Starting /dee2/code/volunteer_pipeline.sh SRR15142081 current disk space = 3085476012032 free memory = 1582636972 SRR15142081 SRAfilesize 7a4969389465ffb4f129e3763dcc7ad1 SRR15142081.sra SRR15142081.sra file validated SRR15142081 is paired end SRR15142081 is conventional basespace SRR15142081 read1 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR15142081_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 37 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.9065 32.0 32.0 32.0 32.0 32.0 2 31.3405 32.0 32.0 32.0 32.0 32.0 3 31.38 32.0 32.0 32.0 32.0 32.0 4 31.381 32.0 32.0 32.0 32.0 32.0 5 31.488 32.0 32.0 32.0 32.0 32.0 6 35.107 36.0 36.0 36.0 36.0 36.0 7 35.07575 36.0 36.0 36.0 36.0 36.0 8 35.17325 36.0 36.0 36.0 36.0 36.0 9 35.16075 36.0 36.0 36.0 36.0 36.0 10-11 35.060375 36.0 36.0 36.0 36.0 36.0 12-13 35.149125 36.0 36.0 36.0 36.0 36.0 14-15 35.172250000000005 36.0 36.0 36.0 36.0 36.0 16-17 35.06325 36.0 36.0 36.0 36.0 36.0 18-19 35.0985 36.0 36.0 36.0 36.0 36.0 20-21 35.078 36.0 36.0 36.0 36.0 36.0 22-23 35.04625 36.0 36.0 36.0 36.0 36.0 24-25 35.058499999999995 36.0 36.0 36.0 36.0 36.0 26-27 34.983875 36.0 36.0 36.0 36.0 36.0 28-29 34.950874999999996 36.0 36.0 36.0 36.0 36.0 30-31 34.9095 36.0 36.0 36.0 36.0 36.0 32-33 34.944125 36.0 36.0 36.0 36.0 36.0 34-35 34.900000000000006 36.0 36.0 36.0 36.0 36.0 36-37 34.988953050464474 36.0 36.0 36.0 36.0 36.0 38-39 34.93396252884402 36.0 36.0 36.0 36.0 36.0 40-41 34.92189854344551 36.0 36.0 36.0 36.0 36.0 42-43 34.91097438473129 36.0 36.0 36.0 36.0 36.0 44-45 34.82245102963335 36.0 36.0 36.0 36.0 36.0 46-47 34.79394776494224 36.0 36.0 36.0 36.0 36.0 48-49 34.780386740331494 36.0 36.0 36.0 32.0 36.0 50-51 34.63736815670518 36.0 36.0 36.0 32.0 36.0 52-53 34.75426921145153 36.0 36.0 36.0 34.0 36.0 54-55 34.46396283274736 36.0 36.0 36.0 32.0 36.0 56-57 34.52398292315419 36.0 36.0 36.0 32.0 36.0 58-59 34.441109994977396 36.0 36.0 36.0 32.0 36.0 60-61 34.35698695688944 36.0 36.0 36.0 32.0 36.0 62-63 34.30665829145728 36.0 36.0 36.0 32.0 36.0 64-65 34.28881107837773 36.0 36.0 36.0 32.0 36.0 66-67 34.27408805031446 36.0 36.0 36.0 32.0 36.0 68-69 34.17182389937106 36.0 36.0 36.0 32.0 36.0 70-71 34.1500754590372 36.0 36.0 36.0 32.0 36.0 72-73 34.16174539876987 36.0 36.0 36.0 32.0 36.0 74-75 34.12137269192466 36.0 36.0 36.0 32.0 36.0 76 33.529603919967336 36.0 36.0 36.0 27.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 17.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 0.0 22 8.0 23 5.0 24 9.0 25 11.0 26 19.0 27 36.0 28 38.0 29 50.0 30 78.0 31 107.0 32 154.0 33 249.0 34 601.0 35 2617.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.77386048854193 10.878871820700075 16.94787207252581 34.399395618232184 2 28.094401205121766 15.415515942756716 35.1493848857645 21.340697966357016 3 26.311825257343713 22.796886768767262 25.45819733868943 25.433090635199594 4 28.119507908611602 30.203364298267637 21.315591262867187 20.361536530253577 5 26.58799899573186 34.49661059502887 23.550087873462214 15.365302535777053 6 19.65854883253829 36.15365302535777 27.943760984182774 16.244037157921166 7 14.109967361285463 28.646748681898064 44.66482550841074 12.578458448405724 8 17.449158925433093 25.88501129801657 38.13708260105449 18.52874717549586 9 19.332161687170473 23.62540798393171 38.03665578709515 19.005774541802662 10-11 18.804920913884008 37.92367562139091 28.14461461210143 15.126788852623651 12-13 19.809189053477276 30.692945016319356 32.60105448154657 16.89681144865679 14-15 19.382375094150138 31.421039417524476 32.262113984433846 16.934471503891537 16-17 19.23173487321115 32.51318101933216 31.75997991463721 16.495104192819483 18-19 19.972382626161185 31.973386894300777 30.667838312829527 17.38639216670851 20-21 19.482801908109465 31.78508661812704 31.107205623901578 17.624905849861914 22-23 19.708762239517952 31.446146121014312 31.596786341953305 17.248305297514435 24-25 19.055987948782324 32.11147376349485 31.14486567913633 17.687672608586492 26-27 19.357268390660305 31.195079086115996 31.810193321616868 17.637459201606827 28-29 19.31960833542556 32.651267888526235 31.57167963846347 16.457444137584734 30-31 18.867687672608586 32.12402711523977 31.521466231483807 17.486818980667838 32-33 19.83429575696711 31.93572683906603 31.446146121014312 16.783831282952548 34-35 18.880241024353502 31.835300025106704 31.948280190810944 17.33617875972885 36-37 17.888526236505147 31.521466231483807 32.83956816469997 17.75043936731107 38-39 18.882611424984304 32.178279974890145 31.52542372881356 17.41368487131199 40-41 18.558513309894526 32.35811150175791 31.74284279256655 17.340532395781015 42-43 18.734304369663484 32.031642390758414 31.893520843797084 17.340532395781015 44-45 19.11099949773983 32.58412857860372 31.077348066298345 17.22752385735811 46-47 18.194374686087393 31.705173279758913 32.471120040180814 17.629331993972876 48-49 18.822199899547964 32.59668508287293 31.893520843797084 16.68759417378202 50-51 18.056253139126067 32.14465092918132 32.59668508287293 17.20241084881969 52-53 18.34505273731793 32.58412857860372 32.898041185334 16.172777498744352 54-55 18.382722250125568 31.843294826720243 32.62179809141135 17.152184831742844 56-57 18.734304369663484 32.79758915118031 31.793068809643394 16.675037669512808 58-59 18.709191361125065 31.793068809643394 32.75991963837267 16.737820190858866 60-61 19.09307875894988 32.181886697651045 31.742243436754176 16.982791106644893 62-63 18.542713567839193 32.22361809045226 31.683417085427134 17.550251256281406 64-65 17.709904474610358 33.383609854198085 31.90045248868778 17.00603318250377 66-67 18.12578616352201 31.77358490566038 32.30188679245283 17.79874213836478 68-69 17.9748427672956 32.503144654088054 32.86792452830189 16.654088050314467 70-71 19.12190212605359 32.14240785004403 32.05434645867405 16.681343565228328 72-73 18.38179519595449 32.61694058154235 31.795195954487994 17.20606826801517 74-75 17.456524624983405 29.92167795035179 34.727200318598165 17.89459710606664 76 21.233156390363416 0.0 50.83707635769702 27.92976725193957 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 20.0 1 10.5 2 1.0 3 1.5 4 2.0 5 1.0 6 2.5 7 3.5 8 2.0 9 3.0 10 4.0 11 6.0 12 8.0 13 8.0 14 10.0 15 15.5 16 18.5 17 16.5 18 23.5 19 31.5 20 34.5 21 38.5 22 46.0 23 63.5 24 78.0 25 84.5 26 93.0 27 103.5 28 117.0 29 134.0 30 163.0 31 194.5 32 202.5 33 197.5 34 229.0 35 258.5 36 255.5 37 263.5 38 251.0 39 244.5 40 247.5 41 250.5 42 240.5 43 186.5 44 154.0 45 149.0 46 141.5 47 115.5 48 91.0 49 81.0 50 75.5 51 70.5 52 49.5 53 41.5 54 47.0 55 35.5 56 18.5 57 13.0 58 13.0 59 9.0 60 4.0 61 4.0 62 4.5 63 4.5 64 3.5 65 4.0 66 3.5 67 1.0 68 1.5 69 4.5 70 5.5 71 3.5 72 1.5 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.7250000000000001 2 0.42500000000000004 3 0.42500000000000004 4 0.42500000000000004 5 0.42500000000000004 6 0.42500000000000004 7 0.42500000000000004 8 0.42500000000000004 9 0.42500000000000004 10-11 0.42500000000000004 12-13 0.42500000000000004 14-15 0.42500000000000004 16-17 0.42500000000000004 18-19 0.42500000000000004 20-21 0.42500000000000004 22-23 0.42500000000000004 24-25 0.42500000000000004 26-27 0.42500000000000004 28-29 0.42500000000000004 30-31 0.42500000000000004 32-33 0.42500000000000004 34-35 0.42500000000000004 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 17.0 36 0.0 37 0.0 38 1.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 1.0 60 1.0 61 0.0 62 0.0 63 1.0 64 2.0 65 2.0 66 0.0 67 0.0 68 0.0 69 0.0 70 1.0 71 8.0 72 22.0 73 77.0 74 201.0 75 1217.0 76 2449.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.925 #Duplication Level Percentage of deduplicated Percentage of total 1 99.51983826130906 98.45 2 0.37907505686125853 0.75 3 0.025271670457417232 0.075 4 0.025271670457417232 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.025271670457417232 0.2 9 0.0 0.0 >10 0.025271670457417232 0.42500000000000004 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 17 0.42500000000000004 No Hit CGGCCAGTGAATTGTAATACGACTCACTATAGGGAGATCTGTATGCTGGT 8 0.2 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR15142081 read2 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR15142081_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 35 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.8335 32.0 32.0 32.0 32.0 32.0 2 31.198 32.0 32.0 32.0 32.0 32.0 3 31.28575 32.0 32.0 32.0 32.0 32.0 4 31.19925 32.0 32.0 32.0 32.0 32.0 5 31.44025 32.0 32.0 32.0 32.0 32.0 6 34.96175 36.0 36.0 36.0 36.0 36.0 7 35.01725 36.0 36.0 36.0 36.0 36.0 8 35.07625 36.0 36.0 36.0 36.0 36.0 9 35.09225 36.0 36.0 36.0 36.0 36.0 10-11 34.960125000000005 36.0 36.0 36.0 36.0 36.0 12-13 35.006625 36.0 36.0 36.0 36.0 36.0 14-15 34.962625 36.0 36.0 36.0 36.0 36.0 16-17 35.100625 36.0 36.0 36.0 36.0 36.0 18-19 34.92975 36.0 36.0 36.0 36.0 36.0 20-21 34.728375 36.0 36.0 36.0 36.0 36.0 22-23 34.424625 36.0 36.0 36.0 32.0 36.0 24-25 34.013625000000005 36.0 36.0 36.0 32.0 36.0 26-27 33.5925 36.0 36.0 36.0 26.5 36.0 28-29 33.357625 36.0 36.0 36.0 21.0 36.0 30-31 33.12412500000001 36.0 36.0 36.0 14.0 36.0 32-33 33.0745 36.0 36.0 36.0 14.0 36.0 34-35 32.678375 36.0 36.0 36.0 14.0 36.0 36-37 32.63347510632975 36.0 36.0 36.0 14.0 36.0 38-39 32.45714744642065 36.0 36.0 36.0 14.0 36.0 40-41 32.5304054054054 36.0 36.0 36.0 14.0 36.0 42-43 32.536286286286284 36.0 36.0 36.0 14.0 36.0 44-45 32.741991991991995 36.0 36.0 36.0 14.0 36.0 46-47 32.61674174174174 36.0 36.0 36.0 14.0 36.0 48-49 32.490990990990994 36.0 36.0 36.0 14.0 36.0 50-51 32.1773023023023 36.0 32.0 36.0 14.0 36.0 52-53 32.19632132132132 36.0 34.0 36.0 14.0 36.0 54-55 32.487612612612615 36.0 36.0 36.0 14.0 36.0 56-57 32.41854354354354 36.0 34.0 36.0 14.0 36.0 58-59 32.33208208208208 36.0 34.0 36.0 14.0 36.0 60-61 32.24533345700654 36.0 34.0 36.0 14.0 36.0 62-63 31.94616925388082 36.0 32.0 36.0 14.0 36.0 64-65 31.810028145446918 36.0 32.0 36.0 14.0 36.0 66-67 31.88640922768305 36.0 32.0 36.0 14.0 36.0 68-69 31.98207121364092 36.0 32.0 36.0 14.0 36.0 70-71 31.69629030683724 36.0 32.0 36.0 14.0 36.0 72-73 31.631447463526243 36.0 32.0 36.0 14.0 36.0 74-75 31.710719618814693 36.0 32.0 36.0 14.0 36.0 76 30.842125984251968 36.0 32.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 1.0 18 3.0 19 6.0 20 8.0 21 12.0 22 34.0 23 67.0 24 88.0 25 110.0 26 107.0 27 97.0 28 93.0 29 106.0 30 98.0 31 132.0 32 167.0 33 331.0 34 969.0 35 1567.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.77777777777778 19.28104575163399 23.856209150326798 29.08496732026144 2 17.713284963722792 25.894420815611706 42.23167375531649 14.16062046534901 3 17.413059794846134 27.845884413309985 39.329497122842135 15.411558669001751 4 22.416812609457093 31.198398799099326 31.448586439829874 14.93620215161371 5 19.5896922692019 33.72529397047786 34.65098824118088 12.034025519139355 6 14.410808106079559 37.378033525143856 35.47660745559169 12.734550913184888 7 11.733800350262696 16.162121591193397 57.192894671003245 14.911183387540655 8 16.837628221165872 21.215911933950462 42.30673004753565 19.63972979734801 9 17.08781586189642 22.516887665749312 41.35601701275957 19.039279459594695 10-11 17.350512884663498 31.64873655241431 36.527395546659996 14.473355016262197 12-13 15.511633725293972 24.48086064548411 43.58268701526144 16.424818613960472 14-15 14.435826870152615 26.70753064798599 44.68351263447586 14.17312984738554 16-17 14.198148611458594 26.845133850387793 44.195646735051284 14.761070803102328 18-19 15.47410557918439 26.582436827620715 42.60695521641231 15.336502376782587 20-21 15.198899174380786 28.546409807355516 41.34350763072304 14.911183387540655 22-23 15.774330748061047 28.5839379534651 40.055041280960715 15.586690017513135 24-25 15.761821366024517 30.11008256192144 38.34125594195646 15.786840130097573 26-27 16.524893670252688 30.060045033775328 38.04103077307981 15.374030522892168 28-29 17.312984738553915 30.235176382286717 36.05203902927195 16.399799849887415 30-31 17.81336002001501 31.88641481110833 34.738553915436576 15.561671253440078 32-33 18.176132099074305 31.848886664998748 33.71278458844133 16.262196647485613 34-35 18.388791593695274 32.04903677758319 33.137353014761075 16.424818613960472 36-37 17.81336002001501 31.973980485364024 33.91293470102577 16.299724793595196 38-39 17.990741899161765 32.891279869886155 32.34079819842362 16.777180032528463 40-41 17.842842842842842 32.75775775775776 32.74524524524524 16.654154154154156 42-43 19.006506506506508 31.83183183183183 32.407407407407405 16.754254254254256 44-45 17.81781781781782 31.83183183183183 33.370870870870874 16.97947947947948 46-47 18.993993993993993 31.106106106106107 33.108108108108105 16.79179179179179 48-49 20.332832832832835 30.005005005005003 33.12062062062062 16.54154154154154 50-51 21.30880880880881 29.94244244244244 32.41991991991992 16.32882882882883 52-53 21.871871871871875 29.179179179179176 32.54504504504504 16.403903903903906 54-55 21.333833833833836 29.817317317317315 32.63263263263263 16.216216216216218 56-57 21.97197197197197 28.64114114114114 32.670170170170174 16.716716716716718 58-59 20.683183183183182 29.867367367367372 31.931931931931935 17.51751751751752 60-61 21.69232694955564 29.227688071097756 31.89385404931781 17.18613093002879 62-63 22.01352366641623 29.38893062860005 31.893313298271973 16.704232406711743 64-65 22.705072010018785 28.716343143393864 31.5466499686913 17.031934877896056 66-67 22.530090270812437 28.598294884653964 31.61985957873621 17.251755265797392 68-69 22.670846394984327 29.078369905956116 31.47335423197492 16.77742946708464 70-71 22.300263388937662 28.96024081274301 31.59413018938919 17.14536560893014 72-73 22.549389706807602 29.268906505599595 31.2696615074871 16.912042280105698 74-75 21.841202848852546 27.55209707201266 33.35531522025851 17.251384858876285 76 24.803149606299215 0.0 49.173228346456696 26.023622047244093 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 4.0 1 3.5 2 3.5 3 3.5 4 3.0 5 2.5 6 3.0 7 3.0 8 2.0 9 4.5 10 8.0 11 8.5 12 8.0 13 10.5 14 11.0 15 20.0 16 27.0 17 24.5 18 27.0 19 33.5 20 48.0 21 58.0 22 68.0 23 87.0 24 102.5 25 111.5 26 123.0 27 152.0 28 174.5 29 185.5 30 198.0 31 231.5 32 264.0 33 268.5 34 267.0 35 261.5 36 267.5 37 263.0 38 232.0 39 207.5 40 204.0 41 182.0 42 142.0 43 126.0 44 115.5 45 104.0 46 100.5 47 92.5 48 68.5 49 50.0 50 52.0 51 47.5 52 43.5 53 38.0 54 26.5 55 19.0 56 17.0 57 17.5 58 14.5 59 10.5 60 9.0 61 9.5 62 8.0 63 5.5 64 3.5 65 2.5 66 2.0 67 2.0 68 1.5 69 1.5 70 2.0 71 2.5 72 2.5 73 1.5 74 1.0 75 1.5 76 2.0 77 1.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 1.0 98 2.0 99 4.5 100 7.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.5499999999999999 2 0.075 3 0.075 4 0.075 5 0.075 6 0.075 7 0.075 8 0.075 9 0.075 10-11 0.075 12-13 0.075 14-15 0.075 16-17 0.075 18-19 0.075 20-21 0.075 22-23 0.075 24-25 0.075 26-27 0.075 28-29 0.075 30-31 0.075 32-33 0.075 34-35 0.075 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.025037556334501748 64-65 0.0 66-67 0.0 68-69 0.012537612838515547 70-71 0.025078369905956112 72-73 0.0 74-75 0.026371308016877634 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 3.0 36 0.0 37 0.0 38 1.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 1.0 60 1.0 61 0.0 62 0.0 63 1.0 64 1.0 65 4.0 66 0.0 67 0.0 68 0.0 69 0.0 70 1.0 71 4.0 72 19.0 73 65.0 74 214.0 75 1145.0 76 2540.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62264150943396 99.0 2 0.3018867924528302 0.6 3 0.025157232704402514 0.075 4 0.0 0.0 5 0.025157232704402514 0.125 6 0.0 0.0 7 0.0 0.0 8 0.025157232704402514 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 8 0.2 No Hit CGGCCAGTGAATTGTAATACGACTCACTATAGGGAGATCTGTATGCTGGT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 339788 spots for SRR15142081.sra Written 339788 spots for SRR15142081.sra Read 339788 spots for SRR15142081.sra Written 339788 spots for SRR15142081.sra Read 339788 spots for SRR15142081.sra Written 339788 spots for SRR15142081.sra Read 339788 spots for SRR15142081.sra Written 339788 spots for SRR15142081.sra Read 339788 spots for SRR15142081.sra Written 339788 spots for SRR15142081.sra Read 339788 spots for SRR15142081.sra Written 339788 spots for SRR15142081.sra Read 339788 spots for SRR15142081.sra Written 339788 spots for SRR15142081.sra Read 339788 spots for SRR15142081.sra Written 339788 spots for SRR15142081.sra Read 339788 spots for SRR15142081.sra Written 339788 spots for SRR15142081.sra Read 339788 spots for SRR15142081.sra Written 339788 spots for SRR15142081.sra Read 339788 spots for SRR15142081.sra Written 339788 spots for SRR15142081.sra Read 339788 spots for SRR15142081.sra Written 339788 spots for SRR15142081.sra Read 339788 spots for SRR15142081.sra Written 339788 spots for SRR15142081.sra Read 339788 spots for SRR15142081.sra Written 339788 spots for SRR15142081.sra Read 339788 spots for SRR15142081.sra Written 339788 spots for SRR15142081.sra Read 339788 spots for SRR15142081.sra Written 339788 spots for SRR15142081.sra Read 339788 spots for SRR15142081.sra Written 339788 spots for SRR15142081.sra Read 339788 spots for SRR15142081.sra Written 339788 spots for SRR15142081.sra Read 339788 spots for SRR15142081.sra Written 339788 spots for SRR15142081.sra Read 339796 spots for SRR15142081.sra Written 339796 spots for SRR15142081.sra SRR ids: ['SRR15142081.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_g1_41mf1 SRR15142081.sra spots: 6795768 blocks: [[1, 339788], [339789, 679576], [679577, 1019364], [1019365, 1359152], [1359153, 1698940], [1698941, 2038728], [2038729, 2378516], [2378517, 2718304], [2718305, 3058092], [3058093, 3397880], [3397881, 3737668], [3737669, 4077456], [4077457, 4417244], [4417245, 4757032], [4757033, 5096820], [5096821, 5436608], [5436609, 5776396], [5776397, 6116184], [6116185, 6455972], [6455973, 6795768]] SRR15142081 file size 1280642 SRR15142081 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR15142081 SRR15142081_1.fastq SRR15142081_2.fastq Input file: SRR15142081_1.fastq Paired file: SRR15142081_2.fastq trimmed: SRR15142081-trimmed-pair1.fastq, SRR15142081-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 06:06:38 2025 >> started Fri Feb 14 06:06:43 2025 >> done (5.541s) 6795768 read pairs processed; of these: 1304 ( 0.02%) short read pairs filtered out after trimming by size control 48871 ( 0.72%) empty read pairs filtered out after trimming by size control 6745593 (99.26%) read pairs available; of these: 9851 ( 0.15%) trimmed read pairs available after processing 6735742 (99.85%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 20 1 0.00% 21 0 0.00% 22 40 0.00% 23 26 0.00% 24 31 0.00% 25 25 0.00% 26 34 0.00% 27 20 0.00% 28 20 0.00% 29 18 0.00% 30 30 0.00% 31 66 0.00% 32 52 0.00% 33 12 0.00% 34 80 0.00% 35 41 0.00% 36 35 0.00% 37 37 0.00% 38 60 0.00% 39 66 0.00% 40 93 0.00% 41 110 0.00% 42 100 0.00% 43 132 0.00% 44 143 0.00% 45 170 0.00% 46 211 0.00% 47 400 0.01% 48 300 0.00% 49 409 0.01% 50 617 0.01% 51 735 0.01% 52 442 0.01% 53 609 0.01% 54 615 0.01% 55 649 0.01% 56 729 0.01% 57 766 0.01% 58 895 0.01% 59 765 0.01% 60 752 0.01% 61 821 0.01% 62 951 0.01% 63 1099 0.02% 64 1102 0.02% 65 1195 0.02% 66 1312 0.02% 67 1527 0.02% 68 1656 0.02% 69 2249 0.03% 70 2454 0.04% 71 3182 0.05% 72 5244 0.08% 73 49734 0.74% 74 514565 7.63% 75 3687368 54.66% 76 2460798 36.48% 6745593 reads passed initial QC criterion=sequence-density sequence-density=0.12 sequence-density-rank=1 fanout-score=1.93 fanout-score-rank=30 prefix-density=0.12 prefix-fanout=1.9 sequence=GCATACGGACATTTTGGAAGGGATGACCCAGACTTCACCTGGGAAGTTGTCAAGCCCCTCAAATGGGAGAAGCCTCAAGCTTAAGAGTGATTTATCCTATCCCTTTTGCGCAATGCTTATTTTATTGGTACTTATGAATAATTCGGTTTGTCTTGCTGCTGGTCTATAATCGTTAGCTATCCTCAATGGTCTAATCTCATGCATTAAGATACCCTATTCATTTTCATTTC criterion=fanout-score sequence-density=0.06 sequence-density-rank=14 fanout-score=318.23 fanout-score-rank=1 prefix-density=0.62 prefix-fanout=30.3 sequence=AAAAGAAAAAAA criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=32.98 fanout-score-rank=26 prefix-density=0.43 prefix-fanout=18.1 sequence=TTTTTTTTTTAT criterion=fanout-score sequence-density=0.08 sequence-density-rank=25 fanout-score=182.03 fanout-score-rank=1 prefix-density=0.86 prefix-fanout=17.9 sequence=TTTTATTTTATT SRR15142081 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 06:07:17 Started mapping on | Feb 14 06:07:17 Finished on | Feb 14 06:08:30 Mapping speed, Million of reads per hour | 332.66 Number of input reads | 6745593 Average input read length | 150 UNIQUE READS: Uniquely mapped reads number | 4676796 Uniquely mapped reads % | 69.33% Average mapped length | 148.07 Number of splices: Total | 173110 Number of splices: Annotated (sjdb) | 136381 Number of splices: GT/AG | 144662 Number of splices: GC/AG | 2594 Number of splices: AT/AC | 461 Number of splices: Non-canonical | 25393 Mismatch rate per base, % | 0.70% Deletion rate per base | 0.09% Deletion average length | 1.47 Insertion rate per base | 0.11% Insertion average length | 1.35 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 179403 % of reads mapped to multiple loci | 2.66% Number of reads mapped to too many loci | 69225 % of reads mapped to too many loci | 1.03% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 26.83% % of reads unmapped: other | 0.15% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1889660 1889660 1889660 N_multimapping 179403 179403 179403 N_noFeature 2225844 2820898 4036218 N_ambiguous 59533 11159 3134 UnstrandedReadsAssigned:2391419 PositiveStrandReadsAssigned:1844739 NegativeStrandReadsAssigned:637444 Dataset is classified unstranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR15142081 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR15142081-trimmed-pair1.fastq SRR15142081-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 6,745,593 reads, 2,970,922 reads pseudoaligned [quant] estimated average fragment length: 159.412 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 942 rounds 52401 SRR15142081.ke.tsv 34699 SRR15142081.se.tsv 87100 total ==> SRR15142081.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1859.59 128 24.2725 Potri.005G024800.1.v4.1 1035 876.588 31 12.4706 Potri.004G059700.1.v4.1 961 802.631 14 6.15084 Potri.007G009000.2.v4.1 1416 1257.59 2 0.560807 Potri.003G141000.2.v4.1 2943 2784.59 14 1.77292 Potri.016G087400.1.v4.1 270 116.361 47 142.434 Potri.015G069301.1.v4.1 564 405.912 0 0 Potri.010G195200.1.v4.1 1773 1614.59 80 17.4723 Potri.012G127500.1.v4.1 977 818.617 9 3.87689 ==> SRR15142081.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 105 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 91 Potri.001G212900.v4.1 10 Potri.001G182400.v4.1 9 Potri.001G256600.v4.1 43 Potri.001G040500.v4.1 4 Potri.001G416900.v4.1 14 Potri.001G452600.v4.1 51 SRR15142081 completed mapping pipeline successfully