Starting /dee2/code/volunteer_pipeline.sh SRR15142085 current disk space = 3085607477248 free memory = 1449486912 SRR15142085 SRAfilesize cf25091ca14ba83973f813e1ace3df87 SRR15142085.sra SRR15142085.sra file validated SRR15142085 is paired end SRR15142085 is conventional basespace SRR15142085 read1 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR15142085_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 37 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.7535 32.0 32.0 32.0 32.0 32.0 2 31.12575 32.0 32.0 32.0 32.0 32.0 3 31.19225 32.0 32.0 32.0 32.0 32.0 4 31.255 32.0 32.0 32.0 32.0 32.0 5 31.3175 32.0 32.0 32.0 32.0 32.0 6 34.88725 36.0 36.0 36.0 36.0 36.0 7 34.8615 36.0 36.0 36.0 36.0 36.0 8 34.9595 36.0 36.0 36.0 36.0 36.0 9 34.971 36.0 36.0 36.0 36.0 36.0 10-11 34.815875 36.0 36.0 36.0 36.0 36.0 12-13 34.95075 36.0 36.0 36.0 36.0 36.0 14-15 34.824125 36.0 36.0 36.0 36.0 36.0 16-17 34.870625000000004 36.0 36.0 36.0 36.0 36.0 18-19 34.902625 36.0 36.0 36.0 36.0 36.0 20-21 34.824375 36.0 36.0 36.0 36.0 36.0 22-23 34.842749999999995 36.0 36.0 36.0 36.0 36.0 24-25 34.854375 36.0 36.0 36.0 36.0 36.0 26-27 34.718500000000006 36.0 36.0 36.0 36.0 36.0 28-29 34.697125 36.0 36.0 36.0 36.0 36.0 30-31 34.718 36.0 36.0 36.0 36.0 36.0 32-33 34.655125 36.0 36.0 36.0 36.0 36.0 34-35 34.6355 36.0 36.0 36.0 36.0 36.0 36-37 34.96728145528044 36.0 36.0 36.0 36.0 36.0 38-39 34.909044972208186 36.0 36.0 36.0 36.0 36.0 40-41 34.87392622536635 36.0 36.0 36.0 36.0 36.0 42-43 34.73383021728145 36.0 36.0 36.0 34.0 36.0 44-45 34.66649823143001 36.0 36.0 36.0 34.0 36.0 46-47 34.73938858009096 36.0 36.0 36.0 36.0 36.0 48-49 34.65639211723092 36.0 36.0 36.0 32.0 36.0 50-51 34.559758275849916 36.0 36.0 36.0 32.0 36.0 52-53 34.52907711757269 36.0 36.0 36.0 32.0 36.0 54-55 34.38394437420986 36.0 36.0 36.0 32.0 36.0 56-57 34.443615676359045 36.0 36.0 36.0 32.0 36.0 58-59 34.168037775761334 36.0 36.0 36.0 32.0 36.0 60-61 34.296483683278524 36.0 36.0 36.0 32.0 36.0 62-63 34.16696861836088 36.0 36.0 36.0 32.0 36.0 64-65 34.07876460201921 36.0 36.0 36.0 32.0 36.0 66-67 34.13956433637284 36.0 36.0 36.0 32.0 36.0 68-69 33.991367375475704 36.0 36.0 36.0 32.0 36.0 70-71 34.04639140571183 36.0 36.0 36.0 32.0 36.0 72-73 33.938957777490955 36.0 36.0 36.0 32.0 36.0 74-75 33.771946761847424 36.0 36.0 36.0 27.0 36.0 76 33.64793529161345 36.0 36.0 36.0 27.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 42.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 2.0 21 1.0 22 2.0 23 3.0 24 15.0 25 22.0 26 23.0 27 37.0 28 50.0 29 62.0 30 81.0 31 112.0 32 152.0 33 214.0 34 578.0 35 2604.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.14916286149163 12.252663622526635 15.981735159817351 35.61643835616438 2 31.152097018696313 16.624557857503792 33.678625568468924 18.544719555330975 3 27.18544719555331 24.30520464881253 23.193532086912583 25.315816068721574 4 28.347650328448708 29.636179888832743 22.713491662455787 19.302678120262758 5 26.57908034360788 35.371399696816574 23.648307225871655 14.401212733703892 6 20.13643254168772 37.39262253663466 28.47397675593734 13.996968165740272 7 13.94643759474482 29.40879231935321 44.26478019201617 12.379989893885801 8 17.812026275896915 26.705406771096513 36.609398686205154 18.873168266801414 9 19.55533097524002 24.532592218292066 38.35270338554826 17.559373420919655 10-11 19.984840828701365 39.047498736735726 26.57908034360788 14.388580090955028 12-13 20.730166750884287 30.002526528549772 31.291056088933804 17.976250631632137 14-15 19.669024759979788 32.41536129358262 32.13744315310763 15.778170793329965 16-17 20.300656897422943 32.895401718039416 29.850934815563416 16.95300656897423 18-19 19.567963617988884 33.046993431025776 30.255179383527036 17.12986356745831 20-21 20.515411824153613 32.20060636685195 30.040424456796362 17.24355735219808 22-23 20.3132895401718 33.33754421424962 29.749873673572512 16.599292572006064 24-25 19.75745325922183 33.628094997473475 29.636179888832743 16.978271854471956 26-27 20.111167256189997 33.249115715007584 30.545730166750886 16.09398686205154 28-29 19.593228903486608 33.12278928751895 30.634158665992928 16.649823143001516 30-31 20.528044466902475 32.41536129358262 30.24254674077817 16.814047498736738 32-33 20.654370894391107 32.84487114704396 29.775138959070237 16.725618999494692 34-35 19.17635169277413 32.55432036382011 30.722587165234966 17.546740778170793 36-37 20.33855482566953 33.88074785245073 29.421424962102073 16.359272359777666 38-39 19.959575543203638 31.74583122789287 30.848913592723598 17.44567963617989 40-41 20.022738756947952 32.680646791308746 29.83830217281455 17.45831227892875 42-43 19.618494188984336 32.579585649317835 29.926730672056596 17.875189489641233 44-45 19.71955533097524 33.52703385548257 29.87620010106114 16.87721071248105 46-47 19.694290045477516 33.35017685699848 30.343607882769074 16.611925214754926 48-49 19.454269833249114 33.034360788276906 30.533097524002024 16.978271854471956 50-51 19.82562547384382 32.97952994692949 30.25018953752843 16.944655041698255 52-53 19.63337547408344 33.13527180783818 30.581542351453855 16.649810366624525 54-55 18.735777496839443 33.76738305941846 30.02528445006321 17.471554993678886 56-57 19.532237673830593 33.4134007585335 29.835651074589126 17.21871049304678 58-59 19.77493994183841 32.962447844228095 29.839423441648755 17.42318877228474 60-61 19.22590437642297 33.37971161143435 30.660258031874527 16.73412598026815 62-63 18.874130297280203 33.86464263124604 30.575585072738775 16.68564199873498 64-65 19.678358870457135 33.70900341901988 29.91009244016715 16.70254527035583 66-67 19.6048632218845 33.40932117527862 30.002532928064845 16.98328267477204 68-69 18.482391689891056 33.797821129972135 29.718773752216876 18.00101342791994 70-71 19.736341741665612 33.40093801495754 29.965775129927746 16.896945113449107 72-73 19.23419412288513 32.88385701564687 30.199720137387096 17.682228724080908 74-75 19.07947551511908 31.375434840781374 31.843724913031846 17.701364731067702 76 23.49936143039591 0.0 49.510429970200086 26.990208599404003 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 60.0 1 32.5 2 5.5 3 6.0 4 6.0 5 7.5 6 8.5 7 6.5 8 5.0 9 6.0 10 7.0 11 9.0 12 11.5 13 10.0 14 11.5 15 12.0 16 12.0 17 17.5 18 22.0 19 26.0 20 31.5 21 36.5 22 38.5 23 46.5 24 60.5 25 75.5 26 94.0 27 111.5 28 124.5 29 133.0 30 156.0 31 178.5 32 189.5 33 201.0 34 228.5 35 234.0 36 219.5 37 227.0 38 217.0 39 203.5 40 205.5 41 211.0 42 203.0 43 179.0 44 153.0 45 144.5 46 143.5 47 122.5 48 109.0 49 105.5 50 93.0 51 73.5 52 65.5 53 68.5 54 61.5 55 50.5 56 45.0 57 40.5 58 30.5 59 22.5 60 17.0 61 12.5 62 10.5 63 9.5 64 10.0 65 9.0 66 5.5 67 4.0 68 3.5 69 3.0 70 3.0 71 2.5 72 1.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.4500000000000002 2 1.05 3 1.05 4 1.05 5 1.05 6 1.05 7 1.05 8 1.05 9 1.05 10-11 1.05 12-13 1.05 14-15 1.05 16-17 1.05 18-19 1.05 20-21 1.05 22-23 1.05 24-25 1.05 26-27 1.05 28-29 1.05 30-31 1.05 32-33 1.05 34-35 1.05 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 42.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 2.0 51 1.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 1.0 59 1.0 60 0.0 61 0.0 62 1.0 63 3.0 64 1.0 65 0.0 66 0.0 67 0.0 68 2.0 69 0.0 70 3.0 71 5.0 72 15.0 73 73.0 74 226.0 75 1275.0 76 2349.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.55 #Duplication Level Percentage of deduplicated Percentage of total 1 99.25679138903126 96.825 2 0.5381855458739108 1.05 3 0.0768836494105587 0.22499999999999998 4 0.0 0.0 5 0.05125576627370579 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0768836494105587 1.6500000000000001 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 42 1.05 No Hit AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 14 0.35000000000000003 No Hit CGGCCAGTGAATTGTAATACGACTCACTATAGGGAGATCTGTATGCTGGT 10 0.25 No Hit CTGGAATCTTAGGTAAATCCGGGATTCTAAGGCCGAGAGCTGATGACGAG 5 0.125 No Hit GTGAATTGTAATACGACTCACTATAGGGAGATCTGTATGCTGGTTTTTTT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR15142085 read2 length is 50-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR15142085_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50-76 %GC 36 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.59825 32.0 32.0 32.0 32.0 32.0 2 30.996 32.0 32.0 32.0 32.0 32.0 3 31.18875 32.0 32.0 32.0 32.0 32.0 4 31.163 32.0 32.0 32.0 32.0 32.0 5 31.22975 32.0 32.0 32.0 32.0 32.0 6 34.91625 36.0 36.0 36.0 36.0 36.0 7 34.966 36.0 36.0 36.0 36.0 36.0 8 34.951 36.0 36.0 36.0 36.0 36.0 9 34.86975 36.0 36.0 36.0 36.0 36.0 10-11 34.80625 36.0 36.0 36.0 36.0 36.0 12-13 34.91225 36.0 36.0 36.0 36.0 36.0 14-15 34.844375 36.0 36.0 36.0 36.0 36.0 16-17 34.96575 36.0 36.0 36.0 36.0 36.0 18-19 34.889624999999995 36.0 36.0 36.0 36.0 36.0 20-21 34.63975 36.0 36.0 36.0 34.0 36.0 22-23 34.370000000000005 36.0 36.0 36.0 32.0 36.0 24-25 33.884 36.0 36.0 36.0 32.0 36.0 26-27 33.387125 36.0 36.0 36.0 21.0 36.0 28-29 33.210875 36.0 36.0 36.0 14.0 36.0 30-31 33.109750000000005 36.0 36.0 36.0 14.0 36.0 32-33 32.894 36.0 36.0 36.0 14.0 36.0 34-35 32.776250000000005 36.0 36.0 36.0 14.0 36.0 36-37 32.548625 36.0 36.0 36.0 14.0 36.0 38-39 32.598124999999996 36.0 36.0 36.0 14.0 36.0 40-41 32.598749999999995 36.0 36.0 36.0 14.0 36.0 42-43 32.443749999999994 36.0 36.0 36.0 14.0 36.0 44-45 32.664375 36.0 36.0 36.0 14.0 36.0 46-47 32.497 36.0 36.0 36.0 14.0 36.0 48-49 32.3245 36.0 36.0 36.0 14.0 36.0 50-51 32.062507941470734 36.0 32.0 36.0 14.0 36.0 52-53 32.12509382036527 36.0 34.0 36.0 14.0 36.0 54-55 32.325118839129345 36.0 36.0 36.0 14.0 36.0 56-57 32.026895171378534 36.0 34.0 36.0 14.0 36.0 58-59 31.995254730587483 36.0 32.0 36.0 14.0 36.0 60-61 31.935043804755942 36.0 32.0 36.0 14.0 36.0 62-63 31.739498640952668 36.0 32.0 36.0 14.0 36.0 64-65 31.52218359023812 36.0 32.0 36.0 14.0 36.0 66-67 31.558020050125315 36.0 32.0 36.0 14.0 36.0 68-69 31.482319012174365 36.0 32.0 36.0 14.0 36.0 70-71 31.349489230744442 36.0 32.0 36.0 14.0 36.0 72-73 31.34776620224931 36.0 32.0 36.0 14.0 36.0 74-75 31.40161483517453 36.0 32.0 36.0 14.0 36.0 76 30.678812922614576 36.0 27.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 0.0 13 0.0 14 1.0 15 0.0 16 0.0 17 3.0 18 7.0 19 5.0 20 10.0 21 21.0 22 48.0 23 54.0 24 92.0 25 108.0 26 111.0 27 129.0 28 116.0 29 93.0 30 92.0 31 119.0 32 173.0 33 372.0 34 997.0 35 1448.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.936619718309856 17.95774647887324 21.654929577464788 33.45070422535211 2 19.25 23.05 44.074999999999996 13.625000000000002 3 17.549999999999997 25.35 40.65 16.45 4 22.35 30.125 32.625 14.899999999999999 5 21.325 31.45 34.300000000000004 12.925 6 14.000000000000002 33.900000000000006 38.05 14.05 7 12.425 16.275000000000002 55.725 15.575 8 16.325 21.325 43.525000000000006 18.825 9 17.125 20.349999999999998 43.6 18.925 10-11 16.775000000000002 30.412499999999998 37.175000000000004 15.6375 12-13 15.3625 22.825 43.1625 18.65 14-15 15.2 25.15 44.4125 15.2375 16-17 14.4375 26.0 43.7125 15.85 18-19 15.275 26.075 42.412499999999994 16.2375 20-21 16.162499999999998 26.8125 40.6875 16.3375 22-23 15.951993999249906 27.590948868608578 40.59257407175897 15.864483060382547 24-25 16.925 28.725 38.2875 16.0625 26-27 16.74168542135534 29.00725181295324 37.90947736934234 16.341585396349085 28-29 17.60220027503438 28.391048881110137 37.05463182897862 16.95211901487686 30-31 18.275 28.762500000000003 34.75 18.212500000000002 32-33 17.829457364341085 30.095023755938982 34.67116779194799 17.404351087771943 34-35 19.042260565141287 28.66966741685421 34.74618654663666 17.54188547136784 36-37 18.3295823955989 30.220055013753438 33.69592398099525 17.75443860965241 38-39 18.11702925731433 29.75743935983996 34.08352088022005 18.042010502625658 40-41 18.4898112264033 29.416177022127766 34.15426928366046 17.939742467808475 42-43 18.642160540135034 29.782445611402853 34.32108027006752 17.254313578394598 44-45 17.891972993248313 31.695423855963988 33.79594898724681 16.616654163540886 46-47 18.967241810452613 29.057264316079017 33.04576144036009 18.929732433108278 48-49 20.330082520630157 28.59464866216554 32.883220805201304 18.192048012003 50-51 21.623311655827916 27.463731865932967 33.59179589794897 17.321160580290147 52-53 22.57257257257257 27.45245245245245 32.45745745745746 17.51751751751752 54-55 21.433933933933936 27.314814814814813 32.9954954954955 18.255755755755757 56-57 21.934434434434436 27.627627627627625 32.74524524524524 17.692692692692695 58-59 21.386559879864848 28.769866099361778 32.01101238893755 17.832561631835816 60-61 22.083124687030544 27.01552328492739 33.71306960440661 17.188282423635453 62-63 23.350444472267434 27.29435332415175 32.06460498309753 17.290597220483285 64-65 23.93483709273183 27.00501253132832 31.416040100250626 17.644110275689222 66-67 22.16094259212835 26.936575582852846 31.98796690899975 18.91451491601905 68-69 23.094282848545635 26.76780341023069 32.64794383149449 17.48996990972919 70-71 23.26223337515684 26.73776662484316 31.957340025094105 18.0426599749059 72-73 22.90748898678414 26.97293895531781 32.02013845185651 18.099433606041533 74-75 22.18430034129693 25.64977684431609 32.97453399842478 19.191388815962195 76 25.169045830202858 0.0 48.23441021788129 26.59654395191585 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 8.0 1 8.0 2 5.0 3 6.5 4 11.0 5 8.5 6 9.5 7 9.5 8 6.5 9 8.5 10 9.5 11 9.5 12 10.0 13 9.5 14 10.5 15 14.5 16 20.5 17 27.5 18 32.5 19 34.0 20 40.0 21 48.5 22 62.0 23 80.5 24 92.0 25 101.0 26 112.5 27 131.0 28 161.0 29 178.0 30 184.5 31 199.5 32 202.5 33 208.0 34 216.0 35 222.5 36 229.0 37 230.5 38 219.5 39 209.0 40 204.5 41 178.0 42 153.5 43 145.5 44 132.5 45 115.5 46 111.5 47 111.0 48 95.0 49 78.5 50 70.0 51 63.5 52 64.0 53 61.0 54 52.0 55 46.5 56 36.5 57 28.0 58 27.0 59 22.5 60 17.0 61 12.0 62 9.5 63 7.0 64 7.5 65 7.0 66 4.5 67 4.0 68 3.5 69 3.0 70 1.5 71 1.0 72 1.5 73 1.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.5 79 1.0 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.5 90 0.5 91 0.5 92 1.0 93 1.0 94 1.5 95 2.0 96 2.0 97 3.5 98 4.0 99 9.5 100 16.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.6 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0125 24-25 0.0 26-27 0.025 28-29 0.0125 30-31 0.0 32-33 0.025 34-35 0.025 36-37 0.025 38-39 0.025 40-41 0.0125 42-43 0.025 44-45 0.025 46-47 0.025 48-49 0.025 50-51 0.025006251562890724 52-53 0.02501876407305479 54-55 0.02501876407305479 56-57 0.02501876407305479 58-59 0.025021894157387717 60-61 0.025031289111389236 62-63 0.025034422330704718 64-65 0.025056376847907794 66-67 0.02506265664160401 68-69 0.0250689395838556 70-71 0.025087807325639738 72-73 0.025166729583490623 74-75 0.026246719160104987 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 50 2.0 51 1.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 1.0 59 1.0 60 0.0 61 0.0 62 1.0 63 2.0 64 2.0 65 0.0 66 0.0 67 0.0 68 2.0 69 0.0 70 4.0 71 5.0 72 11.0 73 60.0 74 196.0 75 1050.0 76 2662.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.3421052631579 98.15 2 0.5060728744939271 1.0 3 0.07591093117408906 0.22499999999999998 4 0.025303643724696356 0.1 5 0.025303643724696356 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025303643724696356 0.4 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 16 0.4 No Hit AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 347438 spots for SRR15142085.sra Written 347438 spots for SRR15142085.sra Read 347438 spots for SRR15142085.sra Written 347438 spots for SRR15142085.sra Read 347438 spots for SRR15142085.sra Written 347438 spots for SRR15142085.sra Read 347438 spots for SRR15142085.sra Written 347438 spots for SRR15142085.sra Read 347438 spots for SRR15142085.sra Written 347438 spots for SRR15142085.sra Read 347438 spots for SRR15142085.sra Written 347438 spots for SRR15142085.sra Read 347438 spots for SRR15142085.sra Written 347438 spots for SRR15142085.sra Read 347438 spots for SRR15142085.sra Written 347438 spots for SRR15142085.sra Read 347438 spots for SRR15142085.sra Written 347438 spots for SRR15142085.sra Read 347438 spots for SRR15142085.sra Written 347438 spots for SRR15142085.sra Read 347438 spots for SRR15142085.sra Written 347438 spots for SRR15142085.sra Read 347438 spots for SRR15142085.sra Written 347438 spots for SRR15142085.sra Read 347438 spots for SRR15142085.sra Written 347438 spots for SRR15142085.sra Read 347438 spots for SRR15142085.sra Written 347438 spots for SRR15142085.sra Read 347438 spots for SRR15142085.sra Written 347438 spots for SRR15142085.sra Read 347438 spots for SRR15142085.sra Written 347438 spots for SRR15142085.sra Read 347443 spots for SRR15142085.sra Written 347443 spots for SRR15142085.sra Read 347438 spots for SRR15142085.sra Written 347438 spots for SRR15142085.sra Read 347438 spots for SRR15142085.sra Written 347438 spots for SRR15142085.sra Read 347438 spots for SRR15142085.sra Written 347438 spots for SRR15142085.sra SRR ids: ['SRR15142085.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_00sztp4j SRR15142085.sra spots: 6948765 blocks: [[1, 347438], [347439, 694876], [694877, 1042314], [1042315, 1389752], [1389753, 1737190], [1737191, 2084628], [2084629, 2432066], [2432067, 2779504], [2779505, 3126942], [3126943, 3474380], [3474381, 3821818], [3821819, 4169256], [4169257, 4516694], [4516695, 4864132], [4864133, 5211570], [5211571, 5559008], [5559009, 5906446], [5906447, 6253884], [6253885, 6601322], [6601323, 6948765]] SRR15142085 file size 1303260 SRR15142085 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR15142085 SRR15142085_1.fastq SRR15142085_2.fastq Input file: SRR15142085_1.fastq Paired file: SRR15142085_2.fastq trimmed: SRR15142085-trimmed-pair1.fastq, SRR15142085-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 05:50:21 2025 >> started Fri Feb 14 05:50:26 2025 >> done (5.553s) 6948765 read pairs processed; of these: 1280 ( 0.02%) short read pairs filtered out after trimming by size control 119004 ( 1.71%) empty read pairs filtered out after trimming by size control 6828481 (98.27%) read pairs available; of these: 39055 ( 0.57%) trimmed read pairs available after processing 6789426 (99.43%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 2 0.00% 20 4 0.00% 21 1 0.00% 22 60 0.00% 23 31 0.00% 24 41 0.00% 25 39 0.00% 26 32 0.00% 27 30 0.00% 28 31 0.00% 29 45 0.00% 30 44 0.00% 31 152 0.00% 32 127 0.00% 33 32 0.00% 34 159 0.00% 35 110 0.00% 36 114 0.00% 37 111 0.00% 38 124 0.00% 39 155 0.00% 40 209 0.00% 41 214 0.00% 42 241 0.00% 43 314 0.00% 44 301 0.00% 45 365 0.01% 46 455 0.01% 47 678 0.01% 48 579 0.01% 49 735 0.01% 50 908 0.01% 51 1066 0.02% 52 827 0.01% 53 1042 0.02% 54 1088 0.02% 55 1022 0.01% 56 1174 0.02% 57 1289 0.02% 58 1436 0.02% 59 1402 0.02% 60 1361 0.02% 61 1564 0.02% 62 1623 0.02% 63 1647 0.02% 64 1980 0.03% 65 2065 0.03% 66 2189 0.03% 67 2494 0.04% 68 2653 0.04% 69 3192 0.05% 70 3373 0.05% 71 4364 0.06% 72 7029 0.10% 73 46430 0.68% 74 518983 7.60% 75 3693976 54.10% 76 2516769 36.86% 6828481 reads passed initial QC criterion=sequence-density sequence-density=0.10 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=32 prefix-density=0.10 prefix-fanout=2.0 sequence=TCCAAGGCTAAATAC criterion=fanout-score sequence-density=0.04 sequence-density-rank=20 fanout-score=585.40 fanout-score-rank=1 prefix-density=0.54 prefix-fanout=38.5 sequence=AAAAATAAAAAA criterion=sequence-density sequence-density=0.31 sequence-density-rank=1 fanout-score=2.25 fanout-score-rank=27 prefix-density=0.22 prefix-fanout=2.3 sequence=GGGAGATCTGTATGCTGGTTTTTTTTT criterion=fanout-score sequence-density=0.07 sequence-density-rank=24 fanout-score=215.99 fanout-score-rank=1 prefix-density=0.66 prefix-fanout=21.7 sequence=TTTTCTTTTTTT SRR15142085 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 05:51:25 Started mapping on | Feb 14 05:51:25 Finished on | Feb 14 05:54:47 Mapping speed, Million of reads per hour | 121.70 Number of input reads | 6828481 Average input read length | 142 UNIQUE READS: Uniquely mapped reads number | 925815 Uniquely mapped reads % | 13.56% Average mapped length | 139.99 Number of splices: Total | 58298 Number of splices: Annotated (sjdb) | 49481 Number of splices: GT/AG | 51381 Number of splices: GC/AG | 739 Number of splices: AT/AC | 81 Number of splices: Non-canonical | 6097 Mismatch rate per base, % | 0.61% Deletion rate per base | 0.09% Deletion average length | 1.55 Insertion rate per base | 0.11% Insertion average length | 1.26 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 68044 % of reads mapped to multiple loci | 1.00% Number of reads mapped to too many loci | 93824 % of reads mapped to too many loci | 1.37% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 83.86% % of reads unmapped: other | 0.21% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 5834659 5834659 5834659 N_multimapping 68044 68044 68044 N_noFeature 152677 207413 860112 N_ambiguous 16442 5172 350 UnstrandedReadsAssigned:756696 PositiveStrandReadsAssigned:713230 NegativeStrandReadsAssigned:65353 Dataset is classified positive stranded MeadianReadLen=68 20thPercentileLength=67 echo kmer=63 SRR15142085 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR15142085-trimmed-pair1.fastq SRR15142085-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 6,828,481 reads, 972,140 reads pseudoaligned [quant] estimated average fragment length: 147.097 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 975 rounds 52401 SRR15142085.ke.tsv 34699 SRR15142085.se.tsv 87100 total ==> SRR15142085.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1871.9 5 2.54745 Potri.005G024800.1.v4.1 1035 888.903 1 1.07291 Potri.004G059700.1.v4.1 961 814.915 1 1.17033 Potri.007G009000.2.v4.1 1416 1269.9 0 0 Potri.003G141000.2.v4.1 2943 2796.9 4 1.36396 Potri.016G087400.1.v4.1 270 127.441 29 217.025 Potri.015G069301.1.v4.1 564 418.073 0 0 Potri.010G195200.1.v4.1 1773 1626.9 0 0 Potri.012G127500.1.v4.1 977 830.915 285 327.121 ==> SRR15142085.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 108 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 19 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR15142085 completed mapping pipeline successfully