Starting /dee2/code/volunteer_pipeline.sh SRR15142088 current disk space = 3085083119616 free memory = 1582617340 SRR15142088 SRAfilesize 34bc5217758d9277e2fbe369edbde16b SRR15142088.sra SRR15142088.sra file validated SRR15142088 is paired end SRR15142088 is conventional basespace SRR15142088 read1 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR15142088_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 36 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.17825 32.0 32.0 32.0 32.0 32.0 2 31.51475 32.0 32.0 32.0 32.0 32.0 3 31.469 32.0 32.0 32.0 32.0 32.0 4 31.52775 32.0 32.0 32.0 32.0 32.0 5 31.522 32.0 32.0 32.0 32.0 32.0 6 35.224 36.0 36.0 36.0 36.0 36.0 7 35.176 36.0 36.0 36.0 36.0 36.0 8 35.33525 36.0 36.0 36.0 36.0 36.0 9 35.30975 36.0 36.0 36.0 36.0 36.0 10-11 35.208749999999995 36.0 36.0 36.0 36.0 36.0 12-13 35.391375 36.0 36.0 36.0 36.0 36.0 14-15 35.333875000000006 36.0 36.0 36.0 36.0 36.0 16-17 35.291875 36.0 36.0 36.0 36.0 36.0 18-19 35.264375 36.0 36.0 36.0 36.0 36.0 20-21 35.242125 36.0 36.0 36.0 36.0 36.0 22-23 35.197625 36.0 36.0 36.0 36.0 36.0 24-25 35.15025 36.0 36.0 36.0 36.0 36.0 26-27 35.142375 36.0 36.0 36.0 36.0 36.0 28-29 35.092749999999995 36.0 36.0 36.0 36.0 36.0 30-31 35.1125 36.0 36.0 36.0 36.0 36.0 32-33 35.024375000000006 36.0 36.0 36.0 36.0 36.0 34-35 35.012625 36.0 36.0 36.0 36.0 36.0 36-37 35.07803901950976 36.0 36.0 36.0 36.0 36.0 38-39 35.02338669334667 36.0 36.0 36.0 36.0 36.0 40-41 35.06153076538269 36.0 36.0 36.0 36.0 36.0 42-43 34.93534267133567 36.0 36.0 36.0 36.0 36.0 44-45 34.87281140570285 36.0 36.0 36.0 36.0 36.0 46-47 34.91245622811405 36.0 36.0 36.0 36.0 36.0 48-49 34.83016508254127 36.0 36.0 36.0 36.0 36.0 50-51 34.73111555777889 36.0 36.0 36.0 32.0 36.0 52-53 34.7776388194097 36.0 36.0 36.0 34.0 36.0 54-55 34.61093046523261 36.0 36.0 36.0 32.0 36.0 56-57 34.61993496748374 36.0 36.0 36.0 32.0 36.0 58-59 34.57578789394697 36.0 36.0 36.0 32.0 36.0 60-61 34.58904452226113 36.0 36.0 36.0 32.0 36.0 62-63 34.50887943971986 36.0 36.0 36.0 32.0 36.0 64-65 34.48511755877939 36.0 36.0 36.0 32.0 36.0 66-67 34.44277567855732 36.0 36.0 36.0 32.0 36.0 68-69 34.43373251223689 36.0 36.0 36.0 32.0 36.0 70-71 34.502753441802255 36.0 36.0 36.0 32.0 36.0 72-73 34.272089778827734 36.0 36.0 36.0 32.0 36.0 74-75 34.194814284293166 36.0 36.0 36.0 32.0 36.0 76 33.97322175732218 36.0 36.0 36.0 32.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 2.0 23 2.0 24 5.0 25 15.0 26 22.0 27 25.0 28 33.0 29 52.0 30 68.0 31 106.0 32 133.0 33 228.0 34 597.0 35 2709.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.30499122146978 11.913719588663154 17.707549535991973 38.073739653875094 2 24.987493746873437 15.332666333166584 38.519259629814904 21.160580290145074 3 22.28614307153577 23.1615807903952 27.238619309654826 27.313656828414207 4 26.013006503251624 28.939469734867433 25.48774387193597 19.559779889944974 5 25.212606303151574 34.14207103551776 25.86293146573287 14.7823911955978 6 18.084042021010504 35.19259629814908 31.6408204102051 15.08254127063532 7 13.1815907953977 25.78789394697349 48.624312156078034 12.406203101550775 8 16.53326663331666 25.46273136568284 40.0200100050025 17.983991995998 9 18.534267133566786 23.836918459229615 39.41970985492746 18.209104552276138 10-11 18.309154577288645 38.76938469234617 28.989494747373683 13.931965982991496 12-13 18.48424212106053 29.464732366183092 34.94247123561781 17.10855427713857 14-15 17.70885442721361 31.62831415707854 34.017008504252125 16.645822911455728 16-17 18.2216108054027 31.578289144572285 33.09154577288644 17.10855427713857 18-19 17.64632316158079 32.69134567283642 32.641320660330166 17.021010505252626 20-21 18.384192096048025 31.140570285142573 32.35367683841921 18.121560780390194 22-23 18.10905452726363 31.803401700850426 32.1535767883942 17.933966983491743 24-25 18.396698349174585 32.60380190095047 32.60380190095047 16.395697848924463 26-27 18.18409204602301 32.728864432216106 31.85342671335668 17.2336168084042 28-29 18.196598299149574 31.540770385192594 32.7663831915958 17.49624812406203 30-31 18.13406703351676 32.253626813406704 32.61630815407704 16.9959979989995 32-33 18.509254627313656 31.503251625812904 33.16658329164582 16.820910455227615 34-35 18.14657328664332 32.1535767883942 32.75387693846923 16.945972986493246 36-37 17.446223111555778 31.82841420710355 32.79139569784893 17.933966983491743 38-39 17.283641820910457 33.204102051025515 32.44122061030515 17.07103551775888 40-41 17.83391695847924 32.553776888444226 32.666333166583286 16.945972986493246 42-43 18.234117058529264 32.86643321660831 32.86643321660831 16.03301650825413 44-45 18.034017008504254 33.291645822911455 31.94097048524262 16.73336668334167 46-47 18.546773386693346 32.1535767883942 32.69134567283642 16.60830415207604 48-49 17.521260630315158 32.50375187593797 32.42871435717859 17.54627313656828 50-51 18.2216108054027 32.22861430715358 32.07853926963482 17.471235617808905 52-53 17.94647323661831 32.903951975987994 32.103551775887944 17.046023011505753 54-55 18.509254627313656 31.41570785392696 33.354177088544276 16.720860430215108 56-57 17.67133566783392 32.94147073536769 32.91645822911456 16.470735367683844 58-59 18.14657328664332 32.60380190095047 31.953476738369186 17.296148074037017 60-61 17.521260630315158 33.17908954477239 31.96598299149575 17.333666833416707 62-63 19.297148574287142 31.540770385192594 31.765882941470736 17.396198099049524 64-65 16.9959979989995 32.87893946973487 32.566283141570786 17.55877938969485 66-67 18.461538461538463 32.132582864290185 32.745465916197624 16.660412757973734 68-69 18.6084344887999 32.79939932423977 31.86084344887999 16.73132273808034 70-71 18.085106382978726 33.0287859824781 31.87734668335419 17.008760951188986 72-73 18.09846772167797 33.031901532278326 32.61743280582768 16.252197940216025 74-75 17.526994996049513 31.485383197260997 33.67131946273374 17.316302343955755 76 21.04602510460251 0.0 51.88284518828452 27.071129707112974 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 3.0 1 2.5 2 1.0 3 0.5 4 1.0 5 1.5 6 2.0 7 1.5 8 1.0 9 2.0 10 4.5 11 4.5 12 3.0 13 5.0 14 13.0 15 21.5 16 23.5 17 20.5 18 29.0 19 42.5 20 47.5 21 52.5 22 63.5 23 80.5 24 95.5 25 106.5 26 114.5 27 127.5 28 148.5 29 163.5 30 172.5 31 200.0 32 225.0 33 241.0 34 248.5 35 238.5 36 243.0 37 261.5 38 247.5 39 233.5 40 229.5 41 200.5 42 174.0 43 165.5 44 154.0 45 136.5 46 128.5 47 111.5 48 95.0 49 75.5 50 56.5 51 43.0 52 35.5 53 34.5 54 33.5 55 26.0 56 16.5 57 13.5 58 9.0 59 8.5 60 6.5 61 3.5 62 2.5 63 2.5 64 2.0 65 1.5 66 1.5 67 1.0 68 3.0 69 4.0 70 1.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.5 76 1.0 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.325 2 0.05 3 0.05 4 0.05 5 0.05 6 0.05 7 0.05 8 0.05 9 0.05 10-11 0.05 12-13 0.05 14-15 0.05 16-17 0.05 18-19 0.05 20-21 0.05 22-23 0.05 24-25 0.05 26-27 0.05 28-29 0.05 30-31 0.05 32-33 0.05 34-35 0.05 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 2.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 1.0 67 1.0 68 1.0 69 0.0 70 0.0 71 5.0 72 18.0 73 65.0 74 220.0 75 1297.0 76 2390.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74931060416145 99.47500000000001 2 0.22562045625470042 0.44999999999999996 3 0.0250689395838556 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAATTTA 20 0.0066256956 52.1625 46 >>END_MODULE SRR15142088 read2 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR15142088_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 34 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.0305 32.0 32.0 32.0 32.0 32.0 2 31.26375 32.0 32.0 32.0 32.0 32.0 3 31.3295 32.0 32.0 32.0 32.0 32.0 4 31.214 32.0 32.0 32.0 32.0 32.0 5 31.336 32.0 32.0 32.0 32.0 32.0 6 34.91825 36.0 36.0 36.0 36.0 36.0 7 35.06675 36.0 36.0 36.0 36.0 36.0 8 35.1095 36.0 36.0 36.0 36.0 36.0 9 35.01725 36.0 36.0 36.0 36.0 36.0 10-11 34.942499999999995 36.0 36.0 36.0 36.0 36.0 12-13 35.10075 36.0 36.0 36.0 36.0 36.0 14-15 34.964 36.0 36.0 36.0 36.0 36.0 16-17 35.11525 36.0 36.0 36.0 36.0 36.0 18-19 35.140875 36.0 36.0 36.0 36.0 36.0 20-21 34.926125 36.0 36.0 36.0 36.0 36.0 22-23 34.721999999999994 36.0 36.0 36.0 36.0 36.0 24-25 34.38549999999999 36.0 36.0 36.0 32.0 36.0 26-27 34.057874999999996 36.0 36.0 36.0 32.0 36.0 28-29 33.945875 36.0 36.0 36.0 32.0 36.0 30-31 33.714875 36.0 36.0 36.0 24.0 36.0 32-33 33.687 36.0 36.0 36.0 21.0 36.0 34-35 33.541125 36.0 36.0 36.0 21.0 36.0 36-37 33.53075768942236 36.0 36.0 36.0 21.0 36.0 38-39 33.30695173793448 36.0 36.0 36.0 21.0 36.0 40-41 33.26794198549638 36.0 36.0 36.0 17.5 36.0 42-43 33.347836959239814 36.0 36.0 36.0 21.0 36.0 44-45 33.51175293823456 36.0 36.0 36.0 21.0 36.0 46-47 33.441610402600645 36.0 36.0 36.0 21.0 36.0 48-49 33.320080020005 36.0 36.0 36.0 21.0 36.0 50-51 32.9291072768192 36.0 34.0 36.0 14.0 36.0 52-53 33.038884721180295 36.0 36.0 36.0 17.5 36.0 54-55 33.15091272818205 36.0 36.0 36.0 14.0 36.0 56-57 33.064516129032256 36.0 36.0 36.0 14.0 36.0 58-59 33.05651412853213 36.0 36.0 36.0 14.0 36.0 60-61 32.98862215553889 36.0 36.0 36.0 14.0 36.0 62-63 32.86496624156039 36.0 34.0 36.0 14.0 36.0 64-65 32.69929982495624 36.0 32.0 36.0 14.0 36.0 66-67 32.84033508377094 36.0 34.0 36.0 14.0 36.0 68-69 32.72545770633628 36.0 32.0 36.0 14.0 36.0 70-71 32.571499758452475 36.0 32.0 36.0 14.0 36.0 72-73 32.52863112940721 36.0 32.0 36.0 14.0 36.0 74-75 32.5702509940799 36.0 32.0 36.0 14.0 36.0 76 31.896769109535068 36.0 32.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 1.0 19 1.0 20 6.0 21 9.0 22 15.0 23 38.0 24 48.0 25 74.0 26 78.0 27 81.0 28 90.0 29 70.0 30 104.0 31 119.0 32 176.0 33 346.0 34 1053.0 35 1689.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.567126725219573 20.777917189460478 23.136762860727732 31.518193224592224 2 17.20430107526882 28.482120530132534 42.5856464116029 11.727931982995749 3 15.378844711177795 30.407601900475118 39.23480870217554 14.978744686171543 4 19.979994998749685 35.108777194298575 30.332583145786447 14.57864466116529 5 19.129782445611404 37.78444611152788 29.957489372343087 13.12828207051763 6 12.878219554888723 38.884721180295074 34.08352088022005 14.153538384596148 7 10.677669417354338 16.27906976744186 56.31407851962991 16.729182295573892 8 14.87871967991998 23.355838959739934 41.2353088272068 20.530132533133283 9 17.67941985496374 24.681170292573142 38.009502375593904 19.629907476869217 10-11 17.37934483620905 34.60865216304076 32.24556139034759 15.766441610402602 12-13 15.9039759939985 26.106526631657918 40.835208802200555 17.154288572143038 14-15 14.303575893973495 27.994498624656167 42.14803700925231 15.55388847211803 16-17 15.191297824456115 28.732183045761438 40.447611902975744 15.628907226806701 18-19 15.916479119779945 29.469867466866717 39.09727431857964 15.516379094773693 20-21 15.766441610402602 29.294823705926483 38.959739934983745 15.978994748687173 22-23 15.478869717429358 30.670167541885473 38.42210552638159 15.428857214303576 24-25 16.01650412603151 30.64516129032258 37.62190547636909 15.71642910727682 26-27 16.32908227056764 30.882720680170046 36.30907726931733 16.479119779944988 28-29 16.90422605651413 31.357839459864966 35.55888972243061 16.179044761190298 30-31 16.966741685421354 30.92023005751438 35.04626156539135 17.066766691672917 32-33 17.416854213553385 31.707926981745437 33.983495873968494 16.891722930732683 34-35 16.55413853463366 32.04551137784446 34.646161540385094 16.754188547136785 36-37 16.991747936984247 33.04576144036009 33.983495873968494 15.978994748687173 38-39 17.516879219804952 31.15778944736184 35.0587646911728 16.266566641660415 40-41 17.329332333083272 32.25806451612903 33.845961490372595 16.566641660415105 42-43 17.554388597149288 31.420355088772194 34.49612403100775 16.52913228307077 44-45 17.35433858464616 32.75818954738685 33.20830207551888 16.67916979244811 46-47 17.716929232308075 31.607901975493874 33.25831457864466 17.416854213553385 48-49 17.366841710427607 30.90772693173293 34.208552138034506 17.516879219804952 50-51 20.155038759689923 30.707676919229808 32.358089522380595 16.779194798699677 52-53 19.092273068267065 31.13278319579895 33.19579894973743 16.579144786196547 54-55 18.54213553388347 31.057764441110276 33.59589897474369 16.804201050262566 56-57 19.179794948737182 30.55763940985246 33.19579894973743 17.066766691672917 58-59 19.317329332333085 30.92023005751438 32.54563640910227 17.216804201050262 60-61 19.479869967491872 29.794948737184296 32.433108277069266 18.292073018254566 62-63 19.667416854213553 30.195048762190545 33.05826456614154 17.079269817454364 64-65 19.56739184796199 30.620155038759687 32.733183295823956 17.079269817454364 66-67 19.904976244061015 30.220055013753438 33.59589897474369 16.27906976744186 68-69 19.299562226391494 30.73170731707317 33.15822388993121 16.81050656660413 70-71 18.891530088827725 31.189791067183787 33.50431627674215 16.41436256724634 72-73 20.15318935208438 30.562531391260674 32.33299849321949 16.95128076343546 74-75 18.044222163727298 28.783890497499343 34.706501710976575 18.46538562779679 76 21.31599684791174 0.0 52.28526398739165 26.39873916469661 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 2.0 1 3.0 2 2.0 3 1.5 4 3.0 5 2.0 6 3.0 7 4.0 8 2.5 9 5.5 10 8.5 11 11.5 12 14.5 13 18.5 14 24.5 15 25.5 16 27.0 17 33.5 18 43.5 19 53.0 20 63.0 21 74.5 22 89.0 23 107.5 24 117.0 25 111.5 26 126.5 27 153.0 28 175.5 29 204.0 30 214.0 31 223.5 32 246.5 33 250.0 34 250.5 35 254.0 36 248.5 37 235.5 38 219.5 39 212.5 40 201.5 41 187.0 42 166.0 43 140.0 44 107.5 45 89.5 46 93.5 47 78.0 48 58.5 49 54.0 50 49.5 51 37.5 52 31.0 53 28.5 54 23.5 55 19.5 56 16.5 57 13.5 58 7.0 59 11.5 60 14.5 61 8.0 62 5.5 63 5.0 64 3.5 65 3.0 66 3.0 67 3.5 68 3.0 69 1.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.5 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.375 2 0.025 3 0.025 4 0.025 5 0.025 6 0.025 7 0.025 8 0.025 9 0.025 10-11 0.025 12-13 0.025 14-15 0.025 16-17 0.025 18-19 0.025 20-21 0.025 22-23 0.025 24-25 0.025 26-27 0.025 28-29 0.025 30-31 0.025 32-33 0.025 34-35 0.025 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 1.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 1.0 68 1.0 69 0.0 70 1.0 71 3.0 72 22.0 73 67.0 74 210.0 75 1156.0 76 2538.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.9 #Duplication Level Percentage of deduplicated Percentage of total 1 99.8998998998999 99.8 2 0.10010010010010009 0.2 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 295595 spots for SRR15142088.sra Written 295595 spots for SRR15142088.sra Read 295595 spots for SRR15142088.sra Written 295595 spots for SRR15142088.sra Read 295595 spots for SRR15142088.sra Written 295595 spots for SRR15142088.sra Read 295595 spots for SRR15142088.sra Written 295595 spots for SRR15142088.sra Read 295595 spots for SRR15142088.sra Written 295595 spots for SRR15142088.sra Read 295595 spots for SRR15142088.sra Written 295595 spots for SRR15142088.sra Read 295595 spots for SRR15142088.sra Written 295595 spots for SRR15142088.sra Read 295595 spots for SRR15142088.sra Written 295595 spots for SRR15142088.sra Read 295595 spots for SRR15142088.sra Written 295595 spots for SRR15142088.sra Read 295595 spots for SRR15142088.sra Written 295595 spots for SRR15142088.sra Read 295595 spots for SRR15142088.sra Written 295595 spots for SRR15142088.sra Read 295595 spots for SRR15142088.sra Written 295595 spots for SRR15142088.sra Read 295595 spots for SRR15142088.sra Written 295595 spots for SRR15142088.sra Read 295595 spots for SRR15142088.sra Written 295595 spots for SRR15142088.sra Read 295595 spots for SRR15142088.sra Written 295595 spots for SRR15142088.sra Read 295595 spots for SRR15142088.sra Written 295595 spots for SRR15142088.sra Read 295595 spots for SRR15142088.sra Written 295595 spots for SRR15142088.sra Read 295595 spots for SRR15142088.sra Written 295595 spots for SRR15142088.sra Read 295595 spots for SRR15142088.sra Written 295595 spots for SRR15142088.sra Read 295614 spots for SRR15142088.sra Written 295614 spots for SRR15142088.sra SRR ids: ['SRR15142088.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_862g67qy SRR15142088.sra spots: 5911919 blocks: [[1, 295595], [295596, 591190], [591191, 886785], [886786, 1182380], [1182381, 1477975], [1477976, 1773570], [1773571, 2069165], [2069166, 2364760], [2364761, 2660355], [2660356, 2955950], [2955951, 3251545], [3251546, 3547140], [3547141, 3842735], [3842736, 4138330], [4138331, 4433925], [4433926, 4729520], [4729521, 5025115], [5025116, 5320710], [5320711, 5616305], [5616306, 5911919]] SRR15142088 file size 1115997 SRR15142088 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR15142088 SRR15142088_1.fastq SRR15142088_2.fastq Input file: SRR15142088_1.fastq Paired file: SRR15142088_2.fastq trimmed: SRR15142088-trimmed-pair1.fastq, SRR15142088-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 06:39:49 2025 >> started Fri Feb 14 06:39:54 2025 >> done (4.911s) 5911919 read pairs processed; of these: 1121 ( 0.02%) short read pairs filtered out after trimming by size control 18403 ( 0.31%) empty read pairs filtered out after trimming by size control 5892395 (99.67%) read pairs available; of these: 8487 ( 0.14%) trimmed read pairs available after processing 5883908 (99.86%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 22 27 0.00% 23 16 0.00% 24 14 0.00% 25 14 0.00% 26 16 0.00% 27 11 0.00% 28 12 0.00% 29 7 0.00% 30 14 0.00% 31 16 0.00% 32 30 0.00% 33 2 0.00% 34 21 0.00% 35 14 0.00% 36 11 0.00% 37 16 0.00% 38 13 0.00% 39 17 0.00% 40 20 0.00% 41 20 0.00% 42 38 0.00% 43 40 0.00% 44 40 0.00% 45 43 0.00% 46 98 0.00% 47 213 0.00% 48 152 0.00% 49 193 0.00% 50 370 0.01% 51 472 0.01% 52 169 0.00% 53 302 0.01% 54 315 0.01% 55 283 0.00% 56 322 0.01% 57 393 0.01% 58 454 0.01% 59 331 0.01% 60 292 0.00% 61 337 0.01% 62 411 0.01% 63 451 0.01% 64 533 0.01% 65 515 0.01% 66 551 0.01% 67 667 0.01% 68 698 0.01% 69 1054 0.02% 70 1102 0.02% 71 1606 0.03% 72 3919 0.07% 73 44662 0.76% 74 455487 7.73% 75 3211720 54.51% 76 2163851 36.72% 5892395 reads passed initial QC criterion=sequence-density sequence-density=0.12 sequence-density-rank=1 fanout-score=135.35 fanout-score-rank=24 prefix-density=0.55 prefix-fanout=30.1 sequence=TTTTTTTTTTAA criterion=fanout-score sequence-density=0.05 sequence-density-rank=31 fanout-score=468.49 fanout-score-rank=1 prefix-density=0.70 prefix-fanout=32.9 sequence=AAAAGAAAAGAAAA criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=79.63 fanout-score-rank=27 prefix-density=0.49 prefix-fanout=26.3 sequence=TTTTTTTTTTAA criterion=fanout-score sequence-density=0.07 sequence-density-rank=33 fanout-score=263.09 fanout-score-rank=1 prefix-density=0.71 prefix-fanout=24.6 sequence=TTTTCTTTTTTT SRR15142088 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 06:40:29 Started mapping on | Feb 14 06:40:30 Finished on | Feb 14 06:41:14 Mapping speed, Million of reads per hour | 482.11 Number of input reads | 5892395 Average input read length | 150 UNIQUE READS: Uniquely mapped reads number | 4246826 Uniquely mapped reads % | 72.07% Average mapped length | 147.92 Number of splices: Total | 111810 Number of splices: Annotated (sjdb) | 71207 Number of splices: GT/AG | 79622 Number of splices: GC/AG | 1738 Number of splices: AT/AC | 430 Number of splices: Non-canonical | 30020 Mismatch rate per base, % | 0.76% Deletion rate per base | 0.10% Deletion average length | 1.42 Insertion rate per base | 0.13% Insertion average length | 1.42 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 205949 % of reads mapped to multiple loci | 3.50% Number of reads mapped to too many loci | 43066 % of reads mapped to too many loci | 0.73% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 23.59% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1439832 1439832 1439832 N_multimapping 205949 205949 205949 N_noFeature 2862146 3493888 3602302 N_ambiguous 24309 7999 3697 UnstrandedReadsAssigned:1360371 PositiveStrandReadsAssigned:744939 NegativeStrandReadsAssigned:640827 Dataset is classified unstranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR15142088 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR15142088-trimmed-pair1.fastq SRR15142088-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 5,892,395 reads, 1,660,154 reads pseudoaligned [quant] estimated average fragment length: 174.183 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 939 rounds 52401 SRR15142088.ke.tsv 34699 SRR15142088.se.tsv 87100 total ==> SRR15142088.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1844.82 73 23.4412 Potri.005G024800.1.v4.1 1035 861.817 41 28.1824 Potri.004G059700.1.v4.1 961 787.86 6 4.5114 Potri.007G009000.2.v4.1 1416 1242.82 18 8.57976 Potri.003G141000.2.v4.1 2943 2769.82 12 2.56649 Potri.016G087400.1.v4.1 270 108.524 24 131.007 Potri.015G069301.1.v4.1 564 391.339 0 0 Potri.010G195200.1.v4.1 1773 1599.82 40 14.8115 Potri.012G127500.1.v4.1 977 803.843 10 7.36951 ==> SRR15142088.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 12 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 41 Potri.001G212900.v4.1 23 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 8 Potri.001G040500.v4.1 4 Potri.001G416900.v4.1 3 Potri.001G452600.v4.1 70 SRR15142088 completed mapping pipeline successfully