Starting /dee2/code/volunteer_pipeline.sh SRR15142080 current disk space = 3085435011072 free memory = 1579050776 SRR15142080 SRAfilesize 17d3c9b56b0f7d98488e610c07e77d98 SRR15142080.sra SRR15142080.sra file validated SRR15142080 is paired end SRR15142080 is conventional basespace SRR15142080 read1 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR15142080_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 36 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.64175 32.0 32.0 32.0 32.0 32.0 2 30.947 32.0 32.0 32.0 32.0 32.0 3 30.95325 32.0 32.0 32.0 32.0 32.0 4 31.07975 32.0 32.0 32.0 32.0 32.0 5 31.136 32.0 32.0 32.0 32.0 32.0 6 34.714 36.0 36.0 36.0 36.0 36.0 7 34.6855 36.0 36.0 36.0 36.0 36.0 8 34.6895 36.0 36.0 36.0 36.0 36.0 9 34.74675 36.0 36.0 36.0 36.0 36.0 10-11 34.64825 36.0 36.0 36.0 36.0 36.0 12-13 34.749625 36.0 36.0 36.0 36.0 36.0 14-15 34.740625 36.0 36.0 36.0 36.0 36.0 16-17 34.705 36.0 36.0 36.0 36.0 36.0 18-19 34.695125000000004 36.0 36.0 36.0 36.0 36.0 20-21 34.635125 36.0 36.0 36.0 36.0 36.0 22-23 34.705625 36.0 36.0 36.0 36.0 36.0 24-25 34.624375 36.0 36.0 36.0 36.0 36.0 26-27 34.466 36.0 36.0 36.0 36.0 36.0 28-29 34.5275 36.0 36.0 36.0 36.0 36.0 30-31 34.397125 36.0 36.0 36.0 34.0 36.0 32-33 34.4995 36.0 36.0 36.0 36.0 36.0 34-35 34.489374999999995 36.0 36.0 36.0 36.0 36.0 36-37 35.00800711743773 36.0 36.0 36.0 36.0 36.0 38-39 34.86387900355872 36.0 36.0 36.0 36.0 36.0 40-41 34.8403660396543 36.0 36.0 36.0 36.0 36.0 42-43 34.79918657854601 36.0 36.0 36.0 36.0 36.0 44-45 34.80167810831426 36.0 36.0 36.0 36.0 36.0 46-47 34.73391812865498 36.0 36.0 36.0 34.0 36.0 48-49 34.75801119023397 36.0 36.0 36.0 36.0 36.0 50-51 34.775432349949135 36.0 36.0 36.0 34.0 36.0 52-53 34.657171922685656 36.0 36.0 36.0 34.0 36.0 54-55 34.563708036622586 36.0 36.0 36.0 32.0 36.0 56-57 34.59946578478758 36.0 36.0 36.0 32.0 36.0 58-59 34.473918575063614 36.0 36.0 36.0 32.0 36.0 60-61 34.404253942595574 36.0 36.0 36.0 32.0 36.0 62-63 34.362596474385725 36.0 36.0 36.0 32.0 36.0 64-65 34.39024700789407 36.0 36.0 36.0 32.0 36.0 66-67 34.3942197857822 36.0 36.0 36.0 32.0 36.0 68-69 34.26605504587156 36.0 36.0 36.0 32.0 36.0 70-71 34.264877805195184 36.0 36.0 36.0 32.0 36.0 72-73 34.28997597636196 36.0 36.0 36.0 32.0 36.0 74-75 34.07928682537293 36.0 36.0 36.0 32.0 36.0 76 33.76635514018692 36.0 36.0 36.0 27.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 66.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 0.0 21 1.0 22 3.0 23 7.0 24 13.0 25 10.0 26 24.0 27 35.0 28 39.0 29 63.0 30 68.0 31 86.0 32 136.0 33 235.0 34 562.0 35 2651.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.63057324840764 12.050955414012739 17.070063694267514 37.248407643312106 2 27.605490594814437 16.115912557193695 36.88357905439756 19.395017793594306 3 23.919674631418403 26.080325368581597 25.063548551093035 24.936451448906965 4 26.51245551601423 32.028469750889684 22.902897813929844 18.55617691916624 5 25.34316217590239 34.67208947635994 25.9023894255211 14.082358922216573 6 19.80172852058973 37.26487036095577 28.596847991865786 14.336553126588713 7 14.158617183528216 27.503812913065584 46.009150991357394 12.328418912048805 8 17.691916624300966 26.461616675139805 37.163192679206915 18.683274021352315 9 19.191662430096592 24.097610574478903 38.02745297407219 18.683274021352315 10-11 18.44178952719878 39.794102694458566 27.51652262328419 14.247585155058465 12-13 20.691408235892222 30.261820030503305 32.689374682257245 16.35739705134723 14-15 18.645144890696493 31.354855109303507 33.76970005083884 16.230299949161157 16-17 19.267920691408236 33.1596339603457 30.020335536349773 17.552109811896287 18-19 19.42043721403152 33.12150482968988 30.40162684290798 17.056431113370614 20-21 19.33146924250127 32.663955261820036 30.9862735129639 17.018301982714796 22-23 19.53482460599898 32.308083375699034 30.935434672089478 17.221657346212506 24-25 18.784951703101168 33.6934417895272 30.732079308591764 16.78952719877987 26-27 19.140823589222165 33.464667005592275 30.922724961870866 16.471784443314693 28-29 19.522114895780376 32.54956786985257 30.998983223182513 16.929334011184544 30-31 18.645144890696493 32.155566853075754 31.469242501270973 17.730045754956787 32-33 18.772241992882563 32.91814946619217 31.164209456024405 17.145399084900863 34-35 18.74682257244535 33.3248601931876 30.617691916624302 17.310625317742755 36-37 18.69598373157092 32.28266395526182 31.469242501270973 17.552109811896287 38-39 19.29334011184545 32.75292323335028 31.278596847991864 16.675139806812407 40-41 19.191662430096592 33.68073207930859 30.338078291814945 16.78952719877987 42-43 19.153533299440774 32.981698017285204 30.681240467717334 17.183528215556684 44-45 18.67531146707348 32.16374269005848 32.06203915586067 17.09890668700737 46-47 19.425375031782355 31.97304856343758 31.57894736842105 17.022629036359014 48-49 18.819938962360123 33.08748728382503 31.345371312309254 16.747202441505596 50-51 18.908952187182095 32.044760935910475 31.637843336724313 17.408443540183114 52-53 18.591047812817905 33.11291963377416 31.345371312309254 16.95066124109868 54-55 18.972533062054932 33.023906408952186 31.243641912512714 16.759918616480164 56-57 19.01551767997965 32.70160264563724 31.493258712795726 16.78962096158738 58-59 18.676844783715012 33.078880407124686 31.246819338422394 16.99745547073791 60-61 18.45018450184502 33.19760783814735 30.89451584171014 17.457691818297494 62-63 18.747613592974417 33.28242331678758 30.915107547409953 17.05485554282805 64-65 18.869365928189456 33.24420677361854 30.417621594092182 17.46880570409982 66-67 18.851101770475097 34.072092727041145 30.098076678130177 16.97872882435359 68-69 18.74362895005097 33.218654434250766 31.090723751274208 16.946992864424058 70-71 18.54684512428298 33.39706819630337 30.73295092415551 17.323135755258125 72-73 18.057332992065522 34.00307141028922 30.77809060660353 17.16150499104172 74-75 17.434788484930397 31.477226652250305 32.96391404243817 18.12407082038113 76 21.197960917587086 0.0 50.89209855564996 27.909940526762956 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 66.0 1 33.0 2 1.0 3 1.5 4 1.0 5 0.5 6 0.0 7 1.0 8 2.0 9 2.0 10 2.5 11 4.0 12 4.5 13 7.0 14 10.0 15 13.0 16 19.0 17 21.0 18 22.5 19 32.5 20 39.5 21 42.5 22 48.0 23 59.0 24 73.5 25 77.5 26 84.5 27 107.0 28 124.0 29 144.5 30 171.5 31 189.0 32 201.5 33 209.0 34 234.0 35 248.0 36 256.0 37 267.5 38 264.0 39 250.5 40 239.5 41 234.0 42 215.0 43 193.5 44 165.5 45 144.0 46 137.0 47 111.5 48 83.5 49 77.5 50 69.0 51 60.0 52 50.5 53 39.5 54 30.5 55 23.5 56 22.0 57 14.5 58 6.5 59 7.0 60 6.0 61 2.5 62 1.0 63 2.0 64 2.0 65 1.5 66 1.5 67 1.0 68 1.0 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.875 2 1.6500000000000001 3 1.6500000000000001 4 1.6500000000000001 5 1.6500000000000001 6 1.6500000000000001 7 1.6500000000000001 8 1.6500000000000001 9 1.6500000000000001 10-11 1.6500000000000001 12-13 1.6500000000000001 14-15 1.6500000000000001 16-17 1.6500000000000001 18-19 1.6500000000000001 20-21 1.6500000000000001 22-23 1.6500000000000001 24-25 1.6500000000000001 26-27 1.6500000000000001 28-29 1.6500000000000001 30-31 1.6500000000000001 32-33 1.6500000000000001 34-35 1.6500000000000001 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 66.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 1.0 44 0.0 45 0.0 46 0.0 47 1.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 1.0 56 0.0 57 1.0 58 0.0 59 0.0 60 1.0 61 0.0 62 1.0 63 1.0 64 0.0 65 1.0 66 1.0 67 1.0 68 0.0 69 1.0 70 1.0 71 5.0 72 20.0 73 75.0 74 245.0 75 1223.0 76 2354.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.175 #Duplication Level Percentage of deduplicated Percentage of total 1 99.8217468805704 98.0 2 0.10185892538833714 0.2 3 0.05092946269416857 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.025464731347084286 1.6500000000000001 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 66 1.6500000000000001 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR15142080 read2 length is 43-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR15142080_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 43-76 %GC 36 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.977 32.0 32.0 32.0 32.0 32.0 2 31.266 32.0 32.0 32.0 32.0 32.0 3 31.27975 32.0 32.0 32.0 32.0 32.0 4 31.34875 32.0 32.0 32.0 32.0 32.0 5 31.35225 32.0 32.0 32.0 32.0 32.0 6 34.939 36.0 36.0 36.0 36.0 36.0 7 35.042 36.0 36.0 36.0 36.0 36.0 8 34.94025 36.0 36.0 36.0 36.0 36.0 9 34.8035 36.0 36.0 36.0 36.0 36.0 10-11 34.705625 36.0 36.0 36.0 36.0 36.0 12-13 34.843375 36.0 36.0 36.0 36.0 36.0 14-15 34.827124999999995 36.0 36.0 36.0 36.0 36.0 16-17 34.8435 36.0 36.0 36.0 36.0 36.0 18-19 34.840374999999995 36.0 36.0 36.0 36.0 36.0 20-21 34.5225 36.0 36.0 36.0 34.0 36.0 22-23 34.318 36.0 36.0 36.0 32.0 36.0 24-25 33.746750000000006 36.0 36.0 36.0 26.5 36.0 26-27 33.384 36.0 36.0 36.0 21.0 36.0 28-29 32.987 36.0 36.0 36.0 14.0 36.0 30-31 33.049125000000004 36.0 36.0 36.0 14.0 36.0 32-33 32.973625 36.0 36.0 36.0 14.0 36.0 34-35 32.762874999999994 36.0 36.0 36.0 14.0 36.0 36-37 32.641000000000005 36.0 36.0 36.0 14.0 36.0 38-39 32.610125 36.0 36.0 36.0 14.0 36.0 40-41 32.755875 36.0 36.0 36.0 14.0 36.0 42-43 32.52775 36.0 36.0 36.0 14.0 36.0 44-45 32.74731182795699 36.0 36.0 36.0 14.0 36.0 46-47 32.6946736684171 36.0 36.0 36.0 14.0 36.0 48-49 32.632316158079036 36.0 36.0 36.0 14.0 36.0 50-51 32.36930965482741 36.0 32.0 36.0 14.0 36.0 52-53 32.328664332166085 36.0 34.0 36.0 14.0 36.0 54-55 32.48236618309154 36.0 36.0 36.0 14.0 36.0 56-57 32.34425819364523 36.0 34.0 36.0 14.0 36.0 58-59 32.25012512512512 36.0 34.0 36.0 14.0 36.0 60-61 32.17458785443766 36.0 34.0 36.0 14.0 36.0 62-63 32.022509922580994 36.0 32.0 36.0 14.0 36.0 64-65 31.90295517155021 36.0 32.0 36.0 14.0 36.0 66-67 31.871997157682944 36.0 32.0 36.0 14.0 36.0 68-69 32.110401002506265 36.0 32.0 36.0 14.0 36.0 70-71 31.83764394839067 36.0 32.0 36.0 14.0 36.0 72-73 31.91360367523521 36.0 32.0 36.0 14.0 36.0 74-75 31.98002841757775 36.0 32.0 36.0 14.0 36.0 76 31.14163756305782 36.0 32.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 0.0 13 0.0 14 0.0 15 2.0 16 0.0 17 2.0 18 4.0 19 8.0 20 9.0 21 23.0 22 48.0 23 58.0 24 88.0 25 100.0 26 115.0 27 108.0 28 95.0 29 84.0 30 95.0 31 101.0 32 162.0 33 330.0 34 970.0 35 1597.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.651595076613916 18.462697814619442 24.08942476764632 30.796282341120325 2 17.925 25.2 44.1 12.775 3 16.175 26.625 41.625 15.575 4 22.825 32.1 31.3 13.775 5 20.75 34.150000000000006 33.625 11.475 6 15.049999999999999 35.5 35.775 13.675 7 12.425 16.05 56.275 15.25 8 16.375 20.525 42.675000000000004 20.424999999999997 9 17.375 21.925 41.725 18.975 10-11 17.8875 31.7125 36.1375 14.2625 12-13 16.725 23.525 43.262499999999996 16.4875 14-15 15.437500000000002 25.9875 45.050000000000004 13.525 16-17 15.65195649456182 25.765720715089387 43.53044130516315 15.051881485185648 18-19 15.962499999999999 26.3 42.5 15.2375 20-21 17.1 27.1625 41.3875 14.35 22-23 16.841710427606902 28.244561140285075 39.28482120530133 15.628907226806701 24-25 17.35433858464616 29.744936234058517 37.92198049512378 14.978744686171543 26-27 18.144304114042768 30.186319869951234 36.11354257846692 15.555833437539077 28-29 18.042010502625658 30.045011252813204 35.93398349587397 15.978994748687173 30-31 18.614826853356668 30.37879734966871 34.766845855731965 16.239529941242655 32-33 18.55695885957234 31.5368263098662 33.60010003751407 16.306114793047392 34-35 19.634817408704354 30.552776388194097 33.54177088544272 16.27063531765883 36-37 19.237023139462163 30.98186366479049 32.445278298936834 17.335834896810507 38-39 18.321660830415208 30.340170085042523 34.079539769884946 17.258629314657327 40-41 18.552319039879986 31.028878609826226 33.066633329166145 17.352169021127644 42-43 18.336460287679802 31.06941838649156 33.295809881175735 17.29831144465291 44-45 18.693693693693696 31.093593593593592 33.233233233233236 16.97947947947948 46-47 19.84236206680846 30.902039284373828 32.27824346303015 16.977355185787566 48-49 20.435489926166937 29.533224877987735 32.89951195094481 17.131773244900515 50-51 21.133633633633632 28.415915915915917 33.1956956956957 17.254754754754757 52-53 21.796796796796798 28.290790790790794 33.7962962962963 16.116116116116117 54-55 22.23056702966579 27.80072599824759 33.145575165853046 16.823131806233572 56-57 21.717361371886344 29.465515083239453 31.968957316309925 16.848166228564278 58-59 21.45272385723231 28.10269254852849 32.42329367564183 18.02128991859737 60-61 22.081663326653306 27.47995991983968 32.23947895791583 18.198897795591183 62-63 22.515975441673973 29.3071043728856 31.011151484776345 17.165768700664078 64-65 23.007518796992482 29.348370927318296 30.739348370927317 16.904761904761905 66-67 21.343526757739063 29.402180724401557 31.733299912269707 17.520992605589672 68-69 21.758214196137445 28.630549285176826 33.195385001254074 16.415851517431655 70-71 22.487137658426402 28.987325887815285 30.982557409963608 17.542979043794706 72-73 21.63455484195945 28.850270746757335 32.50220375267598 17.01297065860723 74-75 20.646864686468646 27.603960396039607 33.17491749174917 18.574257425742573 76 25.72759022118743 0.0 47.72991850989523 26.542491268917345 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.5 3 1.0 4 1.0 5 0.5 6 1.0 7 2.0 8 2.0 9 3.0 10 4.0 11 7.5 12 11.0 13 10.0 14 12.0 15 17.0 16 21.0 17 23.0 18 34.5 19 49.5 20 51.0 21 53.0 22 60.0 23 75.0 24 89.0 25 102.0 26 126.5 27 148.5 28 162.0 29 185.5 30 210.5 31 231.5 32 249.5 33 240.5 34 235.5 35 252.0 36 266.0 37 267.5 38 255.5 39 222.5 40 196.5 41 173.0 42 152.5 43 149.5 44 124.0 45 98.0 46 88.5 47 81.0 48 71.0 49 55.5 50 47.5 51 48.5 52 40.5 53 26.0 54 18.5 55 18.0 56 18.5 57 15.0 58 12.5 59 12.0 60 12.0 61 8.0 62 3.5 63 3.0 64 2.0 65 1.5 66 0.5 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.5 90 1.0 91 1.5 92 2.0 93 1.5 94 2.0 95 3.0 96 3.0 97 4.5 98 12.0 99 19.0 100 20.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.475 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0125 18-19 0.0 20-21 0.0 22-23 0.025 24-25 0.025 26-27 0.0375 28-29 0.025 30-31 0.0125 32-33 0.0375 34-35 0.05 36-37 0.0625 38-39 0.05 40-41 0.0125 42-43 0.0625 44-45 0.07501875468867217 46-47 0.06251562890722681 48-49 0.06253126563281641 50-51 0.05002501250625312 52-53 0.05002501250625312 54-55 0.08754377188594298 56-57 0.06254691018263697 58-59 0.08758758758758758 60-61 0.08759854836691278 62-63 0.10013768932281887 64-65 0.07513148009015778 66-67 0.05010647626205687 68-69 0.07518796992481204 70-71 0.10028832894571893 72-73 0.10064159013712416 74-75 0.11867088607594937 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 43 1.0 44 0.0 45 0.0 46 0.0 47 1.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 1.0 56 0.0 57 1.0 58 0.0 59 0.0 60 1.0 61 0.0 62 1.0 63 1.0 64 0.0 65 1.0 66 1.0 67 1.0 68 0.0 69 1.0 70 1.0 71 3.0 72 21.0 73 62.0 74 220.0 75 1105.0 76 2577.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.175 #Duplication Level Percentage of deduplicated Percentage of total 1 99.848752205697 99.02499999999999 2 0.07562389715149988 0.15 3 0.0 0.0 4 0.025207965717166627 0.1 5 0.0 0.0 6 0.0 0.0 7 0.025207965717166627 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.025207965717166627 0.5499999999999999 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 22 0.5499999999999999 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGTGGGGGGGGGGGGGG 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 386712 spots for SRR15142080.sra Written 386712 spots for SRR15142080.sra Read 386712 spots for SRR15142080.sra Written 386712 spots for SRR15142080.sra Read 386712 spots for SRR15142080.sra Written 386712 spots for SRR15142080.sra Read 386712 spots for SRR15142080.sra Written 386712 spots for SRR15142080.sra Read 386712 spots for SRR15142080.sra Written 386712 spots for SRR15142080.sra Read 386712 spots for SRR15142080.sra Written 386712 spots for SRR15142080.sra Read 386712 spots for SRR15142080.sra Written 386712 spots for SRR15142080.sra Read 386712 spots for SRR15142080.sra Written 386712 spots for SRR15142080.sra Read 386712 spots for SRR15142080.sra Written 386712 spots for SRR15142080.sra Read 386712 spots for SRR15142080.sra Written 386712 spots for SRR15142080.sra Read 386712 spots for SRR15142080.sra Written 386712 spots for SRR15142080.sra Read 386712 spots for SRR15142080.sra Written 386712 spots for SRR15142080.sra Read 386712 spots for SRR15142080.sra Written 386712 spots for SRR15142080.sra Read 386712 spots for SRR15142080.sra Written 386712 spots for SRR15142080.sra Read 386712 spots for SRR15142080.sra Written 386712 spots for SRR15142080.sra Read 386712 spots for SRR15142080.sra Written 386712 spots for SRR15142080.sra Read 386727 spots for SRR15142080.sra Written 386727 spots for SRR15142080.sra Read 386712 spots for SRR15142080.sra Written 386712 spots for SRR15142080.sra Read 386712 spots for SRR15142080.sra Written 386712 spots for SRR15142080.sra Read 386712 spots for SRR15142080.sra Written 386712 spots for SRR15142080.sra SRR ids: ['SRR15142080.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_0jkta4la SRR15142080.sra spots: 7734255 blocks: [[1, 386712], [386713, 773424], [773425, 1160136], [1160137, 1546848], [1546849, 1933560], [1933561, 2320272], [2320273, 2706984], [2706985, 3093696], [3093697, 3480408], [3480409, 3867120], [3867121, 4253832], [4253833, 4640544], [4640545, 5027256], [5027257, 5413968], [5413969, 5800680], [5800681, 6187392], [6187393, 6574104], [6574105, 6960816], [6960817, 7347528], [7347529, 7734255]] SRR15142080 file size 1446439 SRR15142080 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR15142080 SRR15142080_1.fastq SRR15142080_2.fastq Input file: SRR15142080_1.fastq Paired file: SRR15142080_2.fastq trimmed: SRR15142080-trimmed-pair1.fastq, SRR15142080-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 06:09:50 2025 >> started Fri Feb 14 06:10:00 2025 >> done (9.574s) 7734255 read pairs processed; of these: 1472 ( 0.02%) short read pairs filtered out after trimming by size control 195340 ( 2.53%) empty read pairs filtered out after trimming by size control 7537443 (97.46%) read pairs available; of these: 10209 ( 0.14%) trimmed read pairs available after processing 7527234 (99.86%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 22 39 0.00% 23 40 0.00% 24 55 0.00% 25 41 0.00% 26 36 0.00% 27 30 0.00% 28 24 0.00% 29 24 0.00% 30 36 0.00% 31 97 0.00% 32 86 0.00% 33 20 0.00% 34 134 0.00% 35 60 0.00% 36 74 0.00% 37 108 0.00% 38 127 0.00% 39 115 0.00% 40 150 0.00% 41 163 0.00% 42 187 0.00% 43 216 0.00% 44 255 0.00% 45 279 0.00% 46 348 0.00% 47 473 0.01% 48 504 0.01% 49 548 0.01% 50 796 0.01% 51 958 0.01% 52 648 0.01% 53 844 0.01% 54 827 0.01% 55 832 0.01% 56 945 0.01% 57 1079 0.01% 58 1168 0.02% 59 1065 0.01% 60 1083 0.01% 61 1165 0.02% 62 1314 0.02% 63 1428 0.02% 64 1506 0.02% 65 1597 0.02% 66 1731 0.02% 67 1867 0.02% 68 2113 0.03% 69 2598 0.03% 70 2941 0.04% 71 3706 0.05% 72 6037 0.08% 73 56260 0.75% 74 574541 7.62% 75 4090051 54.26% 76 2774074 36.80% 7537443 reads passed initial QC criterion=sequence-density sequence-density=0.09 sequence-density-rank=1 fanout-score=40.15 fanout-score-rank=15 prefix-density=0.27 prefix-fanout=13.2 sequence=ATTTTTATTTTTA criterion=fanout-score sequence-density=0.06 sequence-density-rank=15 fanout-score=396.66 fanout-score-rank=1 prefix-density=0.66 prefix-fanout=33.1 sequence=AAAAGAAAAAAA criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=30.46 fanout-score-rank=30 prefix-density=0.45 prefix-fanout=17.2 sequence=TTTTTTTTTTATT criterion=fanout-score sequence-density=0.07 sequence-density-rank=30 fanout-score=214.69 fanout-score-rank=1 prefix-density=0.88 prefix-fanout=16.9 sequence=TTTTATTTTTTA SRR15142080 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 06:10:36 Started mapping on | Feb 14 06:10:36 Finished on | Feb 14 06:12:25 Mapping speed, Million of reads per hour | 248.94 Number of input reads | 7537443 Average input read length | 150 UNIQUE READS: Uniquely mapped reads number | 4313170 Uniquely mapped reads % | 57.22% Average mapped length | 148.28 Number of splices: Total | 139981 Number of splices: Annotated (sjdb) | 109784 Number of splices: GT/AG | 116834 Number of splices: GC/AG | 1945 Number of splices: AT/AC | 302 Number of splices: Non-canonical | 20900 Mismatch rate per base, % | 0.69% Deletion rate per base | 0.09% Deletion average length | 1.47 Insertion rate per base | 0.11% Insertion average length | 1.38 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 174080 % of reads mapped to multiple loci | 2.31% Number of reads mapped to too many loci | 45137 % of reads mapped to too many loci | 0.60% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 39.76% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 3050437 3050437 3050437 N_multimapping 174080 174080 174080 N_noFeature 2171922 2688073 3762716 N_ambiguous 47566 10528 3008 UnstrandedReadsAssigned:2093682 PositiveStrandReadsAssigned:1614569 NegativeStrandReadsAssigned:547446 Dataset is classified unstranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR15142080 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR15142080-trimmed-pair1.fastq SRR15142080-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 7,537,443 reads, 2,568,280 reads pseudoaligned [quant] estimated average fragment length: 159.444 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 931 rounds 52401 SRR15142080.ke.tsv 34699 SRR15142080.se.tsv 87100 total ==> SRR15142080.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1859.56 167 37.601 Potri.005G024800.1.v4.1 1035 876.556 4 1.91061 Potri.004G059700.1.v4.1 961 802.579 44 22.9539 Potri.007G009000.2.v4.1 1416 1257.56 0 0 Potri.003G141000.2.v4.1 2943 2784.56 23.2251 3.49216 Potri.016G087400.1.v4.1 270 116.314 40 143.986 Potri.015G069301.1.v4.1 564 405.729 0 0 Potri.010G195200.1.v4.1 1773 1614.56 91.9661 23.8488 Potri.012G127500.1.v4.1 977 818.562 33 16.8793 ==> SRR15142080.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 14 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 120 Potri.001G212900.v4.1 3 Potri.001G182400.v4.1 10 Potri.001G256600.v4.1 28 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 14 Potri.001G452600.v4.1 11 SRR15142080 completed mapping pipeline successfully