 0.0 0.0 0.0 0.0 104-105 0.125 0.0 0.0 0.0 0.0 106-107 0.15 0.0 0.0 0.0 0.0 108-109 0.15 0.0 0.0 0.0 0.0 110-111 0.15 0.0 0.0 0.0 0.0 112-113 0.175 0.0 0.0 0.0 0.0 114-115 0.1875 0.0 0.0 0.0 0.0 116-117 0.225 0.0 0.0 0.0 0.0 118-119 0.25 0.0 0.0 0.0 0.0 120-121 0.3 0.0 0.0 0.0 0.0 122-123 0.325 0.0 0.0 0.0 0.0 124-125 0.375 0.0 0.0 0.0 0.0 126-127 0.4 0.0 0.0 0.0 0.0 128-129 0.4 0.0 0.0 0.0 0.0 130-131 0.4375 0.0 0.0 0.0 0.0 132-133 0.55 0.0 0.0 0.0 0.0 134-135 0.625 0.0 0.0 0.0 0.0 136-137 0.625 0.0 0.0 0.0 0.0 138 0.65 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1159752 spots for SRR14639628.sra Written 1159752 spots for SRR14639628.sra Read 1159752 spots for SRR14639628.sra Written 1159752 spots for SRR14639628.sra Read 1159752 spots for SRR14639628.sra Written 1159752 spots for SRR14639628.sra Read 1159752 spots for SRR14639628.sra Written 1159752 spots for SRR14639628.sra Read 1159752 spots for SRR14639628.sra Written 1159752 spots for SRR14639628.sra Read 1159752 spots for SRR14639628.sra Written 1159752 spots for SRR14639628.sra Read 1159752 spots for SRR14639628.sra Written 1159752 spots for SRR14639628.sra Read 1159752 spots for SRR14639628.sra Written 1159752 spots for SRR14639628.sra Read 1159752 spots for SRR14639628.sra Written 1159752 spots for SRR14639628.sra Read 1159752 spots for SRR14639628.sra Written 1159752 spots for SRR14639628.sra Read 1159752 spots for SRR14639628.sra Written 1159752 spots for SRR14639628.sra Read 1159752 spots for SRR14639628.sra Written 1159752 spots for SRR14639628.sra Read 1159752 spots for SRR14639628.sra Written 1159752 spots for SRR14639628.sra Read 1159752 spots for SRR14639628.sra Written 1159752 spots for SRR14639628.sra Read 1159752 spots for SRR14639628.sra Written 1159752 spots for SRR14639628.sra Read 1159752 spots for SRR14639628.sra Written 1159752 spots for SRR14639628.sra Read 1159763 spots for SRR14639628.sra Written 1159763 spots for SRR14639628.sra Read 1159752 spots for SRR14639628.sra Written 1159752 spots for SRR14639628.sra Read 1159752 spots for SRR14639628.sra Written 1159752 spots for SRR14639628.sra Read 1159752 spots for SRR14639628.sra Written 1159752 spots for SRR14639628.sra SRR ids: ['SRR14639628.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_yyp0v3tj SRR14639628.sra spots: 23195051 blocks: [[1, 1159752], [1159753, 2319504], [2319505, 3479256], [3479257, 4639008], [4639009, 5798760], [5798761, 6958512], [6958513, 8118264], [8118265, 9278016], [9278017, 10437768], [10437769, 11597520], [11597521, 12757272], [12757273, 13917024], [13917025, 15076776], [15076777, 16236528], [16236529, 17396280], [17396281, 18556032], [18556033, 19715784], [19715785, 20875536], [20875537, 22035288], [22035289, 23195051]] SRR14639628 file size 8586162 SRR14639628 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR14639628 SRR14639628_1.fastq SRR14639628_2.fastq Input file: SRR14639628_1.fastq Paired file: SRR14639628_2.fastq trimmed: SRR14639628-trimmed-pair1.fastq, SRR14639628-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 14:50:34 2025 >> started Mon Feb 10 14:51:01 2025 >> done (26.661s) 23195051 read pairs processed; of these: 232 ( 0.00%) short read pairs filtered out after trimming by size control 2851 ( 0.01%) empty read pairs filtered out after trimming by size control 23191968 (99.99%) read pairs available; of these: 1013561 ( 4.37%) trimmed read pairs available after processing 22178407 (95.63%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 36 0.00% 19 45 0.00% 20 43 0.00% 21 42 0.00% 22 56 0.00% 23 67 0.00% 24 81 0.00% 25 60 0.00% 26 71 0.00% 27 87 0.00% 28 79 0.00% 29 86 0.00% 30 106 0.00% 31 98 0.00% 32 106 0.00% 33 96 0.00% 34 130 0.00% 35 124 0.00% 36 149 0.00% 37 132 0.00% 38 124 0.00% 39 160 0.00% 40 157 0.00% 41 177 0.00% 42 184 0.00% 43 222 0.00% 44 220 0.00% 45 232 0.00% 46 237 0.00% 47 242 0.00% 48 274 0.00% 49 317 0.00% 50 333 0.00% 51 292 0.00% 52 351 0.00% 53 348 0.00% 54 380 0.00% 55 382 0.00% 56 404 0.00% 57 452 0.00% 58 478 0.00% 59 484 0.00% 60 480 0.00% 61 499 0.00% 62 610 0.00% 63 592 0.00% 64 637 0.00% 65 652 0.00% 66 697 0.00% 67 676 0.00% 68 743 0.00% 69 784 0.00% 70 912 0.00% 71 913 0.00% 72 926 0.00% 73 945 0.00% 74 1023 0.00% 75 1059 0.00% 76 1107 0.00% 77 1157 0.00% 78 1256 0.01% 79 1372 0.01% 80 1418 0.01% 81 1394 0.01% 82 1538 0.01% 83 1569 0.01% 84 1645 0.01% 85 1725 0.01% 86 1859 0.01% 87 1968 0.01% 88 1889 0.01% 89 1967 0.01% 90 2108 0.01% 91 2255 0.01% 92 2275 0.01% 93 2416 0.01% 94 2540 0.01% 95 2562 0.01% 96 2826 0.01% 97 2840 0.01% 98 2940 0.01% 99 3148 0.01% 100 3124 0.01% 101 3313 0.01% 102 3535 0.02% 103 3628 0.02% 104 3742 0.02% 105 4131 0.02% 106 4161 0.02% 107 4386 0.02% 108 4504 0.02% 109 4691 0.02% 110 4846 0.02% 111 4981 0.02% 112 5203 0.02% 113 5427 0.02% 114 5675 0.02% 115 5807 0.03% 116 6141 0.03% 117 6415 0.03% 118 6725 0.03% 119 6858 0.03% 120 7024 0.03% 121 7230 0.03% 122 7589 0.03% 123 7957 0.03% 124 8250 0.04% 125 8560 0.04% 126 9362 0.04% 127 9334 0.04% 128 9700 0.04% 129 10129 0.04% 130 10272 0.04% 131 10613 0.05% 132 9901 0.04% 133 10177 0.04% 134 10357 0.04% 135 10914 0.05% 136 10983 0.05% 137 11129 0.05% 138 11972 0.05% 139 12149 0.05% 140 12243 0.05% 141 12713 0.05% 142 13249 0.06% 143 13874 0.06% 144 14117 0.06% 145 14600 0.06% 146 16289 0.07% 147 21555 0.09% 148 50366 0.22% 149 485594 2.09% 150 22178407 95.63% 23191968 reads passed initial QC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=2.73 fanout-score-rank=25 prefix-density=0.25 prefix-fanout=2.5 sequence=GTTTTCTCATTTGCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=30.00 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=4.6 sequence=GAACAAAATTCGAATTCCAACGATCACATCAACTCTCGAAAGTACTAAAAGTCCGCGACATGTCTGCCCGCTGGTGAGTTATCTACTGACCTACAACCAAAATCTTGACCTCTTCGAGGCTCTTGAACACACCCTGCACATTGACCTTATTCGCACTGACATCCACCCTCAAGAACCTCCCTGGGTTAGCAGC criterion=sequence-density sequence-density=0.30 sequence-density-rank=1 fanout-score=3.59 fanout-score-rank=14 prefix-density=0.37 prefix-fanout=2.9 sequence=TGCAAGTGCGGCAGTG criterion=fanout-score sequence-density=0.13 sequence-density-rank=15 fanout-score=14.95 fanout-score-rank=1 prefix-density=0.28 prefix-fanout=6.9 sequence=AAGGCCAAGATCCAGGACAAGGA SRR14639628 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 14:52:19 Started mapping on | Feb 10 14:52:20 Finished on | Feb 10 15:06:59 Mapping speed, Million of reads per hour | 94.98 Number of input reads | 23191968 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 14800253 Uniquely mapped reads % | 63.82% Average mapped length | 296.10 Number of splices: Total | 12516162 Number of splices: Annotated (sjdb) | 12263888 Number of splices: GT/AG | 12312754 Number of splices: GC/AG | 151699 Number of splices: AT/AC | 11777 Number of splices: Non-canonical | 39932 Mismatch rate per base, % | 0.60% Deletion rate per base | 0.03% Deletion average length | 2.95 Insertion rate per base | 0.02% Insertion average length | 2.59 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 457896 % of reads mapped to multiple loci | 1.97% Number of reads mapped to too many loci | 30185 % of reads mapped to too many loci | 0.13% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 33.78% % of reads unmapped: other | 0.30% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 7933819 7933819 7933819 N_multimapping 457896 457896 457896 N_noFeature 424505 14675019 474665 N_ambiguous 181119 851 105692 UnstrandedReadsAssigned:14194629 PositiveStrandReadsAssigned:124383 NegativeStrandReadsAssigned:14219896 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR14639628 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR14639628-trimmed-pair1.fastq SRR14639628-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,191,968 reads, 15,433,104 reads pseudoaligned [quant] estimated average fragment length: 339.37 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,254 rounds 52401 SRR14639628.ke.tsv 34699 SRR14639628.se.tsv 87100 total ==> SRR14639628.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1679.63 3137 107.515 Potri.005G024800.1.v4.1 1035 696.63 560 46.2759 Potri.004G059700.1.v4.1 961 623.255 142 13.1157 Potri.007G009000.2.v4.1 1416 1077.63 0 0 Potri.003G141000.2.v4.1 2943 2604.63 726.641 16.0599 Potri.016G087400.1.v4.1 270 64.746 967 859.771 Potri.015G069301.1.v4.1 564 261.826 0 0 Potri.010G195200.1.v4.1 1773 1434.63 23 0.922906 Potri.012G127500.1.v4.1 977 638.991 1449 130.54 ==> SRR14639628.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 9 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 248 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 12 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 278 SRR14639628 completed mapping pipeline successfully