Starting /dee2/code/volunteer_pipeline.sh SRR17200365 current disk space = 3049182760960 free memory = 1487558020 SRR17200365 SRAfilesize 63aaf2252de32bf0266ecea1bd040448 SRR17200365.sra SRR17200365.sra file validated SRR17200365 is paired end SRR17200365 is conventional basespace SRR17200365 read1 length is 92-141 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR17200365_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 92-141 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.396 37.0 37.0 37.0 37.0 37.0 2 36.678 37.0 37.0 37.0 37.0 37.0 3 36.437 37.0 37.0 37.0 37.0 37.0 4 36.551 37.0 37.0 37.0 37.0 37.0 5 36.3925 37.0 37.0 37.0 37.0 37.0 6 36.4255 37.0 37.0 37.0 37.0 37.0 7 35.9625 37.0 37.0 37.0 37.0 37.0 8 36.583 37.0 37.0 37.0 37.0 37.0 9 36.591 37.0 37.0 37.0 37.0 37.0 10-14 36.429899999999996 37.0 37.0 37.0 37.0 37.0 15-19 36.4722 37.0 37.0 37.0 37.0 37.0 20-24 36.4541 37.0 37.0 37.0 37.0 37.0 25-29 36.35530000000001 37.0 37.0 37.0 37.0 37.0 30-34 36.2641 37.0 37.0 37.0 37.0 37.0 35-39 36.411899999999996 37.0 37.0 37.0 37.0 37.0 40-44 36.4745 37.0 37.0 37.0 37.0 37.0 45-49 36.3412 37.0 37.0 37.0 37.0 37.0 50-54 36.360200000000006 37.0 37.0 37.0 37.0 37.0 55-59 36.3609 37.0 37.0 37.0 37.0 37.0 60-64 36.357099999999996 37.0 37.0 37.0 37.0 37.0 65-69 36.2864 37.0 37.0 37.0 37.0 37.0 70-74 36.0184 37.0 37.0 37.0 37.0 37.0 75-79 36.009100000000004 37.0 37.0 37.0 37.0 37.0 80-84 36.34949999999999 37.0 37.0 37.0 37.0 37.0 85-89 36.2868 37.0 37.0 37.0 37.0 37.0 90-94 35.89556730153996 37.0 37.0 37.0 37.0 37.0 95-99 36.27522149945473 37.0 37.0 37.0 37.0 37.0 100-104 36.16948282463016 37.0 37.0 37.0 37.0 37.0 105-109 36.12985783663314 37.0 37.0 37.0 37.0 37.0 110-114 36.06646655393662 37.0 37.0 37.0 37.0 37.0 115-119 36.02625137687811 37.0 37.0 37.0 37.0 37.0 120-124 36.16291106000364 37.0 37.0 37.0 37.0 37.0 125-129 36.144550199302046 37.0 37.0 37.0 37.0 37.0 130-134 35.87022985322625 37.0 37.0 37.0 37.0 37.0 135-139 36.1161451121573 37.0 37.0 37.0 37.0 37.0 140-141 35.81777900858488 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 1.0 24 1.0 25 1.0 26 3.0 27 4.0 28 14.0 29 12.0 30 24.0 31 34.0 32 52.0 33 59.0 34 116.0 35 403.0 36 2928.0 37 348.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 17.925 12.075 42.875 27.125 2 18.925 16.05 26.424999999999997 38.6 3 23.799999999999997 23.674999999999997 23.65 28.875 4 22.275 29.7 27.425 20.599999999999998 5 16.975 31.324999999999996 29.299999999999997 22.400000000000002 6 13.4 24.925 43.75 17.925 7 15.275 22.125 36.85 25.75 8 17.8 22.175 35.0 25.025 9 17.325 35.85 27.375 19.45 10-14 20.685000000000002 27.500000000000004 28.215 23.599999999999998 15-19 20.165 28.194999999999997 28.095 23.544999999999998 20-24 20.755000000000003 27.915 27.6 23.73 25-29 19.830000000000002 28.060000000000002 28.09 24.02 30-34 20.06 28.22 27.99 23.73 35-39 20.169999999999998 28.1 28.315 23.415 40-44 19.99 27.725 28.065 24.22 45-49 20.28 28.544999999999998 27.52 23.655 50-54 20.65 28.175 27.750000000000004 23.425 55-59 20.31 28.084999999999997 27.575 24.03 60-64 20.465 28.16 27.435 23.94 65-69 20.31 27.505000000000003 27.935 24.25 70-74 19.85 27.735 28.325 24.09 75-79 19.994999999999997 27.655 27.96 24.39 80-84 20.335 28.22 28.215 23.23 85-89 20.244999999999997 27.700000000000003 27.98 24.075 90-94 20.28710048516981 27.784724653628768 28.08482969039164 23.843345170809783 95-99 19.79501607717042 28.135048231511256 28.170217041800644 23.899718649517684 100-104 19.533380466619533 27.86082213917786 28.375921624078376 24.229875770124227 105-109 20.047878571792392 28.13120766057149 28.08027300972852 23.740640757907606 110-114 20.575073298698626 28.239288102463867 27.529448073658763 23.656190525178747 115-119 20.226951838100714 28.06568007111855 27.966323275636668 23.741044815144065 120-124 20.25505576009818 28.18953097486794 27.586574889280186 23.968838375753695 125-129 19.692661052171058 27.704254621021544 27.82456524116811 24.778519085639285 130-134 20.443090556632512 28.59595679867073 27.632234837995018 23.328717806701746 135-139 20.099695375242316 28.71780670174467 27.97563001938521 23.206867903627803 140-141 20.81140958183329 28.88396566048186 26.723899196898365 23.580725560786487 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.5 20 2.0 21 2.0 22 4.0 23 3.0 24 1.5 25 3.0 26 4.5 27 10.0 28 13.5 29 16.0 30 16.5 31 18.0 32 30.5 33 52.5 34 65.0 35 77.5 36 95.0 37 99.5 38 116.5 39 150.5 40 180.5 41 227.5 42 269.0 43 276.5 44 280.5 45 264.5 46 247.5 47 249.0 48 228.5 49 191.5 50 159.5 51 131.0 52 122.0 53 104.0 54 70.5 55 45.0 56 35.0 57 33.5 58 30.5 59 25.0 60 14.0 61 10.5 62 7.0 63 6.0 64 5.0 65 1.5 66 1.5 67 1.5 68 1.5 69 1.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-141 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 92-93 6.0 94-95 11.0 96-97 4.0 98-99 11.0 100-101 9.0 102-103 7.0 104-105 18.0 106-107 13.0 108-109 15.0 110-111 20.0 112-113 15.0 114-115 33.0 116-117 26.0 118-119 32.0 120-121 34.0 122-123 28.0 124-125 38.0 126-127 46.0 128-129 23.0 130-131 0.0 132-133 0.0 134-135 0.0 136-137 0.0 138-139 0.0 140-141 3611.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 88.675 #Duplication Level Percentage of deduplicated Percentage of total 1 88.83563574851988 78.77499999999999 2 9.811107978573443 17.4 3 1.240484916831125 3.3000000000000003 4 0.05638567803777841 0.2 5 0.0 0.0 6 0.028192839018889203 0.15 7 0.028192839018889203 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTCCATTCAGCTAATTCATTTGTTCATGCCAGTTGCCTTCTTAATTCCTT 7 0.17500000000000002 No Hit CCATCTTTATCAGCACCCACAGTTTTGTCCACTAATTTTCCATCTTTCAG 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTGTAAC 10 0.008747476 133.4875 1 >>END_MODULE SRR17200365 read2 length is 92-141 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR17200365_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 92-141 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.296 37.0 37.0 37.0 37.0 37.0 2 36.472 37.0 37.0 37.0 37.0 37.0 3 36.5855 37.0 37.0 37.0 37.0 37.0 4 36.2625 37.0 37.0 37.0 37.0 37.0 5 36.3815 37.0 37.0 37.0 37.0 37.0 6 36.4205 37.0 37.0 37.0 37.0 37.0 7 36.438 37.0 37.0 37.0 37.0 37.0 8 36.2095 37.0 37.0 37.0 37.0 37.0 9 35.9165 37.0 37.0 37.0 37.0 37.0 10-14 36.4071 37.0 37.0 37.0 37.0 37.0 15-19 36.1931 37.0 37.0 37.0 37.0 37.0 20-24 36.088 37.0 37.0 37.0 34.6 37.0 25-29 36.1798 37.0 37.0 37.0 37.0 37.0 30-34 36.3396 37.0 37.0 37.0 37.0 37.0 35-39 36.3112 37.0 37.0 37.0 37.0 37.0 40-44 36.0737 37.0 37.0 37.0 37.0 37.0 45-49 36.1569 37.0 37.0 37.0 37.0 37.0 50-54 36.2687 37.0 37.0 37.0 37.0 37.0 55-59 35.990300000000005 37.0 37.0 37.0 34.6 37.0 60-64 36.2975 37.0 37.0 37.0 37.0 37.0 65-69 35.9594 37.0 37.0 37.0 37.0 37.0 70-74 36.04130000000001 37.0 37.0 37.0 37.0 37.0 75-79 35.567 37.0 37.0 37.0 34.6 37.0 80-84 35.9925 37.0 37.0 37.0 34.6 37.0 85-89 35.9951 37.0 37.0 37.0 37.0 37.0 90-94 35.94331385301258 37.0 37.0 37.0 34.6 37.0 95-99 35.69554170581897 37.0 37.0 37.0 34.6 37.0 100-104 36.03315028426401 37.0 37.0 37.0 37.0 37.0 105-109 35.76949649111798 37.0 37.0 37.0 34.6 37.0 110-114 35.77417182694944 37.0 37.0 37.0 37.0 37.0 115-119 36.025756950365476 37.0 37.0 37.0 37.0 37.0 120-124 35.934471333308906 37.0 37.0 37.0 37.0 37.0 125-129 35.65003455949768 37.0 37.0 37.0 34.6 37.0 130-134 35.651257948576166 37.0 37.0 37.0 34.6 37.0 135-139 35.879513408902405 37.0 37.0 37.0 37.0 37.0 140-141 35.57810340060824 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 2.0 23 3.0 24 2.0 25 1.0 26 0.0 27 8.0 28 10.0 29 15.0 30 18.0 31 22.0 32 55.0 33 95.0 34 217.0 35 660.0 36 2699.0 37 193.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 21.925 26.8 33.85 17.424999999999997 2 21.5 28.449999999999996 30.7 19.35 3 25.45 34.449999999999996 20.575 19.525000000000002 4 21.875 39.300000000000004 21.825 17.0 5 19.3 37.724999999999994 25.7 17.275 6 21.175 22.1 35.925000000000004 20.8 7 20.45 24.175 30.825000000000003 24.55 8 22.325 24.4 28.7 24.575 9 23.175 32.95 26.25 17.625 10-14 23.94 27.48 26.919999999999998 21.66 15-19 23.945 28.665000000000003 27.54 19.85 20-24 23.97 28.825 27.515 19.689999999999998 25-29 23.555 29.09 27.495000000000005 19.86 30-34 23.915 28.37 27.505000000000003 20.21 35-39 23.815 28.860000000000003 27.37 19.955000000000002 40-44 24.005000000000003 28.54 27.54 19.915 45-49 23.62 28.435 27.77 20.175 50-54 23.955000000000002 27.994999999999997 27.915 20.135 55-59 23.400000000000002 28.225 27.794999999999998 20.580000000000002 60-64 24.375 27.595 27.93 20.1 65-69 23.395 27.894999999999996 28.01 20.7 70-74 23.885 28.694999999999997 27.700000000000003 19.72 75-79 23.94 28.53 27.589999999999996 19.939999999999998 80-84 23.549999999999997 28.215 28.310000000000002 19.925 85-89 23.43 28.005000000000003 27.805000000000003 20.76 90-94 23.813334667133496 28.08482969039164 28.28990146551293 19.811934176961937 95-99 23.447548231511252 28.17524115755627 28.406350482315112 19.970860128617364 100-104 23.467326532673468 27.446722553277446 28.421371578628424 20.664579335420665 105-109 23.91016500305561 28.855163984518235 26.95049908331636 20.2841719291098 110-114 24.133497891597244 28.350303404299083 26.9567006068086 20.559498097295073 115-119 24.098274960794562 28.154730789336117 27.537898588604286 20.209095661265028 120-124 23.801397258812862 27.987840648498747 27.6731907631593 20.537571329529094 125-129 24.056578013216097 29.179181912511602 26.51957839549997 20.24466167877232 130-134 22.90848769698645 29.494055847387337 26.845452032070778 20.752004423555434 135-139 23.73790434061377 28.636991982305776 26.61321537185513 21.011888305225323 140-141 23.790434061376832 29.126347802045892 26.26486038153166 20.818357755045618 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.5 22 1.5 23 1.0 24 0.0 25 0.0 26 1.5 27 6.5 28 8.5 29 9.0 30 15.0 31 25.5 32 36.5 33 45.0 34 53.5 35 73.0 36 93.5 37 118.5 38 152.5 39 178.0 40 208.5 41 233.5 42 249.0 43 283.5 44 297.5 45 274.5 46 262.5 47 252.5 48 227.5 49 193.0 50 154.5 51 127.0 52 101.0 53 76.0 54 64.0 55 51.0 56 32.0 57 23.0 58 17.5 59 12.5 60 13.5 61 11.0 62 5.0 63 2.5 64 2.0 65 1.0 66 1.5 67 1.5 68 1.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-141 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 92-93 6.0 94-95 11.0 96-97 4.0 98-99 11.0 100-101 9.0 102-103 7.0 104-105 18.0 106-107 12.0 108-109 15.0 110-111 20.0 112-113 15.0 114-115 33.0 116-117 25.0 118-119 32.0 120-121 34.0 122-123 28.0 124-125 35.0 126-127 45.0 128-129 23.0 130-131 0.0 132-133 0.0 134-135 0.0 136-137 0.0 138-139 0.0 140-141 3617.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.2 #Duplication Level Percentage of deduplicated Percentage of total 1 89.1535874439462 79.525 2 9.725336322869955 17.349999999999998 3 0.9809417040358746 2.625 4 0.14013452914798205 0.5 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAAGTTT 10 0.008747476 133.4875 1 ACTACTC 10 0.008747476 133.4875 4 >>END_MODULE Read 1643523 spots for SRR17200365.sra Written 1643523 spots for SRR17200365.sra Read 1643523 spots for SRR17200365.sra Written 1643523 spots for SRR17200365.sra Read 1643523 spots for SRR17200365.sra Written 1643523 spots for SRR17200365.sra Read 1643523 spots for SRR17200365.sra Written 1643523 spots for SRR17200365.sra Read 1643523 spots for SRR17200365.sra Written 1643523 spots for SRR17200365.sra Read 1643523 spots for SRR17200365.sra Written 1643523 spots for SRR17200365.sra Read 1643523 spots for SRR17200365.sra Written 1643523 spots for SRR17200365.sra Read 1643523 spots for SRR17200365.sra Written 1643523 spots for SRR17200365.sra Read 1643523 spots for SRR17200365.sra Written 1643523 spots for SRR17200365.sra Read 1643523 spots for SRR17200365.sra Written 1643523 spots for SRR17200365.sra Read 1643523 spots for SRR17200365.sra Written 1643523 spots for SRR17200365.sra Read 1643523 spots for SRR17200365.sra Written 1643523 spots for SRR17200365.sra Read 1643523 spots for SRR17200365.sra Written 1643523 spots for SRR17200365.sra Read 1643523 spots for SRR17200365.sra Written 1643523 spots for SRR17200365.sra Read 1643523 spots for SRR17200365.sra Written 1643523 spots for SRR17200365.sra Read 1643523 spots for SRR17200365.sra Written 1643523 spots for SRR17200365.sra Read 1643529 spots for SRR17200365.sra Written 1643529 spots for SRR17200365.sra Read 1643523 spots for SRR17200365.sra Written 1643523 spots for SRR17200365.sra Read 1643523 spots for SRR17200365.sra Written 1643523 spots for SRR17200365.sra Read 1643523 spots for SRR17200365.sra Written 1643523 spots for SRR17200365.sra SRR ids: ['SRR17200365.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_cb_km6jo SRR17200365.sra spots: 32870466 blocks: [[1, 1643523], [1643524, 3287046], [3287047, 4930569], [4930570, 6574092], [6574093, 8217615], [8217616, 9861138], [9861139, 11504661], [11504662, 13148184], [13148185, 14791707], [14791708, 16435230], [16435231, 18078753], [18078754, 19722276], [19722277, 21365799], [21365800, 23009322], [23009323, 24652845], [24652846, 26296368], [26296369, 27939891], [27939892, 29583414], [29583415, 31226937], [31226938, 32870466]] SRR17200365 file size 10339794 SRR17200365 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR17200365 SRR17200365_1.fastq SRR17200365_2.fastq Input file: SRR17200365_1.fastq Paired file: SRR17200365_2.fastq trimmed: SRR17200365-trimmed-pair1.fastq, SRR17200365-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 04:41:51 2025 >> started Wed Feb 12 04:42:24 2025 >> done (33.483s) 32870466 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 0 ( 0.00%) empty read pairs filtered out after trimming by size control 32870466 (100.00%) read pairs available; of these: 108557 ( 0.33%) trimmed read pairs available after processing 32761909 (99.67%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 89 320 0.00% 90 364 0.00% 91 435 0.00% 92 19100 0.06% 93 20936 0.06% 94 23822 0.07% 95 25976 0.08% 96 28074 0.09% 97 31418 0.10% 98 33709 0.10% 99 36555 0.11% 100 41401 0.13% 101 44358 0.13% 102 48793 0.15% 103 53725 0.16% 104 58118 0.18% 105 62585 0.19% 106 67783 0.21% 107 71285 0.22% 108 75437 0.23% 109 80214 0.24% 110 84257 0.26% 111 88593 0.27% 112 96893 0.29% 113 103795 0.32% 114 108028 0.33% 115 115056 0.35% 116 121632 0.37% 117 126265 0.38% 118 131829 0.40% 119 136376 0.41% 120 138420 0.42% 121 145783 0.44% 122 152602 0.46% 123 159388 0.48% 124 165928 0.50% 125 172980 0.53% 126 175473 0.53% 127 182904 0.56% 128 185494 0.56% 129 1688 0.01% 130 1990 0.01% 131 2614 0.01% 132 7399 0.02% 133 10136 0.03% 134 34339 0.10% 135 0 0.00% 136 445 0.00% 137 1047 0.00% 138 4722 0.01% 139 7600 0.02% 140 29011 0.09% 141 29353371 89.30% 32870466 reads passed initial QC criterion=sequence-density sequence-density=0.36 sequence-density-rank=1 fanout-score=2.03 fanout-score-rank=27 prefix-density=0.37 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.06 sequence-density-rank=31 fanout-score=242.46 fanout-score-rank=1 prefix-density=1.23 prefix-fanout=11.6 sequence=TCTTCTTCTTTCTTCCCCAGGAAATCAAACAACCCGCGATCCTTGGTCTCAACAGCACCACTCTCTTCACCAACTTTGGTCTCATACTCATGGCTCTTGTTTTCCTCAGCCATACTGATCAAAATCACAATATGAACCTAAT criterion=sequence-density sequence-density=0.91 sequence-density-rank=1 fanout-score=2.22 fanout-score-rank=22 prefix-density=0.94 prefix-fanout=2.2 sequence=ACAAAGCTGGTA criterion=fanout-score sequence-density=0.25 sequence-density-rank=10 fanout-score=55.00 fanout-score-rank=1 prefix-density=1.25 prefix-fanout=11.0 sequence=AGAAGAAGAAGAGTTACTTTGAGCAAGCCAAGGACATGATACCAGCATATAAGAAAACTGAAGAGGTCCCTCC SRR17200365 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 04:43:05 Started mapping on | Feb 12 04:43:05 Finished on | Feb 12 04:45:02 Mapping speed, Million of reads per hour | 1011.40 Number of input reads | 32870466 Average input read length | 276 UNIQUE READS: Uniquely mapped reads number | 25525526 Uniquely mapped reads % | 77.65% Average mapped length | 278.68 Number of splices: Total | 24426353 Number of splices: Annotated (sjdb) | 23857743 Number of splices: GT/AG | 24032517 Number of splices: GC/AG | 331689 Number of splices: AT/AC | 13319 Number of splices: Non-canonical | 48828 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.02% Deletion average length | 2.18 Insertion rate per base | 0.01% Insertion average length | 2.17 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 532450 % of reads mapped to multiple loci | 1.62% Number of reads mapped to too many loci | 192873 % of reads mapped to too many loci | 0.59% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 20.06% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 6812490 6812490 6812490 N_multimapping 532450 532450 532450 N_noFeature 867907 25304753 939523 N_ambiguous 439739 2378 289250 UnstrandedReadsAssigned:24217880 PositiveStrandReadsAssigned:218395 NegativeStrandReadsAssigned:24296753 Dataset is classified negative stranded MeadianReadLen=141 20thPercentileLength=141 echo kmer=137 SRR17200365 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR17200365-trimmed-pair1.fastq SRR17200365-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 32,870,466 reads, 29,968,275 reads pseudoaligned [quant] estimated average fragment length: 179.79 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,167 rounds 52401 SRR17200365.ke.tsv 34699 SRR17200365.se.tsv 87100 total ==> SRR17200365.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1839.21 1163 22.9975 Potri.005G024800.1.v4.1 1035 856.21 1000 42.4768 Potri.004G059700.1.v4.1 961 782.21 19 0.883411 Potri.007G009000.2.v4.1 1416 1237.21 0 0 Potri.003G141000.2.v4.1 2943 2764.21 1708.49 22.4789 Potri.016G087400.1.v4.1 270 102.767 2313 818.566 Potri.015G069301.1.v4.1 564 385.327 0 0 Potri.010G195200.1.v4.1 1773 1594.21 133 3.03416 Potri.012G127500.1.v4.1 977 798.21 13055 594.829 ==> SRR17200365.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 119 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 380 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 375 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 6 SRR17200365 completed mapping pipeline successfully