Starting /dee2/code/volunteer_pipeline.sh SRR15142083 current disk space = 3085380395008 free memory = 1579919516 SRR15142083 SRAfilesize b55a664b666f7aeecf0ea2606eb77f64 SRR15142083.sra SRR15142083.sra file validated SRR15142083 is paired end SRR15142083 is conventional basespace SRR15142083 read1 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR15142083_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 38 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.573 32.0 32.0 32.0 32.0 32.0 2 30.93725 32.0 32.0 32.0 32.0 32.0 3 30.96475 32.0 32.0 32.0 32.0 32.0 4 30.95175 32.0 32.0 32.0 32.0 32.0 5 30.95975 32.0 32.0 32.0 32.0 32.0 6 34.59625 36.0 36.0 36.0 36.0 36.0 7 34.6755 36.0 36.0 36.0 36.0 36.0 8 34.747 36.0 36.0 36.0 36.0 36.0 9 34.599 36.0 36.0 36.0 36.0 36.0 10-11 34.477875 36.0 36.0 36.0 36.0 36.0 12-13 34.694125 36.0 36.0 36.0 36.0 36.0 14-15 34.640375000000006 36.0 36.0 36.0 36.0 36.0 16-17 34.5295 36.0 36.0 36.0 36.0 36.0 18-19 34.519375 36.0 36.0 36.0 36.0 36.0 20-21 34.557125 36.0 36.0 36.0 36.0 36.0 22-23 34.49325 36.0 36.0 36.0 36.0 36.0 24-25 34.528625000000005 36.0 36.0 36.0 36.0 36.0 26-27 34.3995 36.0 36.0 36.0 34.0 36.0 28-29 34.49075 36.0 36.0 36.0 36.0 36.0 30-31 34.486999999999995 36.0 36.0 36.0 36.0 36.0 32-33 34.4035 36.0 36.0 36.0 34.0 36.0 34-35 34.375125 36.0 36.0 36.0 34.0 36.0 36-37 34.99338273437485 36.0 36.0 36.0 36.0 36.0 38-39 34.91651819801476 36.0 36.0 36.0 36.0 36.0 40-41 34.76457113769407 36.0 36.0 36.0 34.0 36.0 42-43 34.82498976875176 36.0 36.0 36.0 36.0 36.0 44-45 34.77049389002037 36.0 36.0 36.0 36.0 36.0 46-47 34.74996677526778 36.0 36.0 36.0 36.0 36.0 48-49 34.66314314824248 36.0 36.0 36.0 32.0 36.0 50-51 34.64382165605096 36.0 36.0 36.0 32.0 36.0 52-53 34.58116717635066 36.0 36.0 36.0 32.0 36.0 54-55 34.47692813620303 36.0 36.0 36.0 32.0 36.0 56-57 34.49228321515239 36.0 36.0 36.0 32.0 36.0 58-59 34.35213522432623 36.0 36.0 36.0 32.0 36.0 60-61 34.37702249670322 36.0 36.0 36.0 32.0 36.0 62-63 34.282162993336755 36.0 36.0 36.0 32.0 36.0 64-65 34.19302309455182 36.0 36.0 36.0 32.0 36.0 66-67 34.27970893117151 36.0 36.0 36.0 32.0 36.0 68-69 34.23913022400717 36.0 36.0 36.0 32.0 36.0 70-71 34.189488008550704 36.0 36.0 36.0 32.0 36.0 72-73 34.13798754102484 36.0 36.0 36.0 32.0 36.0 74-75 34.006516987767526 36.0 36.0 36.0 32.0 36.0 76 33.5450723960766 36.0 36.0 36.0 27.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 70.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 2.0 23 5.0 24 11.0 25 15.0 26 30.0 27 27.0 28 56.0 29 48.0 30 78.0 31 115.0 32 152.0 33 236.0 34 598.0 35 2556.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.46788990825688 13.09887869520897 17.7624872579001 32.67074413863404 2 32.44274809160305 18.829516539440203 28.62595419847328 20.10178117048346 3 27.404580152671755 28.931297709923665 21.374045801526716 22.290076335877863 4 28.142493638676847 34.93638676844783 18.75318066157761 18.16793893129771 5 25.470737913486 38.651399491094146 22.290076335877863 13.587786259541984 6 20.89058524173028 40.101781170483456 26.03053435114504 12.977099236641221 7 14.427480916030536 28.931297709923665 42.74809160305343 13.893129770992365 8 20.050890585241728 27.989821882951656 33.3587786259542 18.60050890585242 9 22.010178117048344 25.979643765903308 34.75826972010178 17.251908396946565 10-11 19.389312977099237 42.404580152671755 23.676844783715012 14.529262086513995 12-13 20.330788804071247 31.97201017811705 30.025445292620866 17.67175572519084 14-15 20.368956743002546 34.18575063613232 29.720101781170484 15.725190839694655 16-17 19.923664122137406 34.70737913486005 28.18066157760814 17.1882951653944 18-19 20.687022900763356 33.613231552162844 27.404580152671755 18.295165394402034 20-21 20.712468193384222 34.55470737913486 27.87531806615776 16.857506361323153 22-23 20.979643765903308 34.31297709923664 27.086513994910945 17.62086513994911 24-25 20.0381679389313 34.82188295165394 28.37150127226463 16.768447837150127 26-27 20.318066157760814 33.91857506361323 28.65139949109415 17.111959287531807 28-29 20.483460559796438 35.12722646310433 27.16284987277354 17.226463104325703 30-31 20.34351145038168 34.35114503816794 27.506361323155215 17.798982188295163 32-33 19.974554707379134 35.89058524173028 27.404580152671755 16.730279898218832 34-35 19.69465648854962 34.44020356234097 28.12977099236641 17.735368956743002 36-37 19.060949230181954 35.042626288331846 28.018831912457053 17.877592569029137 38-39 20.246882158310004 33.914482056502926 27.589717485365234 18.248918299821838 40-41 20.45049630949351 33.68541613642148 29.02774242809875 16.836345125986256 42-43 19.71490390734377 34.36426116838488 28.840524373170425 17.08031055110093 44-45 19.79378818737271 35.170570264765786 28.220468431771895 16.815173116089614 46-47 19.77084659452578 35.08593252705283 28.274984086569066 16.868236791852322 48-49 19.587366276108 35.354049923586345 27.687213448802854 17.3713703515028 50-51 18.929936305732483 34.968152866242036 28.84076433121019 17.261146496815286 52-53 19.62283384301733 34.5565749235474 27.968909276248727 17.851681957186543 54-55 19.734660033167494 36.101543564230134 27.363184079601986 16.800612323000383 56-57 19.476707083599234 35.03509891512444 28.602425015954054 16.885768985322272 58-59 19.1723080853238 35.930514752841994 27.768552816451653 17.12862434538255 60-61 19.53684749232344 35.63203684749232 27.456499488229273 17.374616171954965 62-63 19.233726294208097 35.597129677088674 27.75499743721169 17.41414659149154 64-65 20.025673940949936 34.813863928112966 27.368421052631582 17.79204107830552 66-67 19.56298200514139 35.9254498714653 27.36503856041131 17.146529562982003 68-69 19.36606107460379 36.27109908516944 27.56088132972555 16.801958510501226 70-71 19.364423201136805 36.661929983206306 26.508203074538173 17.46544374111872 72-73 19.120135363790187 35.05141220877262 28.34830144474815 17.480150982689054 74-75 18.58911924307778 33.8527897592876 29.094197857242243 18.463893140392376 76 23.58710882765063 0.0 44.79215319943952 31.620737972909858 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 76.0 1 38.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 1.0 10 1.5 11 2.0 12 3.0 13 3.5 14 5.5 15 9.0 16 12.5 17 14.0 18 17.5 19 19.0 20 24.0 21 35.0 22 44.0 23 48.5 24 57.0 25 68.5 26 85.0 27 110.5 28 138.0 29 156.5 30 152.0 31 185.5 32 213.0 33 212.0 34 220.5 35 230.5 36 256.0 37 260.5 38 242.0 39 229.0 40 231.0 41 205.5 42 175.5 43 179.0 44 167.5 45 152.0 46 154.5 47 134.0 48 109.5 49 90.5 50 74.5 51 67.0 52 55.5 53 52.5 54 50.5 55 45.5 56 39.0 57 35.0 58 27.0 59 21.0 60 17.0 61 11.0 62 9.5 63 5.0 64 5.0 65 6.5 66 3.0 67 2.0 68 1.5 69 1.0 70 2.0 71 2.5 72 1.5 73 1.0 74 1.0 75 1.0 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.9 2 1.7500000000000002 3 1.7500000000000002 4 1.7500000000000002 5 1.7500000000000002 6 1.7500000000000002 7 1.7500000000000002 8 1.7500000000000002 9 1.7500000000000002 10-11 1.7500000000000002 12-13 1.7500000000000002 14-15 1.7500000000000002 16-17 1.7500000000000002 18-19 1.7500000000000002 20-21 1.7500000000000002 22-23 1.7500000000000002 24-25 1.7500000000000002 26-27 1.7500000000000002 28-29 1.7500000000000002 30-31 1.7500000000000002 32-33 1.7500000000000002 34-35 1.7500000000000002 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 70.0 36 1.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 1.0 43 0.0 44 0.0 45 0.0 46 1.0 47 1.0 48 0.0 49 1.0 50 0.0 51 1.0 52 0.0 53 3.0 54 3.0 55 0.0 56 1.0 57 1.0 58 3.0 59 3.0 60 4.0 61 4.0 62 0.0 63 6.0 64 2.0 65 1.0 66 6.0 67 3.0 68 7.0 69 3.0 70 7.0 71 11.0 72 29.0 73 106.0 74 255.0 75 1325.0 76 2141.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.5389344262295 97.15 2 0.3073770491803279 0.6 3 0.07684426229508197 0.22499999999999998 4 0.0 0.0 5 0.025614754098360656 0.125 6 0.025614754098360656 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.025614754098360656 1.7500000000000002 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 70 1.7500000000000002 No Hit AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 6 0.15 No Hit CGGCCAGTGAATTGTAATACGACTCACTATAGGGAGATCTGTATGCTGGT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.025 0.0 0.0 0.0 0.0 59 0.025 0.0 0.0 0.0 0.0 60 0.025 0.0 0.0 0.0 0.0 61 0.025 0.0 0.0 0.0 0.0 62 0.025 0.0 0.0 0.0 0.0 63 0.025 0.0 0.0 0.0 0.0 64 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR15142083 read2 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR15142083_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 37 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.72975 32.0 32.0 32.0 32.0 32.0 2 31.0545 32.0 32.0 32.0 32.0 32.0 3 31.1485 32.0 32.0 32.0 32.0 32.0 4 31.17925 32.0 32.0 32.0 32.0 32.0 5 31.29125 32.0 32.0 32.0 32.0 32.0 6 34.87825 36.0 36.0 36.0 36.0 36.0 7 34.82575 36.0 36.0 36.0 36.0 36.0 8 34.7105 36.0 36.0 36.0 36.0 36.0 9 34.70775 36.0 36.0 36.0 36.0 36.0 10-11 34.68675 36.0 36.0 36.0 36.0 36.0 12-13 34.76025 36.0 36.0 36.0 36.0 36.0 14-15 34.656625 36.0 36.0 36.0 36.0 36.0 16-17 34.67975 36.0 36.0 36.0 36.0 36.0 18-19 34.60124999999999 36.0 36.0 36.0 36.0 36.0 20-21 34.303250000000006 36.0 36.0 36.0 32.0 36.0 22-23 34.006125 36.0 36.0 36.0 32.0 36.0 24-25 33.6005 36.0 36.0 36.0 21.0 36.0 26-27 33.219875 36.0 36.0 36.0 14.0 36.0 28-29 32.867374999999996 36.0 36.0 36.0 14.0 36.0 30-31 32.699375 36.0 36.0 36.0 14.0 36.0 32-33 32.52175 36.0 36.0 36.0 14.0 36.0 34-35 32.31875 36.0 36.0 36.0 14.0 36.0 36-37 32.30156851393747 36.0 36.0 36.0 14.0 36.0 38-39 32.235971943887776 36.0 36.0 36.0 14.0 36.0 40-41 32.15743987975952 36.0 36.0 36.0 14.0 36.0 42-43 32.33658098582532 36.0 36.0 36.0 14.0 36.0 44-45 32.29140566274117 36.0 36.0 36.0 14.0 36.0 46-47 32.33876221498372 36.0 36.0 36.0 14.0 36.0 48-49 32.39548872180451 36.0 36.0 36.0 14.0 36.0 50-51 32.10428678866884 36.0 32.0 36.0 14.0 36.0 52-53 32.2323219658977 36.0 34.0 36.0 14.0 36.0 54-55 32.25467883392456 36.0 36.0 36.0 14.0 36.0 56-57 32.07874675552672 36.0 34.0 36.0 14.0 36.0 58-59 31.845822335211384 36.0 32.0 36.0 14.0 36.0 60-61 31.983777961433276 36.0 32.0 36.0 14.0 36.0 62-63 31.706779233870968 36.0 32.0 36.0 14.0 36.0 64-65 31.773915454392487 36.0 32.0 36.0 14.0 36.0 66-67 31.736024460635527 36.0 32.0 36.0 14.0 36.0 68-69 31.801914033035203 36.0 32.0 36.0 14.0 36.0 70-71 31.406356463511255 36.0 32.0 36.0 14.0 36.0 72-73 31.493760428865446 36.0 32.0 36.0 14.0 36.0 74-75 31.55529602594725 36.0 32.0 36.0 14.0 36.0 76 30.670353982300885 36.0 27.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 5.0 17 7.0 18 13.0 19 14.0 20 11.0 21 36.0 22 40.0 23 76.0 24 88.0 25 108.0 26 109.0 27 115.0 28 110.0 29 96.0 30 105.0 31 119.0 32 156.0 33 291.0 34 913.0 35 1581.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.05123053741838 15.494726268206932 29.306880964339527 27.14716223003516 2 19.709491610318057 18.90808915602304 46.8069120961683 14.575507137490609 3 19.208615076383673 20.26045579764588 44.953668920611065 15.577260205359378 4 25.41948409717005 26.59654395191585 33.809166040571 14.1748059103431 5 21.21212121212121 28.70022539444027 36.989732031054345 13.097921362384172 6 14.87603305785124 31.02930127723516 39.86977210117706 14.224893563736538 7 12.396694214876034 12.8725269221137 59.25369396443777 15.477084898572501 8 18.80791384923616 18.23190583521162 43.125469571750564 19.834710743801654 9 18.607563235662408 18.933132982719762 43.075381918357124 19.383921863260706 10-11 18.50738792887553 26.72176308539945 39.10593538692712 15.664913598797897 12-13 16.528925619834713 20.673678938141748 45.830202854996244 16.967192587027295 14-15 15.051339844728274 22.71475081392437 47.00726270974205 15.226646631605309 16-17 15.013774104683195 22.451790633608816 46.04307538191836 16.491359879789634 18-19 15.076383671424995 22.501878287002253 46.33107938893063 16.090658652642123 20-21 16.85449536689206 23.22814926120711 43.87678437265214 16.040570999248686 22-23 16.766841973453545 24.567993989481593 41.785624843476086 16.87953919358878 24-25 17.26771850738793 25.7450538442274 40.320560981718 16.666666666666664 26-27 18.369646882043575 26.69671925870273 37.51565239168545 17.417981467568243 28-29 18.720260455797646 26.22088655146506 37.52817430503381 17.530678687703478 30-31 18.87052341597796 26.408715251690456 36.75181567743551 17.968945654896068 32-33 18.59504132231405 26.258452291510142 36.5389431505134 18.607563235662408 34-35 18.795391935887803 27.61081893313298 35.937891309792136 17.65589782118708 36-37 19.852204408817638 27.367234468937873 34.6192384769539 18.161322645290582 38-39 18.236472945891784 28.34418837675351 35.22044088176352 18.198897795591183 40-41 19.05060120240481 27.655310621242485 34.59418837675351 18.699899799599198 42-43 18.955149085442244 28.30117764971185 34.71561012277625 18.028063142069655 44-45 18.483709273182956 27.58145363408521 35.81453634085213 18.1203007518797 46-47 20.135321388297207 26.776093221400828 34.419245708557824 18.669339681744145 48-49 21.606717633788694 26.557212683293645 34.05188620127835 17.784183481639303 50-51 22.887941840060165 24.95612935572825 34.10629230383555 18.049636500376035 52-53 23.35757271815446 24.72417251755266 34.089769307923774 17.82848545636911 54-55 23.508727866382017 24.81476830340324 34.30867763405752 17.36782619615723 56-57 23.037306870996105 25.097349579198593 33.85253108905916 18.01281246074614 58-59 23.15524827152734 25.93337523570082 32.54556882463859 18.36580766813325 60-61 22.460027697343573 26.02291325695581 33.81593856225608 17.701120483444544 62-63 23.278688524590162 25.83858764186633 31.84110970996217 19.041614123581336 64-65 23.042929292929294 25.467171717171716 33.5479797979798 17.941919191919194 66-67 23.480348793125234 25.249589283457603 33.41337040313409 17.85669152028308 68-69 23.22310908399848 25.275560623337135 33.52337514253136 17.977955150133027 70-71 23.326133909287257 25.42243679329183 32.70232499047135 18.549104306949562 72-73 22.98644847864996 25.172590130401435 33.20122730759397 18.639734083354643 74-75 22.822623473181096 23.977695167286246 33.82899628252788 19.37068507700478 76 27.101769911504427 0.0 47.75073746312684 25.147492625368734 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 10.0 1 5.0 2 1.5 3 2.0 4 1.0 5 2.5 6 3.0 7 1.5 8 1.0 9 3.5 10 4.0 11 4.0 12 6.0 13 6.0 14 7.5 15 8.0 16 12.5 17 19.0 18 25.0 19 29.5 20 38.5 21 49.5 22 56.0 23 63.0 24 72.5 25 85.0 26 105.0 27 129.0 28 149.5 29 163.0 30 182.0 31 198.0 32 203.5 33 207.5 34 228.0 35 250.5 36 237.0 37 221.0 38 234.5 39 232.5 40 215.0 41 189.5 42 155.5 43 156.5 44 147.5 45 127.0 46 122.5 47 121.5 48 113.0 49 88.0 50 74.5 51 66.5 52 51.0 53 48.5 54 52.5 55 49.5 56 41.0 57 31.5 58 24.0 59 22.5 60 17.5 61 11.0 62 10.0 63 9.0 64 7.5 65 6.5 66 5.5 67 4.0 68 2.0 69 3.5 70 5.5 71 4.5 72 2.0 73 0.5 74 1.0 75 1.0 76 0.5 77 0.5 78 0.5 79 0.0 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 1.0 87 2.0 88 1.5 89 1.0 90 0.5 91 0.0 92 0.0 93 1.0 94 2.5 95 3.5 96 4.0 97 4.5 98 4.0 99 7.0 100 11.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.44999999999999996 2 0.17500000000000002 3 0.17500000000000002 4 0.17500000000000002 5 0.17500000000000002 6 0.17500000000000002 7 0.17500000000000002 8 0.17500000000000002 9 0.17500000000000002 10-11 0.17500000000000002 12-13 0.17500000000000002 14-15 0.17500000000000002 16-17 0.17500000000000002 18-19 0.17500000000000002 20-21 0.17500000000000002 22-23 0.17500000000000002 24-25 0.17500000000000002 26-27 0.17500000000000002 28-29 0.17500000000000002 30-31 0.17500000000000002 32-33 0.17500000000000002 34-35 0.17500000000000002 36-37 0.012523481527864746 38-39 0.0 40-41 0.0 42-43 0.012526619065514218 44-45 0.025056376847907794 46-47 0.012528188423953897 48-49 0.012531328320802004 50-51 0.0 52-53 0.0 54-55 0.050207104305259195 56-57 0.02511616225040814 58-59 0.025135101168782207 60-61 0.025173064820641914 62-63 0.07560483870967742 64-65 0.025246149962130777 66-67 0.0 68-69 0.050652146384703056 70-71 0.07617113114129745 72-73 0.051111679018655765 74-75 0.09285051067780872 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 7.0 36 1.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 1.0 43 0.0 44 0.0 45 0.0 46 0.0 47 1.0 48 0.0 49 1.0 50 0.0 51 1.0 52 0.0 53 3.0 54 3.0 55 0.0 56 1.0 57 1.0 58 3.0 59 3.0 60 3.0 61 3.0 62 0.0 63 6.0 64 2.0 65 1.0 66 5.0 67 2.0 68 7.0 69 3.0 70 7.0 71 12.0 72 20.0 73 44.0 74 179.0 75 968.0 76 2712.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.1 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64682139253279 98.75 2 0.20181634712411706 0.4 3 0.050454086781029264 0.15 4 0.050454086781029264 0.2 5 0.0 0.0 6 0.0 0.0 7 0.025227043390514632 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.025227043390514632 0.325 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 13 0.325 No Hit NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 309611 spots for SRR15142083.sra Written 309611 spots for SRR15142083.sra Read 309611 spots for SRR15142083.sra Written 309611 spots for SRR15142083.sra Read 309611 spots for SRR15142083.sra Written 309611 spots for SRR15142083.sra Read 309611 spots for SRR15142083.sra Written 309611 spots for SRR15142083.sra Read 309611 spots for SRR15142083.sra Written 309611 spots for SRR15142083.sra Read 309611 spots for SRR15142083.sra Written 309611 spots for SRR15142083.sra Read 309611 spots for SRR15142083.sra Written 309611 spots for SRR15142083.sra Read 309611 spots for SRR15142083.sra Written 309611 spots for SRR15142083.sra Read 309611 spots for SRR15142083.sra Written 309611 spots for SRR15142083.sra Read 309611 spots for SRR15142083.sra Written 309611 spots for SRR15142083.sra Read 309611 spots for SRR15142083.sra Written 309611 spots for SRR15142083.sra Read 309611 spots for SRR15142083.sra Written 309611 spots for SRR15142083.sra Read 309611 spots for SRR15142083.sra Written 309611 spots for SRR15142083.sra Read 309611 spots for SRR15142083.sra Written 309611 spots for SRR15142083.sra Read 309611 spots for SRR15142083.sra Written 309611 spots for SRR15142083.sra Read 309613 spots for SRR15142083.sra Written 309613 spots for SRR15142083.sra Read 309611 spots for SRR15142083.sra Written 309611 spots for SRR15142083.sra Read 309611 spots for SRR15142083.sra Written 309611 spots for SRR15142083.sra Read 309611 spots for SRR15142083.sra Written 309611 spots for SRR15142083.sra Read 309611 spots for SRR15142083.sra Written 309611 spots for SRR15142083.sra SRR ids: ['SRR15142083.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_i8me0lpx SRR15142083.sra spots: 6192222 blocks: [[1, 309611], [309612, 619222], [619223, 928833], [928834, 1238444], [1238445, 1548055], [1548056, 1857666], [1857667, 2167277], [2167278, 2476888], [2476889, 2786499], [2786500, 3096110], [3096111, 3405721], [3405722, 3715332], [3715333, 4024943], [4024944, 4334554], [4334555, 4644165], [4644166, 4953776], [4953777, 5263387], [5263388, 5572998], [5572999, 5882609], [5882610, 6192222]] SRR15142083 file size 1063441 SRR15142083 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR15142083 SRR15142083_1.fastq SRR15142083_2.fastq Input file: SRR15142083_1.fastq Paired file: SRR15142083_2.fastq trimmed: SRR15142083-trimmed-pair1.fastq, SRR15142083-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 06:14:12 2025 >> started Fri Feb 14 06:14:17 2025 >> done (4.879s) 6192222 read pairs processed; of these: 896 ( 0.01%) short read pairs filtered out after trimming by size control 1318172 (21.29%) empty read pairs filtered out after trimming by size control 4873154 (78.70%) read pairs available; of these: 13627 ( 0.28%) trimmed read pairs available after processing 4859527 (99.72%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 2 0.00% 20 1 0.00% 21 0 0.00% 22 20 0.00% 23 30 0.00% 24 20 0.00% 25 17 0.00% 26 27 0.00% 27 19 0.00% 28 47 0.00% 29 58 0.00% 30 130 0.00% 31 397 0.01% 32 280 0.01% 33 65 0.00% 34 376 0.01% 35 253 0.01% 36 247 0.01% 37 329 0.01% 38 356 0.01% 39 392 0.01% 40 451 0.01% 41 539 0.01% 42 534 0.01% 43 634 0.01% 44 698 0.01% 45 768 0.02% 46 873 0.02% 47 1038 0.02% 48 1138 0.02% 49 1273 0.03% 50 1541 0.03% 51 1672 0.03% 52 1560 0.03% 53 1766 0.04% 54 2164 0.04% 55 1965 0.04% 56 2076 0.04% 57 2298 0.05% 58 2616 0.05% 59 2788 0.06% 60 2883 0.06% 61 3246 0.07% 62 3430 0.07% 63 3905 0.08% 64 4254 0.09% 65 4703 0.10% 66 5017 0.10% 67 5840 0.12% 68 6174 0.13% 69 6963 0.14% 70 7696 0.16% 71 8840 0.18% 72 10621 0.22% 73 39824 0.82% 74 361081 7.41% 75 2588922 53.13% 76 1778291 36.49% 4873154 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=7.28 fanout-score-rank=11 prefix-density=0.66 prefix-fanout=1.8 sequence=GATCCGGAGATGTCTGAATGGGGGAACCCAGCCATCATAAGATGGTTACCTTACACTGAATACATAGGTGTATGGAGCGAACCAGGGGAACTGAAACA criterion=fanout-score sequence-density=0.05 sequence-density-rank=6 fanout-score=544.38 fanout-score-rank=1 prefix-density=0.71 prefix-fanout=40.9 sequence=AAAAAGAAAAAA criterion=sequence-density sequence-density=0.33 sequence-density-rank=1 fanout-score=7.24 fanout-score-rank=28 prefix-density=0.40 prefix-fanout=6.0 sequence=TTTTTTTTTTATTT criterion=fanout-score sequence-density=0.08 sequence-density-rank=23 fanout-score=183.33 fanout-score-rank=1 prefix-density=0.88 prefix-fanout=16.6 sequence=TTTTCTTTTTTT SRR15142083 testing PE reads STAR mapping to Ensembl genome Unpaired reads removal Started job on | Feb 14 06:16:23 Started mapping on | Feb 14 06:16:23 Finished on | Feb 14 06:18:32 Mapping speed, Million of reads per hour | 135.92 Number of input reads | 4870301 Average input read length | 130 UNIQUE READS: Uniquely mapped reads number | 362962 Uniquely mapped reads % | 7.45% Average mapped length | 128.21 Number of splices: Total | 12020 Number of splices: Annotated (sjdb) | 9500 Number of splices: GT/AG | 10273 Number of splices: GC/AG | 92 Number of splices: AT/AC | 20 Number of splices: Non-canonical | 1635 Mismatch rate per base, % | 0.80% Deletion rate per base | 0.07% Deletion average length | 1.44 Insertion rate per base | 0.10% Insertion average length | 1.34 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 27975 % of reads mapped to multiple loci | 0.57% Number of reads mapped to too many loci | 28912 % of reads mapped to too many loci | 0.59% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 91.29% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 4479428 4479428 4479428 N_multimapping 27975 27975 27975 N_noFeature 200358 255692 305906 N_ambiguous 3407 1309 376 UnstrandedReadsAssigned:159197 PositiveStrandReadsAssigned:105961 NegativeStrandReadsAssigned:56680 Dataset is classified unstranded MeadianReadLen=56 20thPercentileLength=55 echo kmer=51 SRR15142083 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR15142083-trimmed-pair1.fastq SRR15142083-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 4,870,301 reads, 332,837 reads pseudoaligned [quant] estimated average fragment length: 118.751 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 798 rounds 52401 SRR15142083.ke.tsv 34699 SRR15142083.se.tsv 87100 total ==> SRR15142083.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1900.25 0 0 Potri.005G024800.1.v4.1 1035 917.249 0 0 Potri.004G059700.1.v4.1 961 843.249 0 0 Potri.007G009000.2.v4.1 1416 1298.25 0 0 Potri.003G141000.2.v4.1 2943 2825.25 1 0.947914 Potri.016G087400.1.v4.1 270 154.716 0 0 Potri.015G069301.1.v4.1 564 446.309 0 0 Potri.010G195200.1.v4.1 1773 1655.25 27 43.6844 Potri.012G127500.1.v4.1 977 859.249 19 59.2189 ==> SRR15142083.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 0 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 0 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR15142083 completed mapping pipeline successfully