Starting /dee2/code/volunteer_pipeline.sh SRR15142087 current disk space = 3085051379712 free memory = 1575987276 SRR15142087 SRAfilesize eac43a2e73be335b6c3b53f6c305a0d3 SRR15142087.sra SRR15142087.sra file validated SRR15142087 is paired end SRR15142087 is conventional basespace SRR15142087 read1 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR15142087_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 35 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.887 32.0 32.0 32.0 32.0 32.0 2 31.398 32.0 32.0 32.0 32.0 32.0 3 31.3775 32.0 32.0 32.0 32.0 32.0 4 31.50375 32.0 32.0 32.0 32.0 32.0 5 31.48075 32.0 32.0 32.0 32.0 32.0 6 35.1535 36.0 36.0 36.0 36.0 36.0 7 35.1355 36.0 36.0 36.0 36.0 36.0 8 35.2045 36.0 36.0 36.0 36.0 36.0 9 35.15725 36.0 36.0 36.0 36.0 36.0 10-11 35.09275 36.0 36.0 36.0 36.0 36.0 12-13 35.19775 36.0 36.0 36.0 36.0 36.0 14-15 35.163250000000005 36.0 36.0 36.0 36.0 36.0 16-17 35.1185 36.0 36.0 36.0 36.0 36.0 18-19 35.115875 36.0 36.0 36.0 36.0 36.0 20-21 35.140375 36.0 36.0 36.0 36.0 36.0 22-23 35.127750000000006 36.0 36.0 36.0 36.0 36.0 24-25 35.085499999999996 36.0 36.0 36.0 36.0 36.0 26-27 34.97175 36.0 36.0 36.0 36.0 36.0 28-29 34.94825 36.0 36.0 36.0 36.0 36.0 30-31 34.953875 36.0 36.0 36.0 36.0 36.0 32-33 34.875625 36.0 36.0 36.0 36.0 36.0 34-35 34.824124999999995 36.0 36.0 36.0 36.0 36.0 36-37 34.90025062656642 36.0 36.0 36.0 36.0 36.0 38-39 34.89724310776943 36.0 36.0 36.0 36.0 36.0 40-41 34.85952380952381 36.0 36.0 36.0 36.0 36.0 42-43 34.86015037593985 36.0 36.0 36.0 36.0 36.0 44-45 34.82380952380952 36.0 36.0 36.0 34.0 36.0 46-47 34.62456140350877 36.0 36.0 36.0 32.0 36.0 48-49 34.70622972573072 36.0 36.0 36.0 32.0 36.0 50-51 34.542241163198796 36.0 36.0 36.0 32.0 36.0 52-53 34.55013787916771 36.0 36.0 36.0 32.0 36.0 54-55 34.4343193782903 36.0 36.0 36.0 32.0 36.0 56-57 34.48450751049235 36.0 36.0 36.0 32.0 36.0 58-59 34.266491096062204 36.0 36.0 36.0 32.0 36.0 60-61 34.34240112528286 36.0 36.0 36.0 32.0 36.0 62-63 34.259784244857 36.0 36.0 36.0 32.0 36.0 64-65 34.146432317327516 36.0 36.0 36.0 32.0 36.0 66-67 34.131099572681386 36.0 36.0 36.0 32.0 36.0 68-69 34.1196126081526 36.0 36.0 36.0 32.0 36.0 70-71 34.12622579834046 36.0 36.0 36.0 32.0 36.0 72-73 34.077274050044124 36.0 36.0 36.0 32.0 36.0 74-75 33.98803668369746 36.0 36.0 36.0 32.0 36.0 76 33.4423982869379 36.0 36.0 36.0 27.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 10.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 3.0 21 1.0 22 5.0 23 4.0 24 6.0 25 12.0 26 22.0 27 35.0 28 50.0 29 61.0 30 82.0 31 115.0 32 148.0 33 230.0 34 653.0 35 2563.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.623963828183875 11.10273800552625 17.357447877417734 34.91585028887214 2 25.739348370927317 16.215538847117795 35.68922305764411 22.355889724310778 3 24.661654135338345 24.160401002506266 25.012531328320804 26.165413533834585 4 26.44110275689223 30.67669172932331 22.75689223057644 20.125313283208023 5 25.162907268170425 34.86215538847118 24.987468671679196 14.987468671679197 6 19.69924812030075 37.092731829573935 27.994987468671678 15.213032581453634 7 12.957393483709273 29.24812030075188 45.86466165413533 11.929824561403509 8 17.694235588972433 27.518796992481203 35.88972431077694 18.897243107769423 9 19.974937343358395 26.466165413533833 35.46365914786968 18.095238095238095 10-11 18.23308270676692 41.2406015037594 26.340852130325814 14.18546365914787 12-13 18.55889724310777 31.203007518796994 33.64661654135339 16.591478696741856 14-15 18.08270676691729 33.1203007518797 33.23308270676692 15.563909774436091 16-17 17.73182957393484 33.92230576441103 32.443609022556394 15.902255639097746 18-19 18.358395989974937 33.1578947368421 31.240601503759397 17.24310776942356 20-21 18.80952380952381 32.957393483709275 30.6516290726817 17.58145363408521 22-23 17.543859649122805 33.54636591478697 31.641604010025066 17.26817042606516 24-25 17.142857142857142 34.774436090225564 31.55388471177945 16.528822055137844 26-27 17.969924812030076 33.709273182957396 30.6516290726817 17.669172932330827 28-29 17.45614035087719 34.385964912280706 31.30325814536341 16.854636591478698 30-31 17.55639097744361 34.34837092731829 31.879699248120303 16.215538847117795 32-33 17.318295739348372 34.34837092731829 31.32832080200501 17.00501253132832 34-35 17.669172932330827 33.734335839599 31.72932330827068 16.8671679197995 36-37 17.343358395989974 34.849624060150376 30.914786967418546 16.892230576441104 38-39 17.167919799498748 34.48621553884712 31.19047619047619 17.155388471177947 40-41 17.43107769423559 34.749373433583955 31.32832080200501 16.49122807017544 42-43 17.192982456140353 35.65162907268171 30.476190476190478 16.67919799498747 44-45 17.832080200501252 33.709273182957396 31.265664160401002 17.192982456140353 46-47 17.769423558897245 33.99749373433584 32.15538847117794 16.07769423558897 48-49 16.831683168316832 33.57563604461712 32.42260934954255 17.1700714375235 50-51 18.08723990975182 34.28177488092254 30.985209325645524 16.64577588368012 52-53 17.84908498370519 34.75808473301579 31.02281273502131 16.37001754825771 54-55 16.9967410378541 34.92103284031086 31.1982953121083 16.88393080972675 56-57 16.940438871473354 35.22257053291536 30.65830721003135 17.178683385579937 58-59 17.205919237521947 34.34913468773514 30.912967143215454 17.531978931527465 60-61 16.95723065345541 33.31242944939169 32.09582340398846 17.63451649316443 62-63 16.708479678876067 34.03161063723031 32.06221776216759 17.19769192172604 64-65 16.57465495608532 35.29485570890841 31.593475533249688 16.537013801756586 66-67 16.95340951902549 35.25053371844782 30.139394700489763 17.656662062036922 68-69 17.276039703480336 35.10491267747204 30.28018595300917 17.338861666038447 70-71 16.70857430223787 35.743022378677395 30.412371134020617 17.136032185064117 72-73 17.30138713745271 35.25851197982345 31.563682219419924 15.876418663303909 74-75 16.16750596342433 33.196395441293404 33.514444738934536 17.121653856347734 76 19.31477516059957 0.0 53.91862955032119 26.76659528907923 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 12.0 1 6.0 2 0.0 3 0.5 4 1.0 5 0.5 6 1.5 7 5.0 8 7.0 9 6.5 10 5.5 11 4.5 12 4.0 13 6.5 14 12.5 15 18.5 16 23.5 17 27.0 18 32.0 19 43.0 20 52.0 21 57.5 22 71.0 23 84.5 24 91.0 25 95.0 26 112.0 27 126.0 28 141.0 29 168.5 30 192.5 31 213.0 32 233.0 33 247.5 34 254.0 35 271.0 36 283.0 37 283.0 38 257.5 39 229.5 40 217.0 41 192.5 42 178.0 43 170.0 44 145.5 45 116.5 46 102.5 47 86.5 48 70.5 49 59.0 50 47.5 51 35.5 52 30.5 53 29.5 54 21.0 55 15.5 56 14.0 57 15.5 58 13.0 59 10.0 60 7.0 61 5.0 62 6.0 63 4.5 64 2.0 65 2.5 66 2.5 67 1.5 68 2.0 69 1.5 70 1.5 71 3.0 72 1.5 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.475 2 0.25 3 0.25 4 0.25 5 0.25 6 0.25 7 0.25 8 0.25 9 0.25 10-11 0.25 12-13 0.25 14-15 0.25 16-17 0.25 18-19 0.25 20-21 0.25 22-23 0.25 24-25 0.25 26-27 0.25 28-29 0.25 30-31 0.25 32-33 0.25 34-35 0.25 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 10.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 1.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 1.0 56 1.0 57 0.0 58 0.0 59 0.0 60 1.0 61 0.0 62 0.0 63 0.0 64 2.0 65 1.0 66 3.0 67 0.0 68 1.0 69 2.0 70 0.0 71 2.0 72 20.0 73 73.0 74 218.0 75 1329.0 76 2335.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.87452948557089 99.5 2 0.0752823086574655 0.15 3 0.0 0.0 4 0.02509410288582183 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02509410288582183 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 10 0.25 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR15142087 read2 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR15142087_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 34 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.8875 32.0 32.0 32.0 32.0 32.0 2 31.183 32.0 32.0 32.0 32.0 32.0 3 31.32325 32.0 32.0 32.0 32.0 32.0 4 31.298 32.0 32.0 32.0 32.0 32.0 5 31.35575 32.0 32.0 32.0 32.0 32.0 6 35.07125 36.0 36.0 36.0 36.0 36.0 7 35.1795 36.0 36.0 36.0 36.0 36.0 8 35.12375 36.0 36.0 36.0 36.0 36.0 9 35.00525 36.0 36.0 36.0 36.0 36.0 10-11 34.97625 36.0 36.0 36.0 36.0 36.0 12-13 35.02425 36.0 36.0 36.0 36.0 36.0 14-15 35.026875000000004 36.0 36.0 36.0 36.0 36.0 16-17 35.09325 36.0 36.0 36.0 36.0 36.0 18-19 35.00425 36.0 36.0 36.0 36.0 36.0 20-21 34.752250000000004 36.0 36.0 36.0 36.0 36.0 22-23 34.42675 36.0 36.0 36.0 32.0 36.0 24-25 34.0175 36.0 36.0 36.0 32.0 36.0 26-27 33.659875 36.0 36.0 36.0 26.5 36.0 28-29 33.31275 36.0 36.0 36.0 17.5 36.0 30-31 33.17875 36.0 36.0 36.0 14.0 36.0 32-33 32.972375 36.0 36.0 36.0 14.0 36.0 34-35 32.650999999999996 36.0 36.0 36.0 14.0 36.0 36-37 32.642035508877214 36.0 36.0 36.0 14.0 36.0 38-39 32.63128282070518 36.0 36.0 36.0 14.0 36.0 40-41 32.601775443860966 36.0 36.0 36.0 14.0 36.0 42-43 32.53875968992248 36.0 36.0 36.0 14.0 36.0 44-45 32.58014503625907 36.0 36.0 36.0 14.0 36.0 46-47 32.62403100775194 36.0 36.0 36.0 14.0 36.0 48-49 32.538884721180295 36.0 36.0 36.0 14.0 36.0 50-51 32.360090022505624 36.0 32.0 36.0 14.0 36.0 52-53 32.27019254813703 36.0 34.0 36.0 14.0 36.0 54-55 32.38159539884971 36.0 36.0 36.0 14.0 36.0 56-57 32.39400223003671 36.0 36.0 36.0 14.0 36.0 58-59 32.24405804353265 36.0 34.0 36.0 14.0 36.0 60-61 32.128001124717414 36.0 34.0 36.0 14.0 36.0 62-63 32.03128128128128 36.0 32.0 36.0 14.0 36.0 64-65 31.92201321251146 36.0 32.0 36.0 14.0 36.0 66-67 31.922838651851265 36.0 32.0 36.0 14.0 36.0 68-69 31.993239679796133 36.0 32.0 36.0 14.0 36.0 70-71 31.66002006521194 36.0 32.0 36.0 14.0 36.0 72-73 31.693854048998944 36.0 32.0 36.0 14.0 36.0 74-75 31.60839046951879 36.0 32.0 36.0 14.0 36.0 76 31.17642585551331 36.0 32.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 2.0 17 1.0 18 3.0 19 6.0 20 7.0 21 20.0 22 35.0 23 51.0 24 86.0 25 96.0 26 107.0 27 111.0 28 105.0 29 102.0 30 98.0 31 149.0 32 174.0 33 307.0 34 987.0 35 1551.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.633350075339028 18.156705173279757 26.845806127574086 25.36413862380713 2 16.829207301825456 23.23080770192548 46.13653413353339 13.80345086271568 3 16.62915728932233 23.705926481620406 46.111527881970495 13.553388347086774 4 22.48062015503876 30.15753938484621 35.08377094273568 12.278069517379345 5 21.48037009252313 31.83295823955989 35.38384596149037 11.302825706426606 6 14.228557139284822 33.93348337084271 39.484871217804454 12.353088272068018 7 11.177794448612154 15.728932233058265 58.63965991497875 14.453613403350838 8 16.25406351587897 20.280070017504375 44.26106526631658 19.204801200300075 9 18.579644911227806 21.605401350337583 41.66041510377595 18.154538634658664 10-11 17.791947986996746 30.84521130282571 38.17204301075269 13.190797699424856 12-13 15.528882220555138 22.66816704176044 46.611652913228305 15.191297824456115 14-15 14.266066516629158 24.74368592148037 47.54938734683671 13.440860215053762 16-17 13.703425856464117 25.79394848712178 46.59914978744686 13.903475868967242 18-19 14.141035258814705 27.25681420355089 45.586396599149786 13.01575393848462 20-21 14.691172793198298 26.019004751187797 44.69867466866717 14.591147786946737 22-23 15.916479119779945 27.59439859964991 42.48562140535134 14.003500875218805 24-25 15.71642910727682 29.257314328582147 41.197799449862465 13.828457114278569 26-27 17.09177294323581 29.094773693423353 39.52238059514879 14.291072768192048 28-29 17.129282320580145 28.832208052013 39.00975243810953 15.028757189297323 30-31 18.02950737684421 29.844961240310074 37.471867966991745 14.653663415853963 32-33 18.54213553388347 29.26981745436359 36.58414603650913 15.603900975243812 34-35 17.866966741685424 30.24506126531633 36.32158039509877 15.566391597899475 36-37 18.12953238309577 30.64516129032258 35.58389597399349 15.641410352588148 38-39 18.092023005751436 29.957489372343087 36.09652413103276 15.853963490872719 40-41 18.242060515128784 30.357589397349336 35.73393348337085 15.666416604151037 42-43 17.57939484871218 31.707926981745437 35.37134283570893 15.341335333833458 44-45 18.067016754188547 32.070517629407355 34.40860215053764 15.453863465866466 46-47 18.992248062015506 29.644911227806954 35.29632408102025 16.06651662915729 48-49 20.64266066516629 29.957489372343087 34.208552138034506 15.191297824456115 50-51 20.830207551887973 27.19429857464366 36.53413353338335 15.441360340085023 52-53 21.29282320580145 27.881970492623154 35.22130532633158 15.603900975243812 54-55 21.017754438609654 28.86971742935734 33.908477119279816 16.204051012753187 56-57 20.38774233896185 28.605378361475925 35.35959974984365 15.647279549718574 58-59 20.878158618964225 28.75906930197648 33.63772829622217 16.72504378283713 60-61 21.86913549355686 28.90028775178281 34.14237457775553 15.088202176904792 62-63 21.939924906132667 28.31038798498123 33.72966207759699 16.020025031289112 64-65 21.639549436795996 29.274092615769714 33.72966207759699 15.356695869837298 66-67 22.510334460729048 28.022046849555306 34.347989477639985 15.119629212075662 68-69 21.619250532648202 28.336884321343526 34.12708359443539 15.916781551572878 70-71 22.02157010283421 27.915726109857037 33.320792575871586 16.74191121143717 72-73 22.039018250471994 28.596601636249215 33.95846444304594 15.40591567023285 74-75 20.89787345760042 27.23812024153321 35.37673930165398 16.48726699921239 76 24.866920152091254 0.0 50.57034220532319 24.562737642585553 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 5.0 1 3.0 2 1.0 3 2.0 4 3.0 5 3.0 6 5.0 7 5.0 8 3.0 9 5.5 10 9.5 11 12.0 12 13.0 13 16.5 14 20.0 15 31.5 16 45.5 17 49.0 18 48.5 19 53.0 20 65.5 21 75.0 22 85.0 23 98.0 24 115.5 25 127.0 26 158.0 27 181.5 28 185.5 29 199.0 30 218.0 31 242.0 32 248.5 33 248.0 34 250.0 35 239.5 36 223.5 37 218.0 38 200.5 39 180.5 40 180.0 41 174.0 42 167.0 43 141.5 44 98.5 45 75.5 46 69.5 47 63.5 48 44.5 49 38.0 50 41.0 51 36.0 52 28.0 53 27.5 54 28.0 55 21.5 56 18.0 57 16.0 58 14.5 59 13.0 60 11.0 61 10.5 62 9.5 63 8.0 64 5.0 65 2.0 66 1.0 67 0.5 68 0.5 69 2.5 70 2.0 71 0.0 72 0.5 73 1.0 74 0.5 75 0.0 76 0.0 77 0.0 78 0.5 79 1.0 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 1.0 87 2.0 88 2.0 89 1.0 90 0.5 91 0.5 92 0.0 93 0.0 94 0.5 95 0.5 96 0.0 97 0.5 98 1.5 99 2.5 100 3.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.44999999999999996 2 0.025 3 0.025 4 0.025 5 0.025 6 0.025 7 0.025 8 0.025 9 0.025 10-11 0.025 12-13 0.025 14-15 0.025 16-17 0.025 18-19 0.025 20-21 0.025 22-23 0.025 24-25 0.025 26-27 0.025 28-29 0.025 30-31 0.025 32-33 0.025 34-35 0.025 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.025025025025025023 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0131250820317627 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 1.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 1.0 56 1.0 57 0.0 58 0.0 59 0.0 60 1.0 61 0.0 62 0.0 63 0.0 64 2.0 65 1.0 66 3.0 67 0.0 68 1.0 69 2.0 70 0.0 71 5.0 72 19.0 73 59.0 74 189.0 75 1085.0 76 2630.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.899849774662 99.75 2 0.050075112669003496 0.1 3 0.050075112669003496 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.025 0.0 0.0 0.0 0.0 50 0.025 0.0 0.0 0.0 0.0 51 0.025 0.0 0.0 0.0 0.0 52 0.025 0.0 0.0 0.0 0.0 53 0.025 0.0 0.0 0.0 0.0 54 0.025 0.0 0.0 0.0 0.0 55 0.025 0.0 0.0 0.0 0.0 56 0.025 0.0 0.0 0.0 0.0 57 0.025 0.0 0.0 0.0 0.0 58 0.025 0.0 0.0 0.0 0.0 59 0.025 0.0 0.0 0.0 0.0 60 0.025 0.0 0.0 0.0 0.0 61 0.025 0.0 0.0 0.0 0.0 62 0.025 0.0 0.0 0.0 0.0 63 0.025 0.0 0.0 0.0 0.0 64 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 354492 spots for SRR15142087.sra Written 354492 spots for SRR15142087.sra Read 354492 spots for SRR15142087.sra Written 354492 spots for SRR15142087.sra Read 354492 spots for SRR15142087.sra Written 354492 spots for SRR15142087.sra Read 354492 spots for SRR15142087.sra Written 354492 spots for SRR15142087.sra Read 354492 spots for SRR15142087.sra Written 354492 spots for SRR15142087.sra Read 354492 spots for SRR15142087.sra Written 354492 spots for SRR15142087.sra Read 354492 spots for SRR15142087.sra Written 354492 spots for SRR15142087.sra Read 354492 spots for SRR15142087.sra Written 354492 spots for SRR15142087.sra Read 354492 spots for SRR15142087.sra Written 354492 spots for SRR15142087.sra Read 354492 spots for SRR15142087.sra Written 354492 spots for SRR15142087.sra Read 354492 spots for SRR15142087.sra Written 354492 spots for SRR15142087.sra Read 354492 spots for SRR15142087.sra Written 354492 spots for SRR15142087.sra Read 354492 spots for SRR15142087.sra Read 354492 spots for SRR15142087.sra Written 354492 spots for SRR15142087.sra Written 354492 spots for SRR15142087.sra Read 354492 spots for SRR15142087.sra Written 354492 spots for SRR15142087.sra Read 354497 spots for SRR15142087.sra Written 354497 spots for SRR15142087.sra Read 354492 spots for SRR15142087.sra Written 354492 spots for SRR15142087.sra Read 354492 spots for SRR15142087.sra Written 354492 spots for SRR15142087.sra Read 354492 spots for SRR15142087.sra Written 354492 spots for SRR15142087.sra Read 354492 spots for SRR15142087.sra Written 354492 spots for SRR15142087.sra SRR ids: ['SRR15142087.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ak877ik5 SRR15142087.sra spots: 7089845 blocks: [[1, 354492], [354493, 708984], [708985, 1063476], [1063477, 1417968], [1417969, 1772460], [1772461, 2126952], [2126953, 2481444], [2481445, 2835936], [2835937, 3190428], [3190429, 3544920], [3544921, 3899412], [3899413, 4253904], [4253905, 4608396], [4608397, 4962888], [4962889, 5317380], [5317381, 5671872], [5671873, 6026364], [6026365, 6380856], [6380857, 6735348], [6735349, 7089845]] SRR15142087 file size 1337036 SRR15142087 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR15142087 SRR15142087_1.fastq SRR15142087_2.fastq Input file: SRR15142087_1.fastq Paired file: SRR15142087_2.fastq trimmed: SRR15142087-trimmed-pair1.fastq, SRR15142087-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 06:46:55 2025 >> started Fri Feb 14 06:47:01 2025 >> done (6.184s) 7089845 read pairs processed; of these: 1377 ( 0.02%) short read pairs filtered out after trimming by size control 33538 ( 0.47%) empty read pairs filtered out after trimming by size control 7054930 (99.51%) read pairs available; of these: 10453 ( 0.15%) trimmed read pairs available after processing 7044477 (99.85%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 20 1 0.00% 21 0 0.00% 22 23 0.00% 23 25 0.00% 24 22 0.00% 25 22 0.00% 26 15 0.00% 27 18 0.00% 28 16 0.00% 29 15 0.00% 30 18 0.00% 31 62 0.00% 32 43 0.00% 33 11 0.00% 34 61 0.00% 35 38 0.00% 36 47 0.00% 37 53 0.00% 38 55 0.00% 39 63 0.00% 40 91 0.00% 41 115 0.00% 42 110 0.00% 43 134 0.00% 44 169 0.00% 45 191 0.00% 46 262 0.00% 47 452 0.01% 48 360 0.01% 49 510 0.01% 50 730 0.01% 51 784 0.01% 52 509 0.01% 53 712 0.01% 54 721 0.01% 55 800 0.01% 56 913 0.01% 57 1042 0.01% 58 1093 0.02% 59 1136 0.02% 60 1044 0.01% 61 1110 0.02% 62 1314 0.02% 63 1478 0.02% 64 1650 0.02% 65 1655 0.02% 66 1800 0.03% 67 2205 0.03% 68 2336 0.03% 69 3032 0.04% 70 3174 0.04% 71 3948 0.06% 72 6442 0.09% 73 53098 0.75% 74 532084 7.54% 75 3897604 55.25% 76 2529514 35.85% 7054930 reads passed initial QC criterion=sequence-density sequence-density=0.11 sequence-density-rank=1 fanout-score=115.05 fanout-score-rank=24 prefix-density=0.67 prefix-fanout=18.5 sequence=TTTTTTTAAAAAA criterion=fanout-score sequence-density=0.06 sequence-density-rank=32 fanout-score=503.39 fanout-score-rank=1 prefix-density=0.84 prefix-fanout=33.8 sequence=AAAAGAAAAGAAAA criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=30.47 fanout-score-rank=35 prefix-density=0.57 prefix-fanout=15.4 sequence=TTTTTTTTTTATT criterion=fanout-score sequence-density=0.09 sequence-density-rank=31 fanout-score=204.85 fanout-score-rank=1 prefix-density=1.07 prefix-fanout=16.5 sequence=TTTTATTTTTTA SRR15142087 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 06:47:43 Started mapping on | Feb 14 06:47:43 Finished on | Feb 14 06:49:09 Mapping speed, Million of reads per hour | 295.32 Number of input reads | 7054930 Average input read length | 142 UNIQUE READS: Uniquely mapped reads number | 4374163 Uniquely mapped reads % | 62.00% Average mapped length | 140.07 Number of splices: Total | 72767 Number of splices: Annotated (sjdb) | 43842 Number of splices: GT/AG | 51267 Number of splices: GC/AG | 1290 Number of splices: AT/AC | 302 Number of splices: Non-canonical | 19908 Mismatch rate per base, % | 0.81% Deletion rate per base | 0.09% Deletion average length | 1.43 Insertion rate per base | 0.12% Insertion average length | 1.39 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 224851 % of reads mapped to multiple loci | 3.19% Number of reads mapped to too many loci | 58972 % of reads mapped to too many loci | 0.84% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 33.84% % of reads unmapped: other | 0.14% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2456664 2456664 2456664 N_multimapping 224851 224851 224851 N_noFeature 3008230 3668865 3700581 N_ambiguous 23296 6977 3510 UnstrandedReadsAssigned:1342637 PositiveStrandReadsAssigned:698321 NegativeStrandReadsAssigned:670072 Dataset is classified unstranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR15142087 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR15142087-trimmed-pair1.fastq SRR15142087-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 7,054,930 reads, 1,781,275 reads pseudoaligned [quant] estimated average fragment length: 146.453 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 929 rounds 52401 SRR15142087.ke.tsv 34699 SRR15142087.se.tsv 87100 total ==> SRR15142087.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1872.55 87 27.3522 Potri.005G024800.1.v4.1 1035 889.547 33 21.8399 Potri.004G059700.1.v4.1 961 815.556 4 2.88743 Potri.007G009000.2.v4.1 1416 1270.55 17 7.87706 Potri.003G141000.2.v4.1 2943 2797.55 17 3.57748 Potri.016G087400.1.v4.1 270 128.778 9 41.144 Potri.015G069301.1.v4.1 564 418.819 0 0 Potri.010G195200.1.v4.1 1773 1627.55 65 23.5118 Potri.012G127500.1.v4.1 977 831.556 2 1.41594 ==> SRR15142087.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 67 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 33 Potri.001G212900.v4.1 4 Potri.001G182400.v4.1 12 Potri.001G256600.v4.1 18 Potri.001G040500.v4.1 3 Potri.001G416900.v4.1 9 Potri.001G452600.v4.1 37 SRR15142087 completed mapping pipeline successfully