Starting /dee2/code/volunteer_pipeline.sh SRR14639629 current disk space = 3059129929728 free memory = 1018926628 SRR14639629 SRAfilesize 6104e8d8850dc1a802ec8372209494c3 SRR14639629.sra SRR14639629.sra file validated SRR14639629 is paired end SRR14639629 is conventional basespace SRR14639629 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14639629_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.63 32.0 32.0 32.0 32.0 32.0 2 31.47125 32.0 32.0 32.0 32.0 32.0 3 35.20125 37.0 32.0 37.0 32.0 37.0 4 36.005 37.0 37.0 37.0 32.0 37.0 5 36.1525 37.0 37.0 37.0 37.0 37.0 6 39.65175 41.0 41.0 41.0 37.0 41.0 7 39.7375 41.0 41.0 41.0 37.0 41.0 8 39.87325 41.0 41.0 41.0 37.0 41.0 9 39.94775 41.0 41.0 41.0 37.0 41.0 10-14 40.1121 41.0 41.0 41.0 37.0 41.0 15-19 40.09795 41.0 41.0 41.0 37.0 41.0 20-24 40.0745 41.0 41.0 41.0 37.0 41.0 25-29 40.056200000000004 41.0 41.0 41.0 37.0 41.0 30-34 39.99165 41.0 41.0 41.0 37.0 41.0 35-39 39.872699999999995 41.0 41.0 41.0 37.0 41.0 40-44 39.7561 41.0 41.0 41.0 37.0 41.0 45-49 39.819 41.0 41.0 41.0 37.0 41.0 50-54 39.67035 41.0 41.0 41.0 37.0 41.0 55-59 39.5984 41.0 41.0 41.0 37.0 41.0 60-64 39.5038 41.0 41.0 41.0 37.0 41.0 65-69 39.42425 41.0 41.0 41.0 37.0 41.0 70-74 39.213750000000005 41.0 41.0 41.0 37.0 41.0 75-79 38.259100000000004 41.0 39.4 41.0 32.0 41.0 80-84 38.728449999999995 41.0 41.0 41.0 33.0 41.0 85-89 38.736599999999996 41.0 41.0 41.0 32.0 41.0 90-94 38.6899 41.0 41.0 41.0 32.0 41.0 95-99 38.60195000000001 41.0 41.0 41.0 32.0 41.0 100-104 38.343450000000004 41.0 39.4 41.0 32.0 41.0 105-109 38.306200000000004 41.0 40.2 41.0 32.0 41.0 110-114 38.22025 41.0 39.4 41.0 32.0 41.0 115-119 38.1195 41.0 37.8 41.0 32.0 41.0 120-124 38.0007 41.0 37.0 41.0 32.0 41.0 125-129 37.850100000000005 41.0 37.0 41.0 30.0 41.0 130-134 37.5372 41.0 37.0 41.0 28.0 41.0 135-139 37.14434999999999 41.0 37.0 41.0 27.0 41.0 140-144 36.715050000000005 41.0 37.0 41.0 24.0 41.0 145-149 36.45645 41.0 37.0 41.0 22.0 41.0 150 36.144 41.0 37.0 41.0 22.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 4.0 22 1.0 23 5.0 24 9.0 25 10.0 26 28.0 27 43.0 28 29.0 29 33.0 30 36.0 31 36.0 32 69.0 33 67.0 34 78.0 35 116.0 36 138.0 37 209.0 38 338.0 39 683.0 40 2068.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.23555888972243 14.50362590647662 15.028757189297323 28.232058014503625 2 18.675 11.700000000000001 36.425000000000004 33.2 3 19.400000000000002 20.075000000000003 28.1 32.425 4 24.75 24.175 25.924999999999997 25.15 5 24.725 32.275 24.7 18.3 6 18.275 33.15 28.275 20.3 7 17.05 28.449999999999996 36.0 18.5 8 16.950000000000003 24.224999999999998 36.975 21.85 9 18.7 27.975 31.574999999999996 21.75 10-14 20.54 29.12 27.250000000000004 23.09 15-19 20.979999999999997 27.150000000000002 27.694999999999997 24.175 20-24 21.29 27.915 27.295 23.5 25-29 20.849999999999998 27.91 27.58 23.66 30-34 21.46 27.634999999999998 26.575 24.33 35-39 20.745 27.889999999999997 27.195000000000004 24.169999999999998 40-44 20.39 28.4 27.639999999999997 23.57 45-49 20.755000000000003 27.68 27.544999999999998 24.02 50-54 20.805 26.724999999999998 27.715 24.755 55-59 20.385 26.875 28.23 24.51 60-64 21.365000000000002 27.089999999999996 27.82 23.724999999999998 65-69 20.915 28.910000000000004 26.72 23.455000000000002 70-74 20.54 29.32 26.905 23.235 75-79 21.33 28.999999999999996 26.424999999999997 23.244999999999997 80-84 20.575 27.944999999999997 27.275 24.205 85-89 21.529999999999998 28.415000000000003 26.495 23.56 90-94 21.485000000000003 27.6 26.265 24.65 95-99 21.57 27.229999999999997 27.310000000000002 23.89 100-104 21.355 27.79 26.915 23.94 105-109 22.005 27.555000000000003 26.61 23.830000000000002 110-114 21.51 27.860000000000003 26.445 24.185000000000002 115-119 21.305 27.71 26.765 24.22 120-124 21.93 27.955000000000002 26.775 23.34 125-129 21.805 27.794999999999998 26.325 24.075 130-134 21.725 27.045 26.755000000000003 24.474999999999998 135-139 21.73 28.189999999999998 26.950000000000003 23.13 140-144 22.372237223722372 27.747774777477748 26.182618261826185 23.697369736973698 145-149 22.259999999999998 27.735 26.884999999999998 23.119999999999997 150 22.25 25.924999999999997 27.125 24.7 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 5.0 1 2.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 1.0 8 1.5 9 1.5 10 1.0 11 0.0 12 0.5 13 1.0 14 0.5 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.5 22 1.0 23 2.0 24 2.0 25 2.0 26 3.5 27 5.5 28 8.0 29 14.5 30 19.5 31 25.5 32 31.5 33 38.0 34 53.0 35 70.5 36 83.5 37 99.5 38 114.5 39 147.0 40 183.0 41 180.5 42 202.0 43 224.0 44 231.0 45 253.0 46 256.5 47 252.0 48 237.0 49 193.5 50 161.5 51 143.0 52 128.0 53 115.5 54 104.0 55 81.5 56 58.0 57 51.5 58 39.0 59 28.5 60 27.0 61 28.0 62 20.5 63 14.0 64 11.5 65 11.5 66 10.0 67 5.5 68 2.5 69 5.0 70 4.5 71 0.5 72 0.0 73 0.0 74 0.5 75 0.5 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.01 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.95 #Duplication Level Percentage of deduplicated Percentage of total 1 95.7690260777009 89.97500000000001 2 3.7253858435337945 7.000000000000001 3 0.37253858435337944 1.05 4 0.07982969664715274 0.3 5 0.026609898882384245 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.026609898882384245 1.55 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source ATCGGAAGAGCACACGTCTGAACTCCAGTCACAGCGATAGATCTCGTATG 62 1.55 TruSeq Adapter, Index 1 (97% over 35bp) TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.0875 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.225 0.0 0.0 0.0 0.0 94-95 0.25 0.0 0.0 0.0 0.0 96-97 0.25 0.0 0.0 0.0 0.0 98-99 0.275 0.0 0.0 0.0 0.0 100-101 0.2875 0.0 0.0 0.0 0.0 102-103 0.3 0.0 0.0 0.0 0.0 104-105 0.3 0.0 0.0 0.0 0.0 106-107 0.325 0.0 0.0 0.0 0.0 108-109 0.35 0.0 0.0 0.0 0.0 110-111 0.3625 0.0 0.0 0.0 0.0 112-113 0.3875 0.0 0.0 0.0 0.0 114-115 0.4125 0.0 0.0 0.0 0.0 116-117 0.425 0.0 0.0 0.0 0.0 118-119 0.425 0.0 0.0 0.0 0.0 120-121 0.4625 0.0 0.0 0.0 0.0 122-123 0.475 0.0 0.0 0.0 0.0 124-125 0.475 0.0 0.0 0.0 0.0 126-127 0.5625 0.0 0.0 0.0 0.0 128-129 0.6125 0.0 0.0 0.0 0.0 130-131 0.6625000000000001 0.0 0.0 0.0 0.0 132-133 0.725 0.0 0.0 0.0 0.0 134-135 0.8375 0.0 0.0 0.0 0.0 136-137 0.9125000000000001 0.0 0.0 0.0 0.0 138 0.975 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAAGAGC 10 0.006973645 144.0 5 GAGCACA 10 0.006973645 144.0 8 CGGAAGA 10 0.006973645 144.0 3 AGAGCAC 10 0.006973645 144.0 7 ATCGGAA 10 0.006973645 144.0 1 GGAAGAG 10 0.006973645 144.0 4 CAGATTT 10 0.006973645 144.0 2 CAGGTTT 10 0.006973645 144.0 4 AAAAAAA 125 3.479982E-5 11.5199995 65-69 >>END_MODULE SRR14639629 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14639629_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.3275 32.0 32.0 32.0 27.0 32.0 2 30.30875 32.0 32.0 32.0 27.0 32.0 3 33.2225 37.0 32.0 37.0 27.0 37.0 4 34.35125 37.0 37.0 37.0 32.0 37.0 5 34.48375 37.0 37.0 37.0 27.0 37.0 6 37.32625 41.0 37.0 41.0 27.0 41.0 7 37.34125 41.0 37.0 41.0 27.0 41.0 8 37.52925 41.0 37.0 41.0 27.0 41.0 9 37.63275 41.0 37.0 41.0 27.0 41.0 10-14 37.6569 41.0 37.0 41.0 27.0 41.0 15-19 37.3826 41.0 37.0 41.0 27.0 41.0 20-24 37.12435000000001 41.0 37.0 41.0 25.0 41.0 25-29 36.88035 41.0 37.0 41.0 25.0 41.0 30-34 36.83655 41.0 37.0 41.0 23.0 41.0 35-39 36.68955 41.0 37.0 41.0 22.0 41.0 40-44 36.44895 41.0 37.0 41.0 22.0 41.0 45-49 36.38875 41.0 37.0 41.0 22.0 41.0 50-54 36.24715 41.0 37.0 41.0 22.0 41.0 55-59 36.18900000000001 41.0 37.0 41.0 22.0 41.0 60-64 36.19715 41.0 37.0 41.0 22.0 41.0 65-69 35.822700000000005 41.0 35.0 41.0 22.0 41.0 70-74 35.6293 41.0 34.0 41.0 20.0 41.0 75-79 34.8854 40.2 31.0 41.0 22.0 41.0 80-84 35.5646 41.0 32.0 41.0 22.0 41.0 85-89 35.5176 41.0 33.0 41.0 16.0 41.0 90-94 35.19924999999999 41.0 32.0 41.0 14.0 41.0 95-99 35.28255 41.0 32.0 41.0 14.0 41.0 100-104 35.08815 41.0 32.0 41.0 12.0 41.0 105-109 35.117900000000006 41.0 32.0 41.0 14.0 41.0 110-114 35.00855 41.0 32.0 41.0 12.0 41.0 115-119 34.63545 41.0 32.0 41.0 12.0 41.0 120-124 34.6318 41.0 32.0 41.0 12.0 41.0 125-129 34.0939 40.2 31.0 41.0 12.0 41.0 130-134 34.0776 41.0 32.0 41.0 12.0 41.0 135-139 33.5702 37.8 28.0 41.0 12.0 41.0 140-144 33.26925 37.0 27.0 41.0 12.0 41.0 145-149 32.9801 37.0 26.0 41.0 12.0 41.0 150 32.4945 37.0 27.0 41.0 12.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 4.0 15 8.0 16 26.0 17 36.0 18 51.0 19 28.0 20 38.0 21 42.0 22 55.0 23 46.0 24 55.0 25 58.0 26 60.0 27 67.0 28 115.0 29 101.0 30 93.0 31 89.0 32 108.0 33 108.0 34 136.0 35 171.0 36 180.0 37 212.0 38 315.0 39 504.0 40 1294.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.5250501002004 26.62825651302605 12.850701402805612 22.995991983967937 2 18.275 25.5 36.175000000000004 20.05 3 18.425 25.275 33.425 22.875 4 24.05 31.974999999999998 21.775 22.2 5 22.900000000000002 38.5 21.7 16.900000000000002 6 17.224999999999998 36.25 25.674999999999997 20.849999999999998 7 20.349999999999998 23.7 32.85 23.1 8 18.2 24.025 31.5 26.275 9 19.7 26.674999999999997 29.575000000000003 24.05 10-14 22.48 27.51 26.495 23.515 15-19 23.34 26.884999999999998 27.13 22.645 20-24 22.685 28.37 26.455000000000002 22.49 25-29 23.025000000000002 28.645 26.36 21.97 30-34 22.5 27.544999999999998 27.045 22.91 35-39 23.06 26.25 27.084999999999997 23.605 40-44 22.795 27.725 26.825 22.655 45-49 22.765 26.845000000000002 27.46 22.93 50-54 23.22 27.095000000000002 26.834999999999997 22.85 55-59 23.615 26.445 26.865 23.075000000000003 60-64 22.97 27.205000000000002 27.155 22.67 65-69 22.41 27.315 27.71 22.564999999999998 70-74 22.48 28.395 26.279999999999998 22.845 75-79 23.25 28.15 26.365 22.235 80-84 22.805 28.4 26.02 22.775000000000002 85-89 23.345 28.325 25.590000000000003 22.74 90-94 22.88 28.22 25.985000000000003 22.915 95-99 22.825 27.49 26.505000000000003 23.18 100-104 23.13 28.51 25.935000000000002 22.425 105-109 23.075000000000003 28.144999999999996 26.040000000000003 22.74 110-114 22.814999999999998 28.525 25.874999999999996 22.785 115-119 23.735 27.625 25.21 23.43 120-124 23.01 27.57 26.179999999999996 23.24 125-129 22.93 27.944999999999997 25.97 23.155 130-134 24.125 27.884999999999998 25.8 22.189999999999998 135-139 23.75 27.36 25.575 23.315 140-144 24.02 27.435 25.419999999999998 23.125 145-149 23.28 27.96 25.924999999999997 22.835 150 22.55 27.200000000000003 27.325 22.925 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.5 21 1.0 22 0.5 23 0.0 24 0.0 25 0.5 26 4.5 27 7.0 28 6.5 29 11.0 30 18.0 31 23.0 32 25.0 33 31.0 34 44.5 35 53.0 36 69.5 37 107.5 38 124.0 39 144.5 40 186.5 41 208.0 42 208.5 43 220.0 44 228.5 45 223.0 46 234.0 47 228.0 48 210.0 49 195.0 50 186.5 51 167.5 52 132.0 53 111.5 54 105.0 55 90.0 56 75.5 57 59.0 58 44.5 59 46.5 60 34.0 61 26.0 62 22.5 63 20.0 64 18.0 65 10.5 66 8.5 67 7.5 68 5.5 69 3.0 70 2.0 71 1.0 72 2.0 73 2.5 74 1.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.2 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.075 #Duplication Level Percentage of deduplicated Percentage of total 1 96.87089140152511 92.10000000000001 2 2.7609781751249014 5.25 3 0.3155403628714173 0.8999999999999999 4 0.026295030239284777 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.026295030239284777 1.6500000000000001 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source ATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTTCAGAGCCGTGTAGATCTC 66 1.6500000000000001 Illumina Single End PCR Primer 1 (96% over 31bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.1375 0.0 0.0 0.0 0.0 94-95 0.175 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.175 0.0 0.0 0.0 0.0 100-101 0.1875 0.0 0.0 0.0 0.0 102-103 0.2 0.0 0.0 0.0 0.0 104-105 0.225 0.0 0.0 0.0 0.0 106-107 0.25 0.0 0.0 0.0 0.0 108-109 0.275 0.0 0.0 0.0 0.0 110-111 0.275 0.0 0.0 0.0 0.0 112-113 0.2875 0.0 0.0 0.0 0.0 114-115 0.3125 0.0 0.0 0.0 0.0 116-117 0.325 0.0 0.0 0.0 0.0 118-119 0.325 0.0 0.0 0.0 0.0 120-121 0.3375 0.0 0.0 0.0 0.0 122-123 0.35 0.0 0.0 0.0 0.0 124-125 0.35 0.0 0.0 0.0 0.0 126-127 0.4125 0.0 0.0 0.0 0.0 128-129 0.4375 0.0 0.0 0.0 0.0 130-131 0.475 0.0 0.0 0.0 0.0 132-133 0.525 0.0 0.0 0.0 0.0 134-135 0.6 0.0 0.0 0.0 0.0 136-137 0.6375 0.0 0.0 0.0 0.0 138 0.675 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAGCGTC 10 0.006973645 144.0 8 AAGAGCG 10 0.006973645 144.0 6 TCGGAAG 10 0.006973645 144.0 2 CGGAAGA 10 0.006973645 144.0 3 AGAGCGT 10 0.006973645 144.0 7 ATCGGAA 10 0.006973645 144.0 1 GGAAGAG 10 0.006973645 144.0 4 AGCGTCG 10 0.006973645 144.0 9 >>END_MODULE Read 1012551 spots for SRR14639629.sra Written 1012551 spots for SRR14639629.sra Read 1012551 spots for SRR14639629.sra Written 1012551 spots for SRR14639629.sra Read 1012551 spots for SRR14639629.sra Written 1012551 spots for SRR14639629.sra Read 1012551 spots for SRR14639629.sra Written 1012551 spots for SRR14639629.sra Read 1012551 spots for SRR14639629.sra Written 1012551 spots for SRR14639629.sra Read 1012551 spots for SRR14639629.sra Written 1012551 spots for SRR14639629.sra Read 1012551 spots for SRR14639629.sra Written 1012551 spots for SRR14639629.sra Read 1012551 spots for SRR14639629.sra Written 1012551 spots for SRR14639629.sra Read 1012551 spots for SRR14639629.sra Written 1012551 spots for SRR14639629.sra Read 1012551 spots for SRR14639629.sra Written 1012551 spots for SRR14639629.sra Read 1012551 spots for SRR14639629.sra Written 1012551 spots for SRR14639629.sra Read 1012551 spots for SRR14639629.sra Written 1012551 spots for SRR14639629.sra Read 1012551 spots for SRR14639629.sra Written 1012551 spots for SRR14639629.sra Read 1012551 spots for SRR14639629.sra Written 1012551 spots for SRR14639629.sra Read 1012551 spots for SRR14639629.sra Written 1012551 spots for SRR14639629.sra Read 1012551 spots for SRR14639629.sra Written 1012551 spots for SRR14639629.sra Read 1012551 spots for SRR14639629.sra Written 1012551 spots for SRR14639629.sra Read 1012569 spots for SRR14639629.sra Written 1012569 spots for SRR14639629.sra Read 1012551 spots for SRR14639629.sra Written 1012551 spots for SRR14639629.sra Read 1012551 spots for SRR14639629.sra Written 1012551 spots for SRR14639629.sra SRR ids: ['SRR14639629.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_p3rff_je SRR14639629.sra spots: 20251038 blocks: [[1, 1012551], [1012552, 2025102], [2025103, 3037653], [3037654, 4050204], [4050205, 5062755], [5062756, 6075306], [6075307, 7087857], [7087858, 8100408], [8100409, 9112959], [9112960, 10125510], [10125511, 11138061], [11138062, 12150612], [12150613, 13163163], [13163164, 14175714], [14175715, 15188265], [15188266, 16200816], [16200817, 17213367], [17213368, 18225918], [18225919, 19238469], [19238470, 20251038]] SRR14639629 file size 7495013 SRR14639629 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR14639629 SRR14639629_1.fastq SRR14639629_2.fastq Input file: SRR14639629_1.fastq Paired file: SRR14639629_2.fastq trimmed: SRR14639629-trimmed-pair1.fastq, SRR14639629-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 15:19:09 2025 >> started Mon Feb 10 15:19:45 2025 >> done (35.548s) 20251038 read pairs processed; of these: 179 ( 0.00%) short read pairs filtered out after trimming by size control 4332 ( 0.02%) empty read pairs filtered out after trimming by size control 20246527 (99.98%) read pairs available; of these: 891474 ( 4.40%) trimmed read pairs available after processing 19355053 (95.60%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 21 0.00% 19 22 0.00% 20 25 0.00% 21 33 0.00% 22 37 0.00% 23 35 0.00% 24 44 0.00% 25 44 0.00% 26 58 0.00% 27 80 0.00% 28 74 0.00% 29 70 0.00% 30 81 0.00% 31 85 0.00% 32 69 0.00% 33 120 0.00% 34 106 0.00% 35 113 0.00% 36 144 0.00% 37 126 0.00% 38 184 0.00% 39 181 0.00% 40 184 0.00% 41 196 0.00% 42 195 0.00% 43 247 0.00% 44 210 0.00% 45 248 0.00% 46 292 0.00% 47 293 0.00% 48 362 0.00% 49 389 0.00% 50 381 0.00% 51 392 0.00% 52 441 0.00% 53 445 0.00% 54 469 0.00% 55 476 0.00% 56 536 0.00% 57 523 0.00% 58 617 0.00% 59 642 0.00% 60 637 0.00% 61 672 0.00% 62 766 0.00% 63 806 0.00% 64 760 0.00% 65 812 0.00% 66 831 0.00% 67 896 0.00% 68 939 0.00% 69 999 0.00% 70 1065 0.01% 71 1072 0.01% 72 1111 0.01% 73 1210 0.01% 74 1178 0.01% 75 1279 0.01% 76 1294 0.01% 77 1369 0.01% 78 1417 0.01% 79 1532 0.01% 80 1638 0.01% 81 1624 0.01% 82 1720 0.01% 83 1756 0.01% 84 1908 0.01% 85 1959 0.01% 86 1938 0.01% 87 2018 0.01% 88 1985 0.01% 89 2112 0.01% 90 2298 0.01% 91 2249 0.01% 92 2289 0.01% 93 2476 0.01% 94 2586 0.01% 95 2695 0.01% 96 2581 0.01% 97 2814 0.01% 98 2775 0.01% 99 3038 0.02% 100 3091 0.02% 101 3067 0.02% 102 3309 0.02% 103 3398 0.02% 104 3461 0.02% 105 3738 0.02% 106 3814 0.02% 107 3889 0.02% 108 3950 0.02% 109 4070 0.02% 110 4197 0.02% 111 4488 0.02% 112 4567 0.02% 113 4563 0.02% 114 4887 0.02% 115 4935 0.02% 116 5138 0.03% 117 5628 0.03% 118 5695 0.03% 119 5696 0.03% 120 5981 0.03% 121 6165 0.03% 122 6191 0.03% 123 6431 0.03% 124 6716 0.03% 125 6891 0.03% 126 7354 0.04% 127 7534 0.04% 128 7493 0.04% 129 7771 0.04% 130 8253 0.04% 131 8322 0.04% 132 7763 0.04% 133 8064 0.04% 134 7927 0.04% 135 8230 0.04% 136 8206 0.04% 137 8511 0.04% 138 8691 0.04% 139 9031 0.04% 140 9212 0.05% 141 9267 0.05% 142 9679 0.05% 143 9946 0.05% 144 10181 0.05% 145 10784 0.05% 146 11803 0.06% 147 17420 0.09% 148 45253 0.22% 149 446429 2.20% 150 19355053 95.60% 20246527 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=28 prefix-density=0.22 prefix-fanout=2.0 sequence=GTTGGAGCCATGC criterion=fanout-score sequence-density=0.09 sequence-density-rank=17 fanout-score=17.00 fanout-score-rank=1 prefix-density=0.22 prefix-fanout=7.2 sequence=ATCAACCTCTGCTGGTCTGG criterion=sequence-density sequence-density=0.33 sequence-density-rank=1 fanout-score=4.23 fanout-score-rank=12 prefix-density=0.43 prefix-fanout=3.2 sequence=CTGCAAATGTGG criterion=fanout-score sequence-density=0.04 sequence-density-rank=30 fanout-score=19.69 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=5.7 sequence=CTTCAACTTGTTCTGTTAATCTCTATTATACAATTCAGCTCAGCAGCAAGGACATTCTCCGTGTCAGATCAAAGCCAAGATCC SRR14639629 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 15:21:06 Started mapping on | Feb 10 15:21:06 Finished on | Feb 10 15:33:05 Mapping speed, Million of reads per hour | 101.37 Number of input reads | 20246527 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 13152996 Uniquely mapped reads % | 64.96% Average mapped length | 295.95 Number of splices: Total | 11142654 Number of splices: Annotated (sjdb) | 10941982 Number of splices: GT/AG | 10962710 Number of splices: GC/AG | 135402 Number of splices: AT/AC | 10113 Number of splices: Non-canonical | 34429 Mismatch rate per base, % | 0.60% Deletion rate per base | 0.03% Deletion average length | 2.95 Insertion rate per base | 0.02% Insertion average length | 2.61 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 409835 % of reads mapped to multiple loci | 2.02% Number of reads mapped to too many loci | 83793 % of reads mapped to too many loci | 0.41% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 32.23% % of reads unmapped: other | 0.37% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 6683696 6683696 6683696 N_multimapping 409835 409835 409835 N_noFeature 313855 13046580 357827 N_ambiguous 153686 831 90768 UnstrandedReadsAssigned:12685455 PositiveStrandReadsAssigned:105585 NegativeStrandReadsAssigned:12704401 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR14639629 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR14639629-trimmed-pair1.fastq SRR14639629-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,246,527 reads, 13,948,691 reads pseudoaligned [quant] estimated average fragment length: 345.37 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,039 rounds 52401 SRR14639629.ke.tsv 34699 SRR14639629.se.tsv 87100 total ==> SRR14639629.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1673.63 2742 109.474 Potri.005G024800.1.v4.1 1035 690.63 283 27.3808 Potri.004G059700.1.v4.1 961 617.308 107 11.5821 Potri.007G009000.2.v4.1 1416 1071.63 0 0 Potri.003G141000.2.v4.1 2943 2598.63 737 18.9508 Potri.016G087400.1.v4.1 270 63.9057 782 817.658 Potri.015G069301.1.v4.1 564 256.101 0 0 Potri.010G195200.1.v4.1 1773 1428.63 33 1.54347 Potri.012G127500.1.v4.1 977 633.02 1700 179.447 ==> SRR14639629.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 41 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 170 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 3 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 209 SRR14639629 completed mapping pipeline successfully