Starting /dee2/code/volunteer_pipeline.sh SRR15142082 current disk space = 3086056521728 free memory = 1446251768 SRR15142082 SRAfilesize 0998e2cccd02642a836c460e26f0c6a3 SRR15142082.sra SRR15142082.sra file validated SRR15142082 is paired end SRR15142082 is conventional basespace SRR15142082 read1 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR15142082_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 37 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.801 32.0 32.0 32.0 32.0 32.0 2 31.09075 32.0 32.0 32.0 32.0 32.0 3 31.17225 32.0 32.0 32.0 32.0 32.0 4 31.161 32.0 32.0 32.0 32.0 32.0 5 31.25375 32.0 32.0 32.0 32.0 32.0 6 34.80775 36.0 36.0 36.0 36.0 36.0 7 34.81125 36.0 36.0 36.0 36.0 36.0 8 34.9135 36.0 36.0 36.0 36.0 36.0 9 34.91925 36.0 36.0 36.0 36.0 36.0 10-11 34.790125 36.0 36.0 36.0 36.0 36.0 12-13 34.935375 36.0 36.0 36.0 36.0 36.0 14-15 34.829875 36.0 36.0 36.0 36.0 36.0 16-17 34.861125 36.0 36.0 36.0 36.0 36.0 18-19 34.81725 36.0 36.0 36.0 36.0 36.0 20-21 34.82362500000001 36.0 36.0 36.0 36.0 36.0 22-23 34.729625 36.0 36.0 36.0 36.0 36.0 24-25 34.7765 36.0 36.0 36.0 36.0 36.0 26-27 34.66 36.0 36.0 36.0 36.0 36.0 28-29 34.648125 36.0 36.0 36.0 36.0 36.0 30-31 34.647625 36.0 36.0 36.0 36.0 36.0 32-33 34.608000000000004 36.0 36.0 36.0 36.0 36.0 34-35 34.50575 36.0 36.0 36.0 36.0 36.0 36-37 34.944486595852304 36.0 36.0 36.0 36.0 36.0 38-39 34.87885685381892 36.0 36.0 36.0 36.0 36.0 40-41 34.709028831562975 36.0 36.0 36.0 36.0 36.0 42-43 34.723571067273646 36.0 36.0 36.0 34.0 36.0 44-45 34.612417804754685 36.0 36.0 36.0 32.0 36.0 46-47 34.6747119127748 36.0 36.0 36.0 32.0 36.0 48-49 34.60637490513534 36.0 36.0 36.0 32.0 36.0 50-51 34.60108805668016 36.0 36.0 36.0 32.0 36.0 52-53 34.50113866396761 36.0 36.0 36.0 32.0 36.0 54-55 34.327794277366095 36.0 36.0 36.0 32.0 36.0 56-57 34.47683544303797 36.0 36.0 36.0 32.0 36.0 58-59 34.29518987341772 36.0 36.0 36.0 32.0 36.0 60-61 34.28762862573765 36.0 36.0 36.0 32.0 36.0 62-63 34.13257421819177 36.0 36.0 36.0 32.0 36.0 64-65 34.200912085127946 36.0 36.0 36.0 32.0 36.0 66-67 34.09821821459154 36.0 36.0 36.0 32.0 36.0 68-69 34.21368821292776 36.0 36.0 36.0 32.0 36.0 70-71 34.1093484333946 36.0 36.0 36.0 32.0 36.0 72-73 34.110634872777155 36.0 36.0 36.0 32.0 36.0 74-75 33.94346541205479 36.0 36.0 36.0 32.0 36.0 76 33.40468364831553 36.0 36.0 36.0 27.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 46.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 2.0 21 2.0 22 6.0 23 6.0 24 12.0 25 16.0 26 21.0 27 38.0 28 55.0 29 50.0 30 79.0 31 108.0 32 143.0 33 258.0 34 597.0 35 2561.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.81349911190053 11.2661760974372 16.036538949505204 37.88378584115707 2 30.045523520485585 13.884673748103188 39.12493677288821 16.944865958523014 3 26.251896813353564 24.12746585735964 26.27718765806778 23.34344967121902 4 29.84319676277188 27.16236722306525 24.10217501264542 18.89226100151745 5 26.960040465351543 32.95397066262013 26.378351036924634 13.707637835103693 6 20.789074355083457 36.949924127465856 28.93272635306019 13.32827516439049 7 14.896307536671724 27.845220030349015 45.371775417298934 11.886697015680324 8 17.298937784522003 25.442589782498736 40.11127971674254 17.147192716236724 9 19.929185634800202 23.21699544764795 39.58017197774406 17.27364693980779 10-11 20.751138088012137 36.49468892261002 28.730399595346483 14.02377339403136 12-13 20.8649468892261 29.299443601416286 33.725341426403645 16.110268082953972 14-15 20.068285280728375 31.322711178553362 32.97926150733434 15.629742033383915 16-17 19.233687405159333 32.132018209408194 32.09408194233687 16.5402124430956 18-19 20.283257460799188 31.84117349519474 31.86646433990895 16.009104704097116 20-21 20.384420839656045 31.815882650480525 30.6398583712696 17.15983813859383 22-23 19.726858877086496 32.56196256954983 31.133029843196763 16.57814871016692 24-25 19.157814871016694 32.27111785533637 31.46181082448154 17.109256449165404 26-27 20.738492665655034 30.816894284269093 32.068791097622665 16.37582195245321 28-29 20.156803237228125 31.398583712696006 31.550328780981285 16.894284269094587 30-31 20.308548305513405 31.322711178553362 30.981284774911483 17.38745574102175 32-33 20.106221547799695 32.53667172483561 31.04451188669702 16.31259484066768 34-35 19.663631765300963 32.435508345978754 31.550328780981285 16.350531107739 36-37 19.929185634800202 31.61355589276682 31.71471927162367 16.742539200809308 38-39 20.39706626201315 31.1962569549823 31.46181082448154 16.944865958523014 40-41 19.82802225594335 31.82852807283763 32.132018209408194 16.211431461810825 42-43 20.801719777440567 30.791603439554883 31.891755184623165 16.514921598381385 44-45 20.460293373798685 31.25948406676783 31.18361153262519 17.096611026808294 46-47 19.286707980270645 31.744024282281526 32.072846844568105 16.896420892879725 48-49 20.743738932456363 30.483177333670632 32.31722742221098 16.45585631166203 50-51 19.483805668016192 30.5668016194332 33.02125506072874 16.928137651821864 52-53 19.977226720647774 31.275303643724694 31.88259109311741 16.864878542510123 54-55 19.70636628274902 30.742943931147952 32.185799265915705 17.364890520187316 56-57 18.9873417721519 30.37974683544304 32.25316455696203 18.37974683544304 58-59 18.89873417721519 32.734177215189874 31.253164556962027 17.11392405063291 60-61 18.939106215976707 31.953411824281552 32.358526395746296 16.748955563995445 62-63 18.80460934532101 31.568950234266175 32.05014562492086 17.576294795491958 64-65 20.230554851786167 31.403597669115786 31.124904991132507 17.240942487965544 66-67 19.16106957293119 31.567608668102903 32.69547585857306 16.575845900392853 68-69 20.012674271229404 31.520912547528518 31.634980988593153 16.831432192648922 70-71 19.558599695585997 31.405377980720445 32.02688990360223 17.009132420091326 72-73 20.3795694815947 32.26340593554961 31.61380715832378 15.743217424531908 74-75 18.977119784656796 28.963660834454913 34.40107671601615 17.65814266487214 76 22.76088742810189 0.0 49.87674609695974 27.36236647493837 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 52.0 1 28.0 2 2.5 3 5.0 4 9.0 5 7.0 6 4.5 7 3.5 8 3.5 9 4.5 10 4.5 11 5.0 12 6.0 13 5.5 14 8.5 15 9.0 16 9.5 17 15.0 18 18.0 19 24.0 20 31.5 21 35.0 22 40.5 23 57.5 24 71.5 25 69.5 26 82.5 27 117.0 28 139.0 29 133.0 30 148.5 31 181.0 32 201.0 33 213.5 34 225.0 35 235.0 36 241.0 37 256.5 38 258.5 39 236.5 40 205.0 41 206.0 42 222.5 43 197.0 44 158.0 45 146.0 46 141.5 47 119.5 48 91.5 49 93.0 50 94.5 51 69.0 52 46.5 53 40.0 54 39.5 55 36.5 56 35.5 57 36.0 58 35.5 59 25.5 60 13.0 61 10.5 62 12.5 63 9.0 64 6.0 65 6.0 66 4.5 67 3.5 68 1.5 69 0.5 70 1.5 71 2.0 72 1.0 73 0.0 74 0.0 75 0.0 76 0.0 77 1.0 78 1.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.4749999999999999 2 1.15 3 1.15 4 1.15 5 1.15 6 1.15 7 1.15 8 1.15 9 1.15 10-11 1.15 12-13 1.15 14-15 1.15 16-17 1.15 18-19 1.15 20-21 1.15 22-23 1.15 24-25 1.15 26-27 1.15 28-29 1.15 30-31 1.15 32-33 1.15 34-35 1.15 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 46.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 1.0 47 0.0 48 0.0 49 1.0 50 0.0 51 0.0 52 0.0 53 1.0 54 1.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 1.0 61 0.0 62 1.0 63 1.0 64 0.0 65 1.0 66 1.0 67 0.0 68 0.0 69 2.0 70 2.0 71 4.0 72 23.0 73 89.0 74 220.0 75 1171.0 76 2434.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.25 #Duplication Level Percentage of deduplicated Percentage of total 1 99.51653944020357 97.775 2 0.356234096692112 0.7000000000000001 3 0.05089058524173028 0.15 4 0.02544529262086514 0.1 5 0.02544529262086514 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02544529262086514 1.15 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 46 1.15 No Hit GTGAATTGTAATACGACTCACTATAGGGAGATCTGTATGCTGGTTTTTTT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR15142082 read2 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR15142082_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 36 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.8035 32.0 32.0 32.0 32.0 32.0 2 31.07725 32.0 32.0 32.0 32.0 32.0 3 31.0655 32.0 32.0 32.0 32.0 32.0 4 31.179 32.0 32.0 32.0 32.0 32.0 5 31.21025 32.0 32.0 32.0 32.0 32.0 6 34.873 36.0 36.0 36.0 36.0 36.0 7 34.99225 36.0 36.0 36.0 36.0 36.0 8 34.8835 36.0 36.0 36.0 36.0 36.0 9 34.87075 36.0 36.0 36.0 36.0 36.0 10-11 34.75725 36.0 36.0 36.0 36.0 36.0 12-13 34.838125000000005 36.0 36.0 36.0 36.0 36.0 14-15 34.8855 36.0 36.0 36.0 36.0 36.0 16-17 34.851124999999996 36.0 36.0 36.0 36.0 36.0 18-19 34.81275 36.0 36.0 36.0 36.0 36.0 20-21 34.653 36.0 36.0 36.0 36.0 36.0 22-23 34.327875 36.0 36.0 36.0 32.0 36.0 24-25 33.89375 36.0 36.0 36.0 32.0 36.0 26-27 33.4325 36.0 36.0 36.0 21.0 36.0 28-29 33.296875 36.0 36.0 36.0 17.5 36.0 30-31 33.267125 36.0 36.0 36.0 21.0 36.0 32-33 33.056375 36.0 36.0 36.0 14.0 36.0 34-35 32.842625 36.0 36.0 36.0 14.0 36.0 36-37 32.87031015507754 36.0 36.0 36.0 14.0 36.0 38-39 32.82403701850926 36.0 36.0 36.0 14.0 36.0 40-41 32.78489244622311 36.0 36.0 36.0 14.0 36.0 42-43 32.58629314657328 36.0 36.0 36.0 14.0 36.0 44-45 32.78801900950475 36.0 36.0 36.0 14.0 36.0 46-47 32.823411705852926 36.0 36.0 36.0 14.0 36.0 48-49 32.68734367183592 36.0 36.0 36.0 14.0 36.0 50-51 32.3976732549412 36.0 32.0 36.0 14.0 36.0 52-53 32.450838128596445 36.0 34.0 36.0 14.0 36.0 54-55 32.55524325952987 36.0 36.0 36.0 14.0 36.0 56-57 32.37309136420526 36.0 34.0 36.0 14.0 36.0 58-59 32.38097622027534 36.0 34.0 36.0 14.0 36.0 60-61 32.15196596521817 36.0 34.0 36.0 14.0 36.0 62-63 31.951652246714676 36.0 32.0 36.0 14.0 36.0 64-65 31.7998496993988 36.0 32.0 36.0 14.0 36.0 66-67 31.927959651069543 36.0 32.0 36.0 14.0 36.0 68-69 31.843609022556393 36.0 32.0 36.0 14.0 36.0 70-71 31.657289102631527 36.0 32.0 36.0 14.0 36.0 72-73 31.655893062539754 36.0 32.0 36.0 14.0 36.0 74-75 31.796129871701766 36.0 32.0 36.0 14.0 36.0 76 31.205298013245034 36.0 32.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 1.0 17 2.0 18 3.0 19 7.0 20 7.0 21 23.0 22 41.0 23 63.0 24 81.0 25 99.0 26 89.0 27 100.0 28 98.0 29 88.0 30 107.0 31 128.0 32 186.0 33 354.0 34 1026.0 35 1494.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.227192762000502 20.432269414425736 22.21663734606685 33.123900477506915 2 17.53376688344172 27.43871935967984 42.92146073036518 12.106053026513257 3 16.15807903951976 28.88944472236118 37.718859429714854 17.2336168084042 4 21.38569284642321 33.91695847923962 30.440220110055026 14.25712856428214 5 18.284142071035518 37.843921960980495 30.540270135067534 13.331665832916459 6 13.331665832916459 37.693846923461734 34.967483741870936 14.007003501750875 7 12.156078039019508 16.50825412706353 54.527263631815906 16.808404202101052 8 14.7823911955978 22.11105552776388 42.271135567783894 20.83541770885443 9 16.10805402701351 24.212106053026513 40.09504752376188 19.5847923961981 10-11 17.03351675837919 32.84142071035518 34.27963981990996 15.845422711355678 12-13 16.10805402701351 24.72486243121561 40.73286643321661 18.434217108554275 14-15 14.494747373686842 27.01350675337669 42.746373186593296 15.74537268634317 16-17 15.982991495747875 27.688844422211105 40.59529764882441 15.732866433216607 18-19 15.0200100050025 28.35167583791896 40.64532266133066 15.982991495747875 20-21 15.070035017508754 28.70185092546273 39.1695847923962 17.058529264632316 22-23 15.670335167583794 29.5647823911956 38.71935967983992 16.04552276138069 24-25 17.083541770885443 30.265132566283143 36.255627813906955 16.395697848924463 26-27 17.435897435897434 31.469668542839273 34.09631019387117 16.99812382739212 28-29 17.983991995998 31.45322661330665 34.05452726363182 16.50825412706353 30-31 18.084042021010504 31.62831415707854 33.49174587293647 16.795897948974485 32-33 18.49906191369606 31.6072545340838 32.37023139462164 17.5234521575985 34-35 18.123827392120077 31.6072545340838 32.607879924953096 17.661038148843026 36-37 17.78028028028028 31.994494494494496 32.469969969969966 17.755255255255257 38-39 17.808904452226113 32.403701850925465 31.86593296648324 17.921460730365183 40-41 17.996498249124564 32.191095547773884 31.52826413206603 18.284142071035518 42-43 18.51851851851852 32.80780780780781 31.26876876876877 17.404904904904907 44-45 17.15036277207906 32.08656492369277 32.21165874405804 18.551413560170126 46-47 18.613960470352765 31.923942957217914 31.123342506880157 18.33875406554916 48-49 19.954960590516702 29.97622920055048 31.69022895033154 18.378581258601276 50-51 22.269485800075064 28.875265857625422 30.902039284373828 17.953209057925683 52-53 22.006755911422495 29.500813211560118 31.577630426623294 16.914800450394093 54-55 21.440200375704446 29.74326862867877 31.133375078271758 17.683155917345022 56-57 21.75763645468202 29.794692038057086 30.558337506259388 17.889334001001505 58-59 21.51089952392884 30.16787772488098 30.06765221748935 18.253570533700827 60-61 22.40731462925852 29.33366733466934 30.210420841683366 18.048597194388776 62-63 22.45204964272283 29.23404788767707 30.099034724833896 18.214867744766202 64-65 21.889487532890612 28.993860418493924 30.459842125046986 18.656809923568478 66-67 21.616541353383457 29.912280701754383 30.476190476190478 17.99498746867168 68-69 22.523200401304237 28.931527464258842 30.649611236518687 17.895660897918233 70-71 21.785534907081868 29.85936715218483 30.072827724761424 18.282270215971874 72-73 22.61964735516373 29.005037783375315 29.521410579345087 18.85390428211587 74-75 21.774834437086092 28.052980132450333 31.443708609271525 18.728476821192054 76 25.360342812621738 0.0 46.59135177249708 28.048305414881185 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 15.0 1 8.5 2 3.5 3 5.5 4 6.0 5 4.5 6 5.0 7 8.5 8 10.0 9 8.5 10 9.0 11 12.5 12 14.0 13 14.0 14 12.0 15 13.5 16 18.0 17 24.0 18 29.0 19 32.5 20 47.5 21 60.5 22 60.5 23 65.5 24 82.0 25 96.0 26 112.0 27 141.0 28 162.5 29 173.5 30 190.0 31 212.5 32 228.0 33 224.0 34 231.5 35 247.0 36 253.0 37 254.5 38 246.0 39 218.0 40 203.0 41 187.5 42 158.0 43 154.0 44 132.5 45 99.5 46 88.0 47 84.5 48 80.0 49 63.5 50 52.5 51 53.5 52 50.5 53 46.0 54 43.0 55 36.5 56 33.0 57 30.0 58 24.5 59 20.0 60 18.0 61 16.5 62 11.0 63 11.5 64 13.0 65 11.0 66 6.0 67 3.5 68 5.0 69 3.0 70 0.5 71 1.0 72 1.0 73 1.0 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.5 80 2.0 81 1.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.5 94 1.5 95 5.5 96 9.0 97 5.0 98 3.0 99 11.5 100 18.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.525 2 0.05 3 0.05 4 0.05 5 0.05 6 0.05 7 0.05 8 0.05 9 0.05 10-11 0.05 12-13 0.05 14-15 0.05 16-17 0.05 18-19 0.05 20-21 0.05 22-23 0.05 24-25 0.05 26-27 0.0625 28-29 0.05 30-31 0.05 32-33 0.0625 34-35 0.0625 36-37 0.05002501250625312 38-39 0.0 40-41 0.0 42-43 0.05002501250625312 44-45 0.02501250625312656 46-47 0.02501250625312656 48-49 0.03751875937968985 50-51 0.012509382036527395 52-53 0.012509382036527395 54-55 0.07508447002878238 56-57 0.025031289111389236 58-59 0.10012515644555695 60-61 0.0625860558267618 62-63 0.12520345561537496 64-65 0.037575150300601205 66-67 0.01252975817566721 68-69 0.07518796992481204 70-71 0.1254075746175069 72-73 0.10065425264217413 74-75 0.13227513227513227 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 2.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 1.0 50 0.0 51 0.0 52 0.0 53 1.0 54 1.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 1.0 61 0.0 62 1.0 63 1.0 64 0.0 65 1.0 66 1.0 67 0.0 68 0.0 69 2.0 70 2.0 71 3.0 72 18.0 73 77.0 74 216.0 75 1105.0 76 2567.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.97500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64637534730993 98.625 2 0.27784794139934327 0.5499999999999999 3 0.025258903763576663 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.050517807527153326 0.75 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 18 0.44999999999999996 No Hit AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 12 0.3 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 323928 spots for SRR15142082.sra Written 323928 spots for SRR15142082.sra Read 323928 spots for SRR15142082.sra Written 323928 spots for SRR15142082.sra Read 323928 spots for SRR15142082.sra Written 323928 spots for SRR15142082.sra Read 323928 spots for SRR15142082.sra Written 323928 spots for SRR15142082.sra Read 323928 spots for SRR15142082.sra Written 323928 spots for SRR15142082.sra Read 323928 spots for SRR15142082.sra Written 323928 spots for SRR15142082.sra Read 323928 spots for SRR15142082.sra Written 323928 spots for SRR15142082.sra Read 323928 spots for SRR15142082.sra Written 323928 spots for SRR15142082.sra Read 323928 spots for SRR15142082.sra Written 323928 spots for SRR15142082.sra Read 323928 spots for SRR15142082.sra Written 323928 spots for SRR15142082.sra Read 323928 spots for SRR15142082.sra Written 323928 spots for SRR15142082.sra Read 323928 spots for SRR15142082.sra Written 323928 spots for SRR15142082.sra Read 323928 spots for SRR15142082.sra Written 323928 spots for SRR15142082.sra Read 323928 spots for SRR15142082.sra Written 323928 spots for SRR15142082.sra Read 323928 spots for SRR15142082.sra Written 323928 spots for SRR15142082.sra Read 323928 spots for SRR15142082.sra Written 323928 spots for SRR15142082.sra Read 323928 spots for SRR15142082.sra Written 323928 spots for SRR15142082.sra Read 323928 spots for SRR15142082.sra Written 323928 spots for SRR15142082.sra Read 323928 spots for SRR15142082.sra Written 323928 spots for SRR15142082.sra Read 323937 spots for SRR15142082.sra Written 323937 spots for SRR15142082.sra SRR ids: ['SRR15142082.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_kp45c09_ SRR15142082.sra spots: 6478569 blocks: [[1, 323928], [323929, 647856], [647857, 971784], [971785, 1295712], [1295713, 1619640], [1619641, 1943568], [1943569, 2267496], [2267497, 2591424], [2591425, 2915352], [2915353, 3239280], [3239281, 3563208], [3563209, 3887136], [3887137, 4211064], [4211065, 4534992], [4534993, 4858920], [4858921, 5182848], [5182849, 5506776], [5506777, 5830704], [5830705, 6154632], [6154633, 6478569]] SRR15142082 file size 1215196 SRR15142082 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR15142082 SRR15142082_1.fastq SRR15142082_2.fastq Input file: SRR15142082_1.fastq Paired file: SRR15142082_2.fastq trimmed: SRR15142082-trimmed-pair1.fastq, SRR15142082-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 05:22:39 2025 >> started Fri Feb 14 05:22:44 2025 >> done (5.150s) 6478569 read pairs processed; of these: 1216 ( 0.02%) short read pairs filtered out after trimming by size control 112948 ( 1.74%) empty read pairs filtered out after trimming by size control 6364405 (98.24%) read pairs available; of these: 23365 ( 0.37%) trimmed read pairs available after processing 6341040 (99.63%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 1 0.00% 20 0 0.00% 21 0 0.00% 22 47 0.00% 23 49 0.00% 24 43 0.00% 25 43 0.00% 26 38 0.00% 27 35 0.00% 28 31 0.00% 29 29 0.00% 30 52 0.00% 31 150 0.00% 32 89 0.00% 33 23 0.00% 34 123 0.00% 35 65 0.00% 36 79 0.00% 37 109 0.00% 38 108 0.00% 39 119 0.00% 40 171 0.00% 41 170 0.00% 42 206 0.00% 43 228 0.00% 44 225 0.00% 45 264 0.00% 46 347 0.01% 47 559 0.01% 48 451 0.01% 49 552 0.01% 50 784 0.01% 51 865 0.01% 52 692 0.01% 53 814 0.01% 54 842 0.01% 55 845 0.01% 56 990 0.02% 57 1039 0.02% 58 1131 0.02% 59 1074 0.02% 60 1108 0.02% 61 1197 0.02% 62 1318 0.02% 63 1366 0.02% 64 1508 0.02% 65 1669 0.03% 66 1759 0.03% 67 1972 0.03% 68 2071 0.03% 69 2561 0.04% 70 2800 0.04% 71 3474 0.05% 72 5831 0.09% 73 47433 0.75% 74 495577 7.79% 75 3447059 54.16% 76 2332218 36.64% 6364405 reads passed initial QC criterion=sequence-density sequence-density=0.42 sequence-density-rank=1 fanout-score=3.27 fanout-score-rank=22 prefix-density=0.44 prefix-fanout=3.1 sequence=GGGAGGCTGAGGCAGGAGAAT criterion=fanout-score sequence-density=0.15 sequence-density-rank=12 fanout-score=20.35 fanout-score-rank=1 prefix-density=0.35 prefix-fanout=8.6 sequence=ATTTTTATTTTTA criterion=sequence-density sequence-density=0.47 sequence-density-rank=1 fanout-score=2.80 fanout-score-rank=29 prefix-density=0.55 prefix-fanout=2.4 sequence=GGCTCACTGCAACCTC criterion=fanout-score sequence-density=0.11 sequence-density-rank=27 fanout-score=92.75 fanout-score-rank=1 prefix-density=0.60 prefix-fanout=16.9 sequence=TTTTTATTTTTT SRR15142082 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 05:23:27 Started mapping on | Feb 14 05:23:27 Finished on | Feb 14 05:24:59 Mapping speed, Million of reads per hour | 249.04 Number of input reads | 6364405 Average input read length | 150 UNIQUE READS: Uniquely mapped reads number | 3367004 Uniquely mapped reads % | 52.90% Average mapped length | 147.87 Number of splices: Total | 128608 Number of splices: Annotated (sjdb) | 95998 Number of splices: GT/AG | 102901 Number of splices: GC/AG | 2099 Number of splices: AT/AC | 345 Number of splices: Non-canonical | 23263 Mismatch rate per base, % | 0.70% Deletion rate per base | 0.11% Deletion average length | 1.47 Insertion rate per base | 0.12% Insertion average length | 1.34 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 137614 % of reads mapped to multiple loci | 2.16% Number of reads mapped to too many loci | 85963 % of reads mapped to too many loci | 1.35% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 43.40% % of reads unmapped: other | 0.18% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2859956 2859956 2859956 N_multimapping 137614 137614 137614 N_noFeature 1431158 1763177 2997158 N_ambiguous 48726 9274 1754 UnstrandedReadsAssigned:1887120 PositiveStrandReadsAssigned:1594553 NegativeStrandReadsAssigned:368092 Dataset is classified unstranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR15142082 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR15142082-trimmed-pair1.fastq SRR15142082-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 6,364,405 reads, 2,342,540 reads pseudoaligned [quant] estimated average fragment length: 156.64 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,005 rounds 52401 SRR15142082.ke.tsv 34699 SRR15142082.se.tsv 87100 total ==> SRR15142082.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1862.36 110 27.39 Potri.005G024800.1.v4.1 1035 879.36 14 7.38286 Potri.004G059700.1.v4.1 961 805.386 14 8.06097 Potri.007G009000.2.v4.1 1416 1260.36 0 0 Potri.003G141000.2.v4.1 2943 2787.36 32 5.32378 Potri.016G087400.1.v4.1 270 119.044 15 58.4313 Potri.015G069301.1.v4.1 564 408.762 0 0 Potri.010G195200.1.v4.1 1773 1617.36 13 3.72735 Potri.012G127500.1.v4.1 977 821.381 19 10.7269 ==> SRR15142082.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 11 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 62 Potri.001G212900.v4.1 8 Potri.001G182400.v4.1 34 Potri.001G256600.v4.1 16 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 19 SRR15142082 completed mapping pipeline successfully