Starting /dee2/code/volunteer_pipeline.sh SRR15142086 current disk space = 3085524967424 free memory = 1499786120 SRR15142086 SRAfilesize dca32bcf52670969bb2efc47ba6cf7e4 SRR15142086.sra SRR15142086.sra file validated SRR15142086 is paired end SRR15142086 is conventional basespace SRR15142086 read1 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR15142086_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 36 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.87925 32.0 32.0 32.0 32.0 32.0 2 30.08325 32.0 32.0 32.0 32.0 32.0 3 30.083 32.0 32.0 32.0 32.0 32.0 4 30.19725 32.0 32.0 32.0 32.0 32.0 5 30.1765 32.0 32.0 32.0 32.0 32.0 6 33.6455 36.0 36.0 36.0 32.0 36.0 7 33.67325 36.0 36.0 36.0 32.0 36.0 8 33.7225 36.0 36.0 36.0 32.0 36.0 9 33.76 36.0 36.0 36.0 32.0 36.0 10-11 33.607749999999996 36.0 36.0 36.0 32.0 36.0 12-13 33.736875 36.0 36.0 36.0 32.0 36.0 14-15 33.687875 36.0 36.0 36.0 32.0 36.0 16-17 33.6765 36.0 36.0 36.0 32.0 36.0 18-19 33.61725 36.0 36.0 36.0 32.0 36.0 20-21 33.588125000000005 36.0 36.0 36.0 32.0 36.0 22-23 33.610875 36.0 36.0 36.0 32.0 36.0 24-25 33.560375 36.0 36.0 36.0 32.0 36.0 26-27 33.58325 36.0 36.0 36.0 32.0 36.0 28-29 33.53675 36.0 36.0 36.0 32.0 36.0 30-31 33.538375 36.0 36.0 36.0 32.0 36.0 32-33 33.496375 36.0 36.0 36.0 32.0 36.0 34-35 33.477500000000006 36.0 36.0 36.0 32.0 36.0 36-37 35.05672268907563 36.0 36.0 36.0 36.0 36.0 38-39 35.01549369747899 36.0 36.0 36.0 36.0 36.0 40-41 34.938287815126046 36.0 36.0 36.0 36.0 36.0 42-43 34.96085967385378 36.0 36.0 36.0 36.0 36.0 44-45 34.89873916469661 36.0 36.0 36.0 36.0 36.0 46-47 34.81008668242711 36.0 36.0 36.0 36.0 36.0 48-49 34.77578474036474 36.0 36.0 36.0 36.0 36.0 50-51 34.64792433000525 36.0 36.0 36.0 32.0 36.0 52-53 34.75721826222676 36.0 36.0 36.0 34.0 36.0 54-55 34.512621614514856 36.0 36.0 36.0 32.0 36.0 56-57 34.64685774388641 36.0 36.0 36.0 32.0 36.0 58-59 34.40165658690508 36.0 36.0 36.0 32.0 36.0 60-61 34.48178969071651 36.0 36.0 36.0 32.0 36.0 62-63 34.34894736842105 36.0 36.0 36.0 32.0 36.0 64-65 34.21118421052631 36.0 36.0 36.0 32.0 36.0 66-67 34.22558568044222 36.0 36.0 36.0 32.0 36.0 68-69 34.249911448618775 36.0 36.0 36.0 32.0 36.0 70-71 34.224433643974216 36.0 36.0 36.0 32.0 36.0 72-73 34.144606466849304 36.0 36.0 36.0 32.0 36.0 74-75 34.00541799440916 36.0 36.0 36.0 32.0 36.0 76 33.612217795484725 36.0 36.0 36.0 27.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 191.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 3.0 23 4.0 24 8.0 25 10.0 26 26.0 27 28.0 28 41.0 29 50.0 30 62.0 31 106.0 32 142.0 33 210.0 34 608.0 35 2510.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.174553101997894 11.277602523659306 15.956887486855942 38.590956887486854 2 27.198739826726175 16.434759779469676 35.88868469414545 20.477815699658702 3 23.680756103964296 25.072197427146232 24.88842215804673 26.358624310842742 4 26.0173273825151 31.45182462588606 22.34182200052507 20.189025991073773 5 24.5996324494618 34.155946442635866 25.886059333158308 15.358361774744028 6 19.401417694933055 37.805198214754526 28.353898661065895 14.43948542924652 7 12.49671829876608 28.642688369650827 45.94381727487529 12.916776056707796 8 17.064846416382252 27.697558414281964 37.72643738514046 17.511157784195326 9 19.322656865318983 23.707009713835653 38.40903124179575 18.56130217904962 10-11 18.994486741927012 39.95799422420583 27.46127592543975 13.586243108427409 12-13 19.690207403517984 30.677343134681017 32.593856655290104 17.038592806510895 14-15 18.311892885271725 32.23943292202678 33.36833814649514 16.08033604620635 16-17 18.82383827776319 33.932790758729325 31.2417957469152 16.001575216592283 18-19 18.338146495143082 32.488842215804674 31.858755578892094 17.314255710160147 20-21 19.519558939354162 32.71199789971121 30.493567865581518 17.274875295353112 22-23 19.611446573903912 33.105802047781566 30.0735101076398 17.20924127067472 24-25 18.83696508269887 33.000787608296136 31.215542137043844 16.946705171961142 26-27 17.983722761879758 33.48647939091625 31.556839065371488 16.9729587818325 28-29 19.283276450511945 32.83013914413232 31.16303491730113 16.723549488054605 30-31 18.403780519821474 33.13205565765293 31.399317406143346 17.064846416382252 32-33 18.45628773956419 33.15830926752428 30.624835914938302 17.76056707797322 34-35 18.44558225022975 33.21517657870553 31.14086910857293 17.198372062491796 36-37 18.69747899159664 33.705357142857146 30.72478991596639 16.87237394957983 38-39 18.72373949579832 32.563025210084035 31.59138655462185 17.1218487394958 40-41 18.946953781512605 32.405462184873954 31.801470588235293 16.84611344537815 42-43 18.62114248194353 32.646093237032176 31.4510833880499 17.281680892974393 44-45 18.045705279747835 32.82111899133176 31.954294720252168 17.17888100866824 46-47 18.203309692671397 33.64854215918046 30.60152350932493 17.54662463882322 48-49 19.217128595822935 33.166951267568635 30.723761986076447 16.892158150531987 50-51 18.470835522858646 33.920126116657904 31.174461376773515 16.43457698370993 52-53 18.283385909568874 33.162460567823345 31.15141955835962 17.40273396424816 54-55 17.749145411517222 34.012621614514856 30.686300289245334 17.551932684722587 56-57 18.472258743097555 33.57875361556666 30.212989744938206 17.73599789639758 58-59 17.84117801735472 33.631343676045226 31.685511438338153 16.8419668682619 60-61 18.426936735499144 33.34210180192029 31.092989609364725 17.137971853215834 62-63 18.828947368421055 33.81578947368421 30.42105263157895 16.93421052631579 64-65 18.855263157894736 32.328947368421055 32.0921052631579 16.723684210526315 66-67 17.623058699657804 33.82469070808107 31.10028954988155 17.451961042379573 68-69 18.314680710994075 33.90388413429888 30.678077682685977 17.103357472021067 70-71 18.344754876120188 34.132841328413285 30.83816552451239 16.68423827095414 72-73 18.973273352738822 33.342154008997085 31.079650701243715 16.604921937020375 74-75 17.74533202302401 31.559736066264215 32.7109364032009 17.98399550751088 76 19.389110225763613 0.0 51.7485613103143 28.862328463922086 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 195.0 1 98.5 2 1.0 3 0.0 4 0.0 5 1.0 6 2.5 7 1.5 8 0.0 9 2.0 10 5.5 11 6.5 12 6.0 13 11.5 14 17.5 15 17.0 16 14.5 17 15.5 18 19.0 19 24.5 20 31.5 21 42.0 22 52.0 23 64.0 24 84.0 25 97.0 26 95.0 27 109.5 28 128.5 29 141.0 30 172.0 31 195.0 32 208.5 33 228.0 34 232.5 35 235.0 36 238.0 37 228.5 38 234.5 39 231.0 40 212.0 41 197.0 42 183.0 43 158.5 44 147.0 45 131.0 46 105.5 47 103.5 48 97.0 49 81.0 50 66.0 51 56.5 52 46.0 53 32.0 54 24.5 55 21.0 56 20.0 57 23.5 58 21.0 59 12.5 60 8.0 61 6.0 62 3.0 63 2.5 64 2.5 65 2.0 66 1.0 67 1.0 68 1.5 69 2.5 70 2.5 71 1.5 72 1.0 73 0.5 74 0.5 75 0.5 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.9 2 4.775 3 4.775 4 4.775 5 4.775 6 4.775 7 4.775 8 4.775 9 4.775 10-11 4.775 12-13 4.775 14-15 4.775 16-17 4.775 18-19 4.775 20-21 4.775 22-23 4.775 24-25 4.775 26-27 4.775 28-29 4.775 30-31 4.775 32-33 4.775 34-35 4.7875 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 192.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 1.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 1.0 49 0.0 50 0.0 51 1.0 52 2.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 1.0 60 1.0 61 1.0 62 0.0 63 0.0 64 0.0 65 1.0 66 0.0 67 1.0 68 1.0 69 2.0 70 2.0 71 4.0 72 20.0 73 88.0 74 239.0 75 1183.0 76 2259.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.025 #Duplication Level Percentage of deduplicated Percentage of total 1 99.76322020520915 94.8 2 0.1841620626151013 0.35000000000000003 3 0.026308866087871613 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.026308866087871613 4.775 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 191 4.775 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR15142086 read2 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR15142086_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 37 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.70175 32.0 32.0 32.0 32.0 32.0 2 31.10125 32.0 32.0 32.0 32.0 32.0 3 31.10175 32.0 32.0 32.0 32.0 32.0 4 30.928 32.0 32.0 32.0 32.0 32.0 5 31.089 32.0 32.0 32.0 32.0 32.0 6 34.72375 36.0 36.0 36.0 32.0 36.0 7 34.6465 36.0 36.0 36.0 32.0 36.0 8 34.48575 36.0 36.0 36.0 32.0 36.0 9 34.4075 36.0 36.0 36.0 32.0 36.0 10-11 34.294125 36.0 36.0 36.0 32.0 36.0 12-13 34.27375 36.0 36.0 36.0 32.0 36.0 14-15 34.253875 36.0 36.0 36.0 32.0 36.0 16-17 34.262375 36.0 36.0 36.0 32.0 36.0 18-19 34.277874999999995 36.0 36.0 36.0 32.0 36.0 20-21 34.06037499999999 36.0 36.0 36.0 32.0 36.0 22-23 33.844125000000005 36.0 36.0 36.0 32.0 36.0 24-25 33.364375 36.0 36.0 36.0 17.5 36.0 26-27 32.8525 36.0 36.0 36.0 14.0 36.0 28-29 32.6905 36.0 36.0 36.0 14.0 36.0 30-31 32.650625 36.0 36.0 36.0 14.0 36.0 32-33 32.342375000000004 36.0 36.0 36.0 14.0 36.0 34-35 32.131875 36.0 36.0 36.0 14.0 36.0 36-37 32.08335419274093 36.0 36.0 36.0 14.0 36.0 38-39 32.050187734668334 36.0 36.0 36.0 14.0 36.0 40-41 32.15932415519399 36.0 36.0 36.0 14.0 36.0 42-43 32.00700431122278 36.0 36.0 36.0 14.0 36.0 44-45 32.20480721081623 36.0 36.0 36.0 14.0 36.0 46-47 32.39221331997997 36.0 36.0 36.0 14.0 36.0 48-49 32.184294661375986 36.0 36.0 36.0 14.0 36.0 50-51 31.880415727523165 36.0 32.0 36.0 14.0 36.0 52-53 32.14698833757741 36.0 34.0 36.0 14.0 36.0 54-55 32.27869674185463 36.0 36.0 36.0 14.0 36.0 56-57 32.25764411027569 36.0 34.0 36.0 14.0 36.0 58-59 31.982456140350877 36.0 32.0 36.0 14.0 36.0 60-61 31.849815710606375 36.0 32.0 36.0 14.0 36.0 62-63 31.68848758465011 36.0 32.0 36.0 14.0 36.0 64-65 31.47416603962879 36.0 32.0 36.0 14.0 36.0 66-67 31.556698444555945 36.0 32.0 36.0 14.0 36.0 68-69 31.6061206557724 36.0 32.0 36.0 14.0 36.0 70-71 31.384811488381132 36.0 32.0 36.0 14.0 36.0 72-73 31.453653273915798 36.0 32.0 36.0 14.0 36.0 74-75 31.59006064542475 36.0 32.0 36.0 14.0 36.0 76 30.937813827732715 36.0 32.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 2.0 14 0.0 15 3.0 16 8.0 17 13.0 18 22.0 19 28.0 20 29.0 21 35.0 22 52.0 23 69.0 24 83.0 25 90.0 26 134.0 27 93.0 28 73.0 29 100.0 30 97.0 31 127.0 32 171.0 33 310.0 34 988.0 35 1469.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.41735640832706 17.883120140456484 22.799097065462753 30.900426385753697 2 21.32132132132132 24.64964964964965 42.567567567567565 11.461461461461461 3 20.945945945945947 25.375375375375377 39.46446446446446 14.214214214214213 4 25.875875875875877 29.22922922922923 31.006006006006004 13.88888888888889 5 23.14814814814815 32.63263263263263 32.207207207207205 12.012012012012011 6 16.691691691691695 33.45845845845846 36.58658658658659 13.263263263263264 7 14.839839839839838 14.73973973973974 54.25425425425425 16.166166166166164 8 19.11911911911912 20.545545545545547 41.391391391391394 18.943943943943946 9 20.47047047047047 20.47047047047047 40.965965965965964 18.093093093093092 10-11 20.382882882882882 30.58058058058058 35.08508508508508 13.951451451451453 12-13 18.11811811811812 23.04804804804805 42.81781781781782 16.016016016016017 14-15 16.07857857857858 25.16266266266266 44.13163163163163 14.627127127127126 16-17 17.594794143411338 25.47866349643349 42.18495807783757 14.741584282317607 18-19 17.68018018018018 25.75075075075075 41.766766766766764 14.802302302302303 20-21 17.42992992992993 25.900900900900904 42.1046046046046 14.564564564564563 22-23 18.060075093867333 26.90863579474343 40.613266583229034 14.4180225281602 24-25 18.155655655655657 27.82782782782783 38.23823823823824 15.778278278278279 26-27 18.855640415675474 30.39939902341305 35.80818830599725 14.936772254914235 28-29 19.56440105144574 29.615721617223684 34.98560520715984 15.834272124170734 30-31 19.41941941941942 29.87987987987988 34.15915915915916 16.54154154154154 32-33 19.506698384875424 29.735820708651563 35.858269688243396 14.899211218229624 34-35 19.546706736789382 30.4908590032557 33.25820185324317 16.704232406711743 36-37 19.33625547902317 29.430181590482153 34.690043832185346 16.543519098309332 38-39 19.446531430002505 30.904082143751566 33.30828950663661 16.341096919609317 40-41 19.852296908248842 31.60595819251471 32.21930153961697 16.322443359619477 42-43 19.579105599398723 30.89064261555806 33.08280095202305 16.44745083302017 44-45 20.00751691305437 30.2179904785768 34.02655975945878 15.747932848910049 46-47 20.170383362565772 30.06765221748935 33.48784765722876 16.274116762716112 48-49 22.074668003006764 28.213480330744172 32.272613380105234 17.439238286143823 50-51 23.8441298082947 27.177045483022177 32.66507956396442 16.31374514471871 52-53 24.605164201554274 27.124592629731765 32.12584607671096 16.144397092003008 54-55 22.8270412642669 28.094820017559265 32.83582089552239 16.242317822651447 56-57 23.112616002006522 28.053674441936295 32.25482819162278 16.578881364434412 58-59 23.175319789315274 28.95660897918234 32.09179834462002 15.776272886882367 60-61 22.77004140007527 29.770417764395933 30.97478359051562 16.484757245013174 62-63 23.637961335676625 28.75972884760231 31.621893045443134 15.98041677127793 64-65 23.31827309236948 28.52660642570281 31.37550200803213 16.77961847389558 66-67 23.220785741182375 29.044809840592446 31.25392243002385 16.48048198820133 68-69 24.252700326551118 28.30946998241648 31.574981160512433 15.86284853051997 70-71 23.05758109127483 28.56424440533065 31.481015841086247 16.89715866230827 72-73 23.49974785678265 28.328290468986385 31.442259203227437 16.72970247100353 74-75 23.556612498348528 26.516052318668255 31.906460562822037 18.020874620161184 76 28.080339899575122 0.0 46.54306682116648 25.3765932792584 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 4.0 1 3.0 2 1.5 3 1.5 4 2.0 5 3.5 6 5.0 7 4.0 8 3.5 9 6.5 10 8.5 11 13.0 12 18.5 13 19.5 14 21.5 15 28.5 16 30.0 17 25.5 18 28.0 19 41.5 20 44.5 21 38.0 22 59.5 23 83.0 24 93.5 25 107.5 26 128.5 27 141.0 28 164.5 29 187.5 30 191.0 31 203.0 32 225.5 33 239.0 34 243.0 35 255.0 36 249.5 37 237.0 38 227.0 39 202.0 40 189.5 41 180.5 42 165.5 43 135.0 44 104.0 45 92.5 46 85.0 47 84.5 48 77.0 49 61.5 50 44.0 51 39.0 52 37.0 53 39.5 54 48.0 55 41.5 56 30.5 57 21.5 58 16.0 59 14.0 60 9.0 61 9.0 62 9.5 63 6.0 64 5.0 65 4.0 66 3.5 67 5.0 68 3.5 69 1.5 70 2.0 71 2.5 72 1.5 73 0.5 74 0.5 75 1.0 76 1.0 77 1.0 78 0.5 79 0.0 80 0.0 81 0.0 82 1.0 83 2.0 84 2.0 85 1.5 86 2.0 87 3.0 88 2.0 89 3.5 90 4.5 91 4.0 92 5.0 93 5.0 94 7.5 95 11.5 96 13.0 97 13.0 98 18.5 99 23.0 100 22.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.325 2 0.1 3 0.1 4 0.1 5 0.1 6 0.1 7 0.1 8 0.1 9 0.1 10-11 0.1 12-13 0.1 14-15 0.1 16-17 0.11249999999999999 18-19 0.1 20-21 0.1 22-23 0.125 24-25 0.1 26-27 0.1625 28-29 0.13749999999999998 30-31 0.1 32-33 0.1625 34-35 0.17500000000000002 36-37 0.0625782227784731 38-39 0.05006257822277847 40-41 0.012515644555694618 42-43 0.07510326699211416 44-45 0.07511266900350526 46-47 0.07511266900350526 48-49 0.06260172780768748 50-51 0.06260956674179814 52-53 0.05011275369581559 54-55 0.08771929824561403 56-57 0.07518796992481204 58-59 0.07518796992481204 60-61 0.07521624670928921 62-63 0.1003260596940055 64-65 0.07524454477050413 66-67 0.06271951831409935 68-69 0.08784038147822813 70-71 0.10047726701833709 72-73 0.07558578987150416 74-75 0.10558268443975188 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 5.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 1.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 1.0 49 0.0 50 0.0 51 1.0 52 2.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 1.0 60 1.0 61 1.0 62 0.0 63 0.0 64 0.0 65 1.0 66 0.0 67 1.0 68 1.0 69 2.0 70 2.0 71 5.0 72 12.0 73 62.0 74 225.0 75 1087.0 76 2589.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64583860359221 98.475 2 0.2023779408044523 0.4 3 0.05059448520111307 0.15 4 0.05059448520111307 0.2 5 0.025297242600556536 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025297242600556536 0.65 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 26 0.65 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGTGGGGGGGGGGGG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 382642 spots for SRR15142086.sra Written 382642 spots for SRR15142086.sra Read 382642 spots for SRR15142086.sra Written 382642 spots for SRR15142086.sra Read 382642 spots for SRR15142086.sra Written 382642 spots for SRR15142086.sra Read 382642 spots for SRR15142086.sra Written 382642 spots for SRR15142086.sra Read 382642 spots for SRR15142086.sra Written 382642 spots for SRR15142086.sra Read 382642 spots for SRR15142086.sra Written 382642 spots for SRR15142086.sra Read 382642 spots for SRR15142086.sra Written 382642 spots for SRR15142086.sra Read 382642 spots for SRR15142086.sra Written 382642 spots for SRR15142086.sra Read 382642 spots for SRR15142086.sra Written 382642 spots for SRR15142086.sra Read 382642 spots for SRR15142086.sra Written 382642 spots for SRR15142086.sra Read 382642 spots for SRR15142086.sra Read 382642 spots for SRR15142086.sra Written 382642 spots for SRR15142086.sra Written 382642 spots for SRR15142086.sra Read 382642 spots for SRR15142086.sra Written 382642 spots for SRR15142086.sra Read 382642 spots for SRR15142086.sra Written 382642 spots for SRR15142086.sra Read 382642 spots for SRR15142086.sra Written 382642 spots for SRR15142086.sra Read 382642 spots for SRR15142086.sra Written 382642 spots for SRR15142086.sra Read 382652 spots for SRR15142086.sra Written 382652 spots for SRR15142086.sra Read 382642 spots for SRR15142086.sra Written 382642 spots for SRR15142086.sra Read 382642 spots for SRR15142086.sra Written 382642 spots for SRR15142086.sra Read 382642 spots for SRR15142086.sra Written 382642 spots for SRR15142086.sra SRR ids: ['SRR15142086.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_s116m03p SRR15142086.sra spots: 7652850 blocks: [[1, 382642], [382643, 765284], [765285, 1147926], [1147927, 1530568], [1530569, 1913210], [1913211, 2295852], [2295853, 2678494], [2678495, 3061136], [3061137, 3443778], [3443779, 3826420], [3826421, 4209062], [4209063, 4591704], [4591705, 4974346], [4974347, 5356988], [5356989, 5739630], [5739631, 6122272], [6122273, 6504914], [6504915, 6887556], [6887557, 7270198], [7270199, 7652850]] SRR15142086 file size 1348963 SRR15142086 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR15142086 SRR15142086_1.fastq SRR15142086_2.fastq Input file: SRR15142086_1.fastq Paired file: SRR15142086_2.fastq trimmed: SRR15142086-trimmed-pair1.fastq, SRR15142086-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 05:58:01 2025 >> started Fri Feb 14 05:58:09 2025 >> done (7.242s) 7652850 read pairs processed; of these: 1324 ( 0.02%) short read pairs filtered out after trimming by size control 1226034 (16.02%) empty read pairs filtered out after trimming by size control 6425492 (83.96%) read pairs available; of these: 13508 ( 0.21%) trimmed read pairs available after processing 6411984 (99.79%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 1 0.00% 20 1 0.00% 21 0 0.00% 22 50 0.00% 23 53 0.00% 24 33 0.00% 25 50 0.00% 26 46 0.00% 27 32 0.00% 28 36 0.00% 29 41 0.00% 30 78 0.00% 31 238 0.00% 32 182 0.00% 33 39 0.00% 34 236 0.00% 35 147 0.00% 36 188 0.00% 37 172 0.00% 38 225 0.00% 39 259 0.00% 40 282 0.00% 41 338 0.01% 42 372 0.01% 43 407 0.01% 44 400 0.01% 45 470 0.01% 46 518 0.01% 47 766 0.01% 48 658 0.01% 49 814 0.01% 50 1000 0.02% 51 1149 0.02% 52 891 0.01% 53 1119 0.02% 54 1274 0.02% 55 1210 0.02% 56 1203 0.02% 57 1352 0.02% 58 1462 0.02% 59 1385 0.02% 60 1401 0.02% 61 1505 0.02% 62 1629 0.03% 63 1684 0.03% 64 1896 0.03% 65 1928 0.03% 66 2143 0.03% 67 2453 0.04% 68 2554 0.04% 69 2991 0.05% 70 3219 0.05% 71 4025 0.06% 72 6280 0.10% 73 49431 0.77% 74 496444 7.73% 75 3483485 54.21% 76 2343247 36.47% 6425492 reads passed initial QC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=3.33 fanout-score-rank=29 prefix-density=0.21 prefix-fanout=3.2 sequence=GGGAGGCTGAGGCAGGAGAAT criterion=fanout-score sequence-density=0.06 sequence-density-rank=20 fanout-score=328.30 fanout-score-rank=1 prefix-density=0.58 prefix-fanout=34.6 sequence=AAAAAGAAAAAA criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=3.68 fanout-score-rank=32 prefix-density=0.29 prefix-fanout=3.1 sequence=CCCAGGCTGGAGTGCAGTGGC criterion=fanout-score sequence-density=0.10 sequence-density-rank=25 fanout-score=159.74 fanout-score-rank=1 prefix-density=0.89 prefix-fanout=17.6 sequence=TTTTATTTTATTTT SRR15142086 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 05:58:48 Started mapping on | Feb 14 05:58:48 Finished on | Feb 14 06:00:40 Mapping speed, Million of reads per hour | 206.53 Number of input reads | 6425492 Average input read length | 150 UNIQUE READS: Uniquely mapped reads number | 3332814 Uniquely mapped reads % | 51.87% Average mapped length | 147.87 Number of splices: Total | 87767 Number of splices: Annotated (sjdb) | 61599 Number of splices: GT/AG | 67704 Number of splices: GC/AG | 1101 Number of splices: AT/AC | 318 Number of splices: Non-canonical | 18644 Mismatch rate per base, % | 0.75% Deletion rate per base | 0.09% Deletion average length | 1.44 Insertion rate per base | 0.12% Insertion average length | 1.40 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 161013 % of reads mapped to multiple loci | 2.51% Number of reads mapped to too many loci | 56796 % of reads mapped to too many loci | 0.88% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 44.63% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2931854 2931854 2931854 N_multimapping 161013 161013 161013 N_noFeature 2063327 2508413 2874197 N_ambiguous 24831 9054 2370 UnstrandedReadsAssigned:1244656 PositiveStrandReadsAssigned:815347 NegativeStrandReadsAssigned:456247 Dataset is classified unstranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR15142086 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR15142086-trimmed-pair1.fastq SRR15142086-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 6,425,492 reads, 1,606,191 reads pseudoaligned [quant] estimated average fragment length: 158.875 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 935 rounds 52401 SRR15142086.ke.tsv 34699 SRR15142086.se.tsv 87100 total ==> SRR15142086.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1860.13 81 26.8608 Potri.005G024800.1.v4.1 1035 877.125 52 36.5694 Potri.004G059700.1.v4.1 961 803.152 11 8.44834 Potri.007G009000.2.v4.1 1416 1258.13 19 9.3155 Potri.003G141000.2.v4.1 2943 2785.13 22 4.87253 Potri.016G087400.1.v4.1 270 118.095 12 62.6794 Potri.015G069301.1.v4.1 564 406.465 0 0 Potri.010G195200.1.v4.1 1773 1615.13 56 21.3874 Potri.012G127500.1.v4.1 977 819.143 20 15.0608 ==> SRR15142086.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 11 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 26 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 9 Potri.001G256600.v4.1 24 Potri.001G040500.v4.1 3 Potri.001G416900.v4.1 7 Potri.001G452600.v4.1 73 SRR15142086 completed mapping pipeline successfully