Starting /dee2/code/volunteer_pipeline.sh SRR17200366 current disk space = 3048893403136 free memory = 1581205552 SRR17200366 SRAfilesize 0299393afb9d4cb07be6be6057174030 SRR17200366.sra SRR17200366.sra file validated SRR17200366 is paired end SRR17200366 is conventional basespace SRR17200366 read1 length is 92-141 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR17200366_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 92-141 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.345 37.0 37.0 37.0 37.0 37.0 2 36.605 37.0 37.0 37.0 37.0 37.0 3 36.3885 37.0 37.0 37.0 37.0 37.0 4 36.669 37.0 37.0 37.0 37.0 37.0 5 36.2855 37.0 37.0 37.0 37.0 37.0 6 36.4335 37.0 37.0 37.0 37.0 37.0 7 35.7515 37.0 37.0 37.0 37.0 37.0 8 36.518 37.0 37.0 37.0 37.0 37.0 9 36.437 37.0 37.0 37.0 37.0 37.0 10-14 36.471000000000004 37.0 37.0 37.0 37.0 37.0 15-19 36.46810000000001 37.0 37.0 37.0 37.0 37.0 20-24 36.443900000000006 37.0 37.0 37.0 37.0 37.0 25-29 36.325599999999994 37.0 37.0 37.0 37.0 37.0 30-34 36.303999999999995 37.0 37.0 37.0 37.0 37.0 35-39 36.412600000000005 37.0 37.0 37.0 37.0 37.0 40-44 36.4156 37.0 37.0 37.0 37.0 37.0 45-49 36.3313 37.0 37.0 37.0 37.0 37.0 50-54 36.3587 37.0 37.0 37.0 37.0 37.0 55-59 36.373400000000004 37.0 37.0 37.0 37.0 37.0 60-64 36.2754 37.0 37.0 37.0 37.0 37.0 65-69 36.300200000000004 37.0 37.0 37.0 37.0 37.0 70-74 36.0156 37.0 37.0 37.0 37.0 37.0 75-79 35.9844 37.0 37.0 37.0 37.0 37.0 80-84 36.311600000000006 37.0 37.0 37.0 37.0 37.0 85-89 36.2918 37.0 37.0 37.0 37.0 37.0 90-94 35.89763305212586 37.0 37.0 37.0 37.0 37.0 95-99 36.270078349413055 37.0 37.0 37.0 37.0 37.0 100-104 36.17015784058837 37.0 37.0 37.0 37.0 37.0 105-109 36.098547710915796 37.0 37.0 37.0 37.0 37.0 110-114 36.13676728431618 37.0 37.0 37.0 37.0 37.0 115-119 35.97415421306791 37.0 37.0 37.0 37.0 37.0 120-124 36.143523922608054 37.0 37.0 37.0 37.0 37.0 125-129 36.09346879006664 37.0 37.0 37.0 37.0 37.0 130-134 35.91063829787234 37.0 37.0 37.0 37.0 37.0 135-139 36.132029902242664 37.0 37.0 37.0 37.0 37.0 140-141 35.73548016101208 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 0.0 22 1.0 23 0.0 24 1.0 25 0.0 26 5.0 27 5.0 28 7.0 29 17.0 30 24.0 31 30.0 32 48.0 33 86.0 34 114.0 35 392.0 36 2905.0 37 364.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 18.875 13.200000000000001 40.1 27.825 2 19.45 16.725 25.074999999999996 38.75 3 23.875 25.074999999999996 21.925 29.125 4 22.3 28.925 25.35 23.425 5 17.474999999999998 32.4 28.575 21.55 6 13.600000000000001 26.650000000000002 41.075 18.675 7 15.325 23.35 36.7 24.625 8 17.525 22.400000000000002 35.875 24.2 9 18.775 35.875 25.874999999999996 19.475 10-14 20.755000000000003 28.01 27.405 23.830000000000002 15-19 19.46 28.560000000000002 28.665000000000003 23.315 20-24 20.31 27.87 28.215 23.605 25-29 19.86 28.395 28.105000000000004 23.64 30-34 20.165 28.615000000000002 27.63 23.59 35-39 19.985 28.475 27.245 24.295 40-44 19.64 28.03 28.26 24.07 45-49 20.145 28.1 27.694999999999997 24.060000000000002 50-54 20.34 28.185 27.495000000000005 23.98 55-59 19.925 27.71 28.205000000000002 24.16 60-64 19.81 28.43 27.584999999999997 24.175 65-69 20.41 27.315 28.59 23.685000000000002 70-74 20.115 28.535 27.445000000000004 23.905 75-79 19.665 28.4 27.744999999999997 24.19 80-84 20.29 27.27 28.325 24.115000000000002 85-89 20.3 28.055000000000003 27.589999999999996 24.055 90-94 20.35916162273023 28.452803761692763 27.622430093542093 23.565604522034917 95-99 21.27114815000753 27.355790953361115 27.571665244239167 23.801395652392188 100-104 20.13453368399757 27.432733158001216 29.40016184503338 23.032571312967836 105-109 20.577543392555427 27.940197634529724 27.84803645486662 23.634222518048233 110-114 19.6081496534834 28.190297535303007 28.29451305299359 23.90703975822 115-119 20.161762358324907 28.29244931623477 27.526206566274674 24.019581759165646 120-124 20.03717675359466 28.232464053359575 27.642009731561973 24.08834946148379 125-129 20.470747991399797 27.803553242050473 27.656444494738032 24.0692542718117 130-134 19.902242668200117 28.326624496837262 28.562392179413454 23.208740655549164 135-139 20.5232892466935 27.964347326049456 27.665324899367455 23.84703852788959 140-141 20.45715928694652 28.047728579643472 28.076480736055203 23.4186313973548 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 0.5 22 1.0 23 2.5 24 1.5 25 2.5 26 5.5 27 8.0 28 9.5 29 12.0 30 21.5 31 34.0 32 34.5 33 46.5 34 71.5 35 85.0 36 105.0 37 123.0 38 134.0 39 150.5 40 189.0 41 226.0 42 240.5 43 234.0 44 237.5 45 263.0 46 255.5 47 244.5 48 231.0 49 196.5 50 163.0 51 133.0 52 104.0 53 94.5 54 91.5 55 65.0 56 47.0 57 34.5 58 20.5 59 21.0 60 20.5 61 11.5 62 6.5 63 4.5 64 4.5 65 4.0 66 1.5 67 1.0 68 1.5 69 1.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.5 75 1.0 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-141 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 92-93 7.0 94-95 7.0 96-97 5.0 98-99 11.0 100-101 15.0 102-103 18.0 104-105 20.0 106-107 24.0 108-109 30.0 110-111 24.0 112-113 25.0 114-115 39.0 116-117 31.0 118-119 38.0 120-121 48.0 122-123 46.0 124-125 45.0 126-127 55.0 128-129 34.0 130-131 0.0 132-133 0.0 134-135 0.0 136-137 0.0 138-139 0.0 140-141 3478.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 87.5 #Duplication Level Percentage of deduplicated Percentage of total 1 87.65714285714286 76.7 2 10.8 18.9 3 1.2285714285714284 3.225 4 0.2857142857142857 1.0 5 0.0 0.0 6 0.0 0.0 7 0.028571428571428574 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTCCATTCAGCTAATTCATTTGTTCATGCCAGTTGCCTTCTTAATTCCTT 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR17200366 read2 length is 92-141 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR17200366_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 92-141 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.235 37.0 37.0 37.0 37.0 37.0 2 36.493 37.0 37.0 37.0 37.0 37.0 3 36.4895 37.0 37.0 37.0 37.0 37.0 4 36.3445 37.0 37.0 37.0 37.0 37.0 5 36.3835 37.0 37.0 37.0 37.0 37.0 6 36.322 37.0 37.0 37.0 37.0 37.0 7 36.324 37.0 37.0 37.0 37.0 37.0 8 36.265 37.0 37.0 37.0 37.0 37.0 9 35.815 37.0 37.0 37.0 37.0 37.0 10-14 36.3948 37.0 37.0 37.0 37.0 37.0 15-19 36.1874 37.0 37.0 37.0 37.0 37.0 20-24 36.037699999999994 37.0 37.0 37.0 34.6 37.0 25-29 36.1665 37.0 37.0 37.0 37.0 37.0 30-34 36.2343 37.0 37.0 37.0 37.0 37.0 35-39 36.293099999999995 37.0 37.0 37.0 37.0 37.0 40-44 36.0887 37.0 37.0 37.0 37.0 37.0 45-49 36.16029999999999 37.0 37.0 37.0 37.0 37.0 50-54 36.2819 37.0 37.0 37.0 37.0 37.0 55-59 35.98870000000001 37.0 37.0 37.0 34.6 37.0 60-64 36.3409 37.0 37.0 37.0 37.0 37.0 65-69 35.972300000000004 37.0 37.0 37.0 37.0 37.0 70-74 35.9816 37.0 37.0 37.0 37.0 37.0 75-79 35.648399999999995 37.0 37.0 37.0 34.6 37.0 80-84 36.0399 37.0 37.0 37.0 34.6 37.0 85-89 36.0364 37.0 37.0 37.0 37.0 37.0 90-94 35.87351001608994 37.0 37.0 37.0 37.0 37.0 95-99 35.67358377216512 37.0 37.0 37.0 34.6 37.0 100-104 36.04044113773415 37.0 37.0 37.0 37.0 37.0 105-109 35.67821953927258 37.0 37.0 37.0 34.6 37.0 110-114 35.73090540620837 37.0 37.0 37.0 37.0 37.0 115-119 36.00951369205314 37.0 37.0 37.0 37.0 37.0 120-124 35.95934962610389 37.0 37.0 37.0 37.0 37.0 125-129 35.612505780091674 37.0 37.0 37.0 34.6 37.0 130-134 35.64342824273799 37.0 37.0 37.0 37.0 37.0 135-139 35.8468219729652 37.0 37.0 37.0 37.0 37.0 140-141 35.49525452976704 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 1.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 1.0 24 3.0 25 3.0 26 4.0 27 7.0 28 6.0 29 7.0 30 28.0 31 32.0 32 47.0 33 106.0 34 202.0 35 663.0 36 2699.0 37 190.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 21.85 28.475 32.475 17.2 2 21.25 28.725 30.375000000000004 19.650000000000002 3 24.8 36.025 20.925 18.25 4 23.125 39.550000000000004 21.5 15.825 5 20.65 36.725 25.575 17.05 6 20.9 23.150000000000002 35.25 20.7 7 20.3 24.0 30.825000000000003 24.875 8 22.8 25.650000000000002 28.9 22.650000000000002 9 25.525 34.075 22.900000000000002 17.5 10-14 25.019999999999996 27.425 27.015 20.54 15-19 23.86 29.225 26.935 19.98 20-24 23.36 28.499999999999996 28.24 19.900000000000002 25-29 22.95 28.749999999999996 27.93 20.369999999999997 30-34 24.32 28.720000000000002 27.12 19.84 35-39 23.830000000000002 28.835 27.77 19.564999999999998 40-44 22.895 28.360000000000003 27.744999999999997 21.0 45-49 23.494999999999997 29.38 26.58 20.544999999999998 50-54 23.765 28.975 27.589999999999996 19.67 55-59 23.64 27.88 28.275 20.205000000000002 60-64 23.735 28.384999999999998 27.735 20.145 65-69 23.235 28.299999999999997 27.98 20.485 70-74 24.075 27.68 27.644999999999996 20.599999999999998 75-79 23.7 27.855 28.02 20.424999999999997 80-84 24.03 28.13 27.725 20.115 85-89 24.169999999999998 27.805000000000003 27.785 20.24 90-94 23.640638287229255 28.26271822320044 27.622430093542093 20.47421339602821 95-99 24.00843458178532 28.060046189376443 27.74374937242695 20.187769856411286 100-104 23.58089648892037 28.38207022159263 27.850855003541437 20.186178285945562 105-109 23.41101152368758 28.27656850192061 28.16389244558259 20.14852752880922 110-114 23.29424029189471 28.48579619494397 28.00104248110503 20.218921032056294 115-119 24.052385008517888 28.737223168654175 26.6982538330494 20.512137989778534 120-124 23.97833579517479 28.64489304666557 26.566004704852563 20.81076645330707 125-129 24.318053197509904 28.041878890775322 26.808149405772497 20.831918505942276 130-134 22.991084268047167 29.04227782571182 26.902502157031925 21.064135749209086 135-139 23.986194995685935 29.301121656600515 25.752085130859935 20.96059821685361 140-141 24.158757549611735 28.18521714121369 27.538107563991947 20.117917745182627 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 1.5 20 0.5 21 0.0 22 1.0 23 2.5 24 3.0 25 2.5 26 3.5 27 10.0 28 12.5 29 10.5 30 16.5 31 22.5 32 31.5 33 43.0 34 60.0 35 89.0 36 109.5 37 119.0 38 141.5 39 178.5 40 198.5 41 223.5 42 254.0 43 248.5 44 254.0 45 287.0 46 270.0 47 247.0 48 223.5 49 181.5 50 158.0 51 131.0 52 111.0 53 91.0 54 69.5 55 51.5 56 40.0 57 26.0 58 13.5 59 9.0 60 7.0 61 9.0 62 8.0 63 6.0 64 3.0 65 2.0 66 3.0 67 2.5 68 1.0 69 0.0 70 2.0 71 3.0 72 1.5 73 1.5 74 1.5 75 0.5 76 0.0 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-141 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 92-93 7.0 94-95 7.0 96-97 5.0 98-99 12.0 100-101 15.0 102-103 19.0 104-105 19.0 106-107 24.0 108-109 30.0 110-111 24.0 112-113 26.0 114-115 39.0 116-117 30.0 118-119 40.0 120-121 47.0 122-123 46.0 124-125 44.0 126-127 54.0 128-129 35.0 130-131 0.0 132-133 0.0 134-135 0.0 136-137 0.0 138-139 0.0 140-141 3477.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 87.925 #Duplication Level Percentage of deduplicated Percentage of total 1 87.97270400909866 77.35 2 10.662496445834519 18.75 3 1.0520329826556725 2.775 4 0.2843332385555872 1.0 5 0.028433323855558714 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TTTGGACATTTGATGCTAATGACTGGCTATTTTGGTTGTTAATTTTTTGT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.025 0.0 34-35 0.0 0.0 0.0 0.025 0.0 36-37 0.0 0.0 0.0 0.025 0.0 38-39 0.0 0.0 0.0 0.025 0.0 40-41 0.0 0.0 0.0 0.025 0.0 42-43 0.0 0.0 0.0 0.025 0.0 44-45 0.0 0.0 0.0 0.025 0.0 46-47 0.0 0.0 0.0 0.025 0.0 48-49 0.0 0.0 0.0 0.025 0.0 50-51 0.0 0.0 0.0 0.025 0.0 52-53 0.0 0.0 0.0 0.025 0.0 54-55 0.0 0.0 0.0 0.025 0.0 56-57 0.0 0.0 0.0 0.025 0.0 58-59 0.0 0.0 0.0 0.025 0.0 60-61 0.0 0.0 0.0 0.025 0.0 62-63 0.0 0.0 0.0 0.025 0.0 64-65 0.0 0.0 0.0 0.025 0.0 66-67 0.0 0.0 0.0 0.025 0.0 68-69 0.0 0.0 0.0 0.025 0.0 70-71 0.0 0.0 0.0 0.025 0.0 72-73 0.0 0.0 0.0 0.025 0.0 74-75 0.0 0.0 0.0 0.025 0.0 76-77 0.0 0.0 0.0 0.025 0.0 78-79 0.0 0.0 0.0 0.025 0.0 80-81 0.0 0.0 0.0 0.025 0.0 82-83 0.0 0.0 0.0 0.025 0.0 84-85 0.0 0.0 0.0 0.025 0.0 86-87 0.0 0.0 0.0 0.025 0.0 88-89 0.0 0.0 0.0 0.025 0.0 90-91 0.0 0.0 0.0 0.025 0.0 92-93 0.0 0.0 0.0 0.025 0.0 94-95 0.0 0.0 0.0 0.025 0.0 96-97 0.0 0.0 0.0 0.025 0.0 98-99 0.0 0.0 0.0 0.025 0.0 100-101 0.0 0.0 0.0 0.025 0.0 102-103 0.0 0.0 0.0 0.025 0.0 104-105 0.0 0.0 0.0 0.025 0.0 106-107 0.0 0.0 0.0 0.025 0.0 108-109 0.0 0.0 0.0 0.025 0.0 110-111 0.0 0.0 0.0 0.025 0.0 112-113 0.0 0.0 0.0 0.025 0.0 114-115 0.0 0.0 0.0 0.025 0.0 116-117 0.0 0.0 0.0 0.025 0.0 118-119 0.0 0.0 0.0 0.025 0.0 120-121 0.0 0.0 0.0 0.025 0.0 122-123 0.0 0.0 0.0 0.025 0.0 124-125 0.0 0.0 0.0 0.025 0.0 126-127 0.0 0.0 0.0 0.025 0.0 128-129 0.0 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCAATGC 10 0.009019888 132.125 2 >>END_MODULE Read 1652295 spots for SRR17200366.sra Written 1652295 spots for SRR17200366.sra Read 1652295 spots for SRR17200366.sra Written 1652295 spots for SRR17200366.sra Read 1652295 spots for SRR17200366.sra Written 1652295 spots for SRR17200366.sra Read 1652302 spots for SRR17200366.sra Written 1652302 spots for SRR17200366.sra Read 1652295 spots for SRR17200366.sra Written 1652295 spots for SRR17200366.sra Read 1652295 spots for SRR17200366.sra Written 1652295 spots for SRR17200366.sra Read 1652295 spots for SRR17200366.sra Written 1652295 spots for SRR17200366.sra Read 1652295 spots for SRR17200366.sra Written 1652295 spots for SRR17200366.sra Read 1652295 spots for SRR17200366.sra Written 1652295 spots for SRR17200366.sra Read 1652295 spots for SRR17200366.sra Written 1652295 spots for SRR17200366.sra Read 1652295 spots for SRR17200366.sra Written 1652295 spots for SRR17200366.sra Read 1652295 spots for SRR17200366.sra Written 1652295 spots for SRR17200366.sra Read 1652295 spots for SRR17200366.sra Written 1652295 spots for SRR17200366.sra Read 1652295 spots for SRR17200366.sra Written 1652295 spots for SRR17200366.sra Read 1652295 spots for SRR17200366.sra Written 1652295 spots for SRR17200366.sra Read 1652295 spots for SRR17200366.sra Written 1652295 spots for SRR17200366.sra Read 1652295 spots for SRR17200366.sra Written 1652295 spots for SRR17200366.sra Read 1652295 spots for SRR17200366.sra Written 1652295 spots for SRR17200366.sra Read 1652295 spots for SRR17200366.sra Written 1652295 spots for SRR17200366.sra Read 1652295 spots for SRR17200366.sra Written 1652295 spots for SRR17200366.sra SRR ids: ['SRR17200366.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_359zvayp SRR17200366.sra spots: 33045907 blocks: [[1, 1652295], [1652296, 3304590], [3304591, 4956885], [4956886, 6609180], [6609181, 8261475], [8261476, 9913770], [9913771, 11566065], [11566066, 13218360], [13218361, 14870655], [14870656, 16522950], [16522951, 18175245], [18175246, 19827540], [19827541, 21479835], [21479836, 23132130], [23132131, 24784425], [24784426, 26436720], [26436721, 28089015], [28089016, 29741310], [29741311, 31393605], [31393606, 33045907]] SRR17200366 file size 10357156 SRR17200366 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR17200366 SRR17200366_1.fastq SRR17200366_2.fastq Input file: SRR17200366_1.fastq Paired file: SRR17200366_2.fastq trimmed: SRR17200366-trimmed-pair1.fastq, SRR17200366-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 05:30:37 2025 >> started Wed Feb 12 05:31:12 2025 >> done (35.288s) 33045907 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 0 ( 0.00%) empty read pairs filtered out after trimming by size control 33045907 (100.00%) read pairs available; of these: 135643 ( 0.41%) trimmed read pairs available after processing 32910264 (99.59%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 89 475 0.00% 90 607 0.00% 91 611 0.00% 92 24668 0.07% 93 27756 0.08% 94 31543 0.10% 95 34313 0.10% 96 37873 0.11% 97 41515 0.13% 98 43979 0.13% 99 47608 0.14% 100 53212 0.16% 101 57920 0.18% 102 62296 0.19% 103 68808 0.21% 104 74366 0.23% 105 79639 0.24% 106 85321 0.26% 107 90465 0.27% 108 94584 0.29% 109 101419 0.31% 110 105984 0.32% 111 110392 0.33% 112 119999 0.36% 113 126902 0.38% 114 133745 0.40% 115 142587 0.43% 116 147724 0.45% 117 152488 0.46% 118 158940 0.48% 119 162827 0.49% 120 164895 0.50% 121 175271 0.53% 122 180323 0.55% 123 188768 0.57% 124 194497 0.59% 125 201014 0.61% 126 201493 0.61% 127 209299 0.63% 128 211957 0.64% 129 1973 0.01% 130 2055 0.01% 131 2836 0.01% 132 8176 0.02% 133 11622 0.04% 134 35038 0.11% 135 0 0.00% 136 505 0.00% 137 1361 0.00% 138 5555 0.02% 139 9070 0.03% 140 33191 0.10% 141 28786442 87.11% 33045907 reads passed initial QC criterion=sequence-density sequence-density=0.43 sequence-density-rank=1 fanout-score=2.11 fanout-score-rank=20 prefix-density=0.44 prefix-fanout=2.0 sequence=CTTGGCCCTTGG criterion=fanout-score sequence-density=0.06 sequence-density-rank=27 fanout-score=121.64 fanout-score-rank=1 prefix-density=0.43 prefix-fanout=18.4 sequence=TTCTCTTCTTCAGTCTTGGGGTGGTACCCAGGTAACTTCTCCTTGATCTTCTC criterion=sequence-density sequence-density=1.01 sequence-density-rank=1 fanout-score=2.24 fanout-score-rank=21 prefix-density=1.04 prefix-fanout=2.2 sequence=ACAAAGCTGGTA criterion=fanout-score sequence-density=0.21 sequence-density-rank=13 fanout-score=68.20 fanout-score-rank=1 prefix-density=1.15 prefix-fanout=12.5 sequence=AGAAGAAGAAGAGTTACTTTGAGCAAGCCAAGGACATGATACCAGCATATAAGAAAACTGAAGAGGTCCCTCC SRR17200366 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 05:31:53 Started mapping on | Feb 12 05:31:53 Finished on | Feb 12 05:34:04 Mapping speed, Million of reads per hour | 908.13 Number of input reads | 33045907 Average input read length | 275 UNIQUE READS: Uniquely mapped reads number | 24925685 Uniquely mapped reads % | 75.43% Average mapped length | 278.20 Number of splices: Total | 23914977 Number of splices: Annotated (sjdb) | 23380488 Number of splices: GT/AG | 23525367 Number of splices: GC/AG | 328094 Number of splices: AT/AC | 12988 Number of splices: Non-canonical | 48528 Mismatch rate per base, % | 0.22% Deletion rate per base | 0.02% Deletion average length | 2.12 Insertion rate per base | 0.01% Insertion average length | 2.22 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 535837 % of reads mapped to multiple loci | 1.62% Number of reads mapped to too many loci | 292210 % of reads mapped to too many loci | 0.88% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 21.96% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 7584385 7584385 7584385 N_multimapping 535837 535837 535837 N_noFeature 847164 24702760 912905 N_ambiguous 474662 2219 316356 UnstrandedReadsAssigned:23603859 PositiveStrandReadsAssigned:220706 NegativeStrandReadsAssigned:23696424 Dataset is classified negative stranded MeadianReadLen=141 20thPercentileLength=141 echo kmer=137 SRR17200366 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR17200366-trimmed-pair1.fastq SRR17200366-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 33,045,907 reads, 30,267,092 reads pseudoaligned [quant] estimated average fragment length: 175.298 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,248 rounds 52401 SRR17200366.ke.tsv 34699 SRR17200366.se.tsv 87100 total ==> SRR17200366.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1843.7 1182 22.961 Potri.005G024800.1.v4.1 1035 860.702 925 38.4905 Potri.004G059700.1.v4.1 961 786.707 30 1.36575 Potri.007G009000.2.v4.1 1416 1241.7 0 0 Potri.003G141000.2.v4.1 2943 2768.7 1823.85 23.5927 Potri.016G087400.1.v4.1 270 105.965 2016 681.388 Potri.015G069301.1.v4.1 564 389.789 0 0 Potri.010G195200.1.v4.1 1773 1598.7 85 1.90422 Potri.012G127500.1.v4.1 977 802.707 9034 403.077 ==> SRR17200366.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 313 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 354 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 116 Potri.001G416900.v4.1 11 Potri.001G452600.v4.1 10 SRR17200366 completed mapping pipeline successfully