Starting /dee2/code/volunteer_pipeline.sh SRR17200367 current disk space = 3048997330944 free memory = 1301787704 SRR17200367 SRAfilesize 4a7e92faa6b8cae8855e3baf1481c3f5 SRR17200367.sra SRR17200367.sra file validated SRR17200367 is paired end SRR17200367 is conventional basespace SRR17200367 read1 length is 92-141 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR17200367_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 92-141 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3475 37.0 37.0 37.0 37.0 37.0 2 36.584 37.0 37.0 37.0 37.0 37.0 3 36.393 37.0 37.0 37.0 37.0 37.0 4 36.615 37.0 37.0 37.0 37.0 37.0 5 36.3085 37.0 37.0 37.0 37.0 37.0 6 36.413 37.0 37.0 37.0 37.0 37.0 7 35.7885 37.0 37.0 37.0 37.0 37.0 8 36.504 37.0 37.0 37.0 37.0 37.0 9 36.502 37.0 37.0 37.0 37.0 37.0 10-14 36.433800000000005 37.0 37.0 37.0 37.0 37.0 15-19 36.406600000000005 37.0 37.0 37.0 37.0 37.0 20-24 36.369899999999994 37.0 37.0 37.0 37.0 37.0 25-29 36.307100000000005 37.0 37.0 37.0 37.0 37.0 30-34 36.245799999999996 37.0 37.0 37.0 37.0 37.0 35-39 36.3907 37.0 37.0 37.0 37.0 37.0 40-44 36.41 37.0 37.0 37.0 37.0 37.0 45-49 36.3328 37.0 37.0 37.0 37.0 37.0 50-54 36.299400000000006 37.0 37.0 37.0 37.0 37.0 55-59 36.3186 37.0 37.0 37.0 37.0 37.0 60-64 36.3066 37.0 37.0 37.0 37.0 37.0 65-69 36.2855 37.0 37.0 37.0 37.0 37.0 70-74 35.9905 37.0 37.0 37.0 37.0 37.0 75-79 35.8989 37.0 37.0 37.0 37.0 37.0 80-84 36.330499999999994 37.0 37.0 37.0 37.0 37.0 85-89 36.2596 37.0 37.0 37.0 37.0 37.0 90-94 35.837584845247164 37.0 37.0 37.0 34.6 37.0 95-99 36.238557676846746 37.0 37.0 37.0 37.0 37.0 100-104 36.176277616626535 37.0 37.0 37.0 37.0 37.0 105-109 36.148393020888726 37.0 37.0 37.0 37.0 37.0 110-114 36.08032816592424 37.0 37.0 37.0 37.0 37.0 115-119 35.93278888496932 37.0 37.0 37.0 37.0 37.0 120-124 36.135581659035566 37.0 37.0 37.0 37.0 37.0 125-129 36.05480579122419 37.0 37.0 37.0 37.0 37.0 130-134 35.881454545454545 37.0 37.0 37.0 37.0 37.0 135-139 35.98092307692308 37.0 37.0 37.0 37.0 37.0 140-141 35.84951048951049 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 3.0 24 0.0 25 2.0 26 2.0 27 11.0 28 7.0 29 18.0 30 27.0 31 41.0 32 43.0 33 73.0 34 140.0 35 380.0 36 2902.0 37 351.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 18.6 11.5 42.95 26.950000000000003 2 19.3 15.675 26.200000000000003 38.824999999999996 3 22.775000000000002 24.325 23.425 29.475 4 22.0 29.75 27.05 21.2 5 17.299999999999997 31.25 29.5 21.95 6 13.65 27.125 40.699999999999996 18.525 7 14.799999999999999 23.05 37.75 24.4 8 18.0 21.125 35.55 25.324999999999996 9 18.6 35.25 27.224999999999998 18.925 10-14 19.919999999999998 27.82 27.644999999999996 24.615000000000002 15-19 19.68 28.255000000000003 28.49 23.575 20-24 19.900000000000002 28.315 27.775 24.01 25-29 19.595000000000002 28.38 28.384999999999998 23.64 30-34 20.544999999999998 28.37 27.810000000000002 23.275000000000002 35-39 19.869999999999997 28.275 27.515 24.34 40-44 20.465 27.565 28.345 23.625 45-49 20.645 27.875 27.58 23.9 50-54 20.06 28.425 27.725 23.79 55-59 19.935 28.015 28.465 23.585 60-64 20.555 28.165000000000003 27.595 23.685000000000002 65-69 20.26 27.095000000000002 28.265 24.38 70-74 20.43 27.67 27.884999999999998 24.015 75-79 20.43 27.68 27.97 23.919999999999998 80-84 20.36 27.615000000000002 27.82 24.205 85-89 19.885 27.950000000000003 27.975 24.19 90-94 20.001000550302667 27.835309420181098 28.315573565461005 23.84811646405523 95-99 19.45533112250025 28.369008139885437 27.65551200884333 24.520148728770977 100-104 19.786394006883985 28.381251265438344 28.133225349260982 23.699129378416682 105-109 20.11764705882353 27.375959079283884 27.913043478260867 24.593350383631712 110-114 19.977239809642043 28.289882060831783 27.80364163045727 23.9292364990689 115-119 20.622119815668203 27.754503560955175 28.24151654796816 23.38186007540846 120-124 20.302884358109914 28.180018194466744 27.77866966340237 23.738427784020978 125-129 19.772639479057446 27.481927045968767 28.38695436234203 24.358479112631752 130-134 19.77062937062937 27.994405594405595 28.06153846153846 24.173426573426575 135-139 20.665734265734265 27.78181818181818 28.335664335664333 23.216783216783217 140-141 20.20979020979021 27.720279720279724 26.99300699300699 25.076923076923073 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 2.0 23 1.5 24 1.0 25 2.0 26 5.5 27 9.5 28 14.0 29 16.5 30 20.5 31 24.5 32 26.0 33 39.5 34 65.0 35 78.5 36 89.0 37 117.0 38 144.5 39 169.0 40 195.0 41 216.5 42 248.0 43 270.5 44 277.0 45 261.5 46 248.5 47 236.5 48 209.5 49 192.0 50 175.0 51 135.5 52 101.0 53 97.5 54 81.0 55 59.0 56 42.0 57 28.0 58 19.5 59 16.0 60 16.0 61 12.5 62 8.0 63 6.5 64 4.5 65 2.0 66 2.0 67 2.0 68 1.5 69 1.0 70 0.5 71 0.5 72 0.0 73 2.0 74 2.0 75 0.5 76 0.5 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-141 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 92-93 8.0 94-95 4.0 96-97 16.0 98-99 8.0 100-101 10.0 102-103 19.0 104-105 18.0 106-107 13.0 108-109 22.0 110-111 14.0 112-113 20.0 114-115 12.0 116-117 27.0 118-119 41.0 120-121 28.0 122-123 45.0 124-125 49.0 126-127 42.0 128-129 29.0 130-131 0.0 132-133 0.0 134-135 0.0 136-137 0.0 138-139 0.0 140-141 3575.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 88.375 #Duplication Level Percentage of deduplicated Percentage of total 1 88.17538896746817 77.925 2 10.551626591230551 18.65 3 1.2164073550212162 3.225 4 0.056577086280056574 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR17200367 read2 length is 92-141 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR17200367_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 92-141 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.293 37.0 37.0 37.0 37.0 37.0 2 36.3505 37.0 37.0 37.0 37.0 37.0 3 36.5385 37.0 37.0 37.0 37.0 37.0 4 36.1545 37.0 37.0 37.0 37.0 37.0 5 36.263 37.0 37.0 37.0 37.0 37.0 6 36.354 37.0 37.0 37.0 37.0 37.0 7 36.2895 37.0 37.0 37.0 37.0 37.0 8 36.211 37.0 37.0 37.0 37.0 37.0 9 36.0215 37.0 37.0 37.0 37.0 37.0 10-14 36.3788 37.0 37.0 37.0 37.0 37.0 15-19 36.1783 37.0 37.0 37.0 37.0 37.0 20-24 36.147299999999994 37.0 37.0 37.0 37.0 37.0 25-29 36.1368 37.0 37.0 37.0 37.0 37.0 30-34 36.238 37.0 37.0 37.0 37.0 37.0 35-39 36.29 37.0 37.0 37.0 37.0 37.0 40-44 36.001999999999995 37.0 37.0 37.0 37.0 37.0 45-49 36.158100000000005 37.0 37.0 37.0 37.0 37.0 50-54 36.2606 37.0 37.0 37.0 37.0 37.0 55-59 35.9713 37.0 37.0 37.0 34.6 37.0 60-64 36.28060000000001 37.0 37.0 37.0 37.0 37.0 65-69 35.9097 37.0 37.0 37.0 37.0 37.0 70-74 35.935 37.0 37.0 37.0 37.0 37.0 75-79 35.583 37.0 37.0 37.0 34.6 37.0 80-84 35.9894 37.0 37.0 37.0 34.6 37.0 85-89 35.9593 37.0 37.0 37.0 37.0 37.0 90-94 35.92539396426077 37.0 37.0 37.0 34.6 37.0 95-99 35.708943102252206 37.0 37.0 37.0 34.6 37.0 100-104 35.993299522050066 37.0 37.0 37.0 37.0 37.0 105-109 35.71450306934522 37.0 37.0 37.0 34.6 37.0 110-114 35.69537605519572 37.0 37.0 37.0 34.6 37.0 115-119 36.0089094078813 37.0 37.0 37.0 37.0 37.0 120-124 35.90906989401585 37.0 37.0 37.0 37.0 37.0 125-129 35.565482649773834 37.0 37.0 37.0 34.6 37.0 130-134 35.584348798211295 37.0 37.0 37.0 34.6 37.0 135-139 35.84158747903857 37.0 37.0 37.0 37.0 37.0 140-141 35.61794298490777 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 3.0 24 4.0 25 4.0 26 4.0 27 9.0 28 13.0 29 16.0 30 20.0 31 35.0 32 57.0 33 99.0 34 165.0 35 680.0 36 2686.0 37 205.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 23.7 27.400000000000002 31.974999999999998 16.925 2 20.125 27.700000000000003 32.125 20.05 3 26.85 34.025 21.175 17.95 4 25.4 37.175000000000004 22.075 15.35 5 19.725 37.4 26.1 16.775000000000002 6 21.425 21.65 37.075 19.85 7 19.875 24.55 29.375 26.200000000000003 8 23.375 25.900000000000002 28.675 22.05 9 24.15 33.7 22.95 19.2 10-14 24.14 27.51 26.8 21.55 15-19 24.005000000000003 29.23 27.089999999999996 19.675 20-24 23.755000000000003 28.655 26.935 20.655 25-29 23.105 28.87 28.215 19.81 30-34 24.21 28.725 27.015 20.05 35-39 23.66 28.804999999999996 27.334999999999997 20.200000000000003 40-44 24.2 28.595 27.384999999999998 19.82 45-49 24.0 28.199999999999996 27.975 19.825 50-54 23.23 28.660000000000004 27.51 20.599999999999998 55-59 23.875 27.82 27.92 20.385 60-64 23.755000000000003 28.134999999999998 27.250000000000004 20.86 65-69 24.19 27.97 27.62 20.22 70-74 23.705000000000002 28.22 28.084999999999997 19.99 75-79 23.555 28.03 27.675 20.74 80-84 24.3 27.29 28.384999999999998 20.025000000000002 85-89 23.835 27.900000000000002 27.76 20.505000000000003 90-94 23.92816048826855 29.131022062134175 26.79473710540797 20.146080344189304 95-99 23.972465078886543 27.8816199376947 27.956989247311824 20.188925736106924 100-104 23.56752379024094 28.497671593439968 26.923466288722413 21.01133832759668 105-109 23.85166240409207 27.964194373401536 27.82097186700767 20.36317135549872 110-114 24.079246844609973 28.703703703703702 26.955307262569832 20.26174218911649 115-119 23.744698675323313 28.530289543955178 27.29462275511807 20.430389025603436 120-124 24.12815575524176 28.62109542148053 27.246469833119384 20.004278990158323 125-129 24.640238187131278 28.560401389424932 26.856701769862713 19.942658653581077 130-134 23.499161542761318 28.451648965902738 27.814421464505312 20.234768026830633 135-139 23.84572386808273 28.999441028507544 26.646171045276688 20.508664058133036 140-141 24.762437115707097 28.59139183901621 25.936277249860257 20.709893795416434 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 1.0 14 1.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 2.0 27 4.0 28 7.5 29 11.0 30 17.5 31 23.5 32 29.0 33 40.0 34 50.0 35 75.0 36 103.5 37 117.5 38 144.0 39 175.0 40 209.0 41 239.5 42 244.0 43 262.0 44 275.5 45 264.5 46 261.5 47 248.0 48 222.0 49 196.5 50 168.0 51 143.0 52 118.0 53 79.5 54 57.5 55 55.5 56 40.5 57 31.5 58 25.5 59 12.5 60 9.0 61 10.5 62 9.0 63 4.5 64 2.5 65 1.5 66 1.0 67 2.0 68 1.0 69 0.5 70 0.5 71 0.5 72 1.0 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-141 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 92-93 8.0 94-95 4.0 96-97 16.0 98-99 8.0 100-101 10.0 102-103 19.0 104-105 18.0 106-107 13.0 108-109 22.0 110-111 14.0 112-113 20.0 114-115 12.0 116-117 26.0 118-119 41.0 120-121 27.0 122-123 45.0 124-125 47.0 126-127 44.0 128-129 28.0 130-131 0.0 132-133 0.0 134-135 0.0 136-137 0.0 138-139 0.0 140-141 3578.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 89.2707460184409 79.875 2 9.779267951941883 17.5 3 0.866163732886281 2.325 4 0.08382229673093043 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TATTCTA 10 0.008931199 132.5625 6 AATATTC 10 0.008931199 132.5625 4 ATATTCT 10 0.008931199 132.5625 5 >>END_MODULE Read 1699162 spots for SRR17200367.sra Written 1699162 spots for SRR17200367.sra Read 1699162 spots for SRR17200367.sra Written 1699162 spots for SRR17200367.sra Read 1699162 spots for SRR17200367.sra Written 1699162 spots for SRR17200367.sra Read 1699162 spots for SRR17200367.sra Written 1699162 spots for SRR17200367.sra Read 1699162 spots for SRR17200367.sra Written 1699162 spots for SRR17200367.sra Read 1699162 spots for SRR17200367.sra Written 1699162 spots for SRR17200367.sra Read 1699162 spots for SRR17200367.sra Written 1699162 spots for SRR17200367.sra Read 1699162 spots for SRR17200367.sra Written 1699162 spots for SRR17200367.sra Read 1699162 spots for SRR17200367.sra Written 1699162 spots for SRR17200367.sra Read 1699162 spots for SRR17200367.sra Written 1699162 spots for SRR17200367.sra Read 1699162 spots for SRR17200367.sra Written 1699162 spots for SRR17200367.sra Read 1699162 spots for SRR17200367.sra Written 1699162 spots for SRR17200367.sra Read 1699162 spots for SRR17200367.sra Written 1699162 spots for SRR17200367.sra Read 1699162 spots for SRR17200367.sra Written 1699162 spots for SRR17200367.sra Read 1699164 spots for SRR17200367.sra Written 1699164 spots for SRR17200367.sra Read 1699162 spots for SRR17200367.sra Written 1699162 spots for SRR17200367.sra Read 1699162 spots for SRR17200367.sra Written 1699162 spots for SRR17200367.sra Read 1699162 spots for SRR17200367.sra Written 1699162 spots for SRR17200367.sra Read 1699162 spots for SRR17200367.sra Written 1699162 spots for SRR17200367.sra Read 1699162 spots for SRR17200367.sra Written 1699162 spots for SRR17200367.sra SRR ids: ['SRR17200367.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_sva80ec0 SRR17200367.sra spots: 33983242 blocks: [[1, 1699162], [1699163, 3398324], [3398325, 5097486], [5097487, 6796648], [6796649, 8495810], [8495811, 10194972], [10194973, 11894134], [11894135, 13593296], [13593297, 15292458], [15292459, 16991620], [16991621, 18690782], [18690783, 20389944], [20389945, 22089106], [22089107, 23788268], [23788269, 25487430], [25487431, 27186592], [27186593, 28885754], [28885755, 30584916], [30584917, 32284078], [32284079, 33983242]] SRR17200367 file size 10678417 SRR17200367 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR17200367 SRR17200367_1.fastq SRR17200367_2.fastq Input file: SRR17200367_1.fastq Paired file: SRR17200367_2.fastq trimmed: SRR17200367-trimmed-pair1.fastq, SRR17200367-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 05:25:22 2025 >> started Wed Feb 12 05:25:56 2025 >> done (33.855s) 33983242 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 0 ( 0.00%) empty read pairs filtered out after trimming by size control 33983242 (100.00%) read pairs available; of these: 126194 ( 0.37%) trimmed read pairs available after processing 33857048 (99.63%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 89 470 0.00% 90 437 0.00% 91 511 0.00% 92 21519 0.06% 93 23231 0.07% 94 26959 0.08% 95 30214 0.09% 96 33094 0.10% 97 35290 0.10% 98 38682 0.11% 99 41433 0.12% 100 46141 0.14% 101 50049 0.15% 102 54924 0.16% 103 60444 0.18% 104 65103 0.19% 105 69923 0.21% 106 75889 0.22% 107 79273 0.23% 108 83875 0.25% 109 89844 0.26% 110 95195 0.28% 111 99435 0.29% 112 107384 0.32% 113 114490 0.34% 114 119713 0.35% 115 127268 0.37% 116 132836 0.39% 117 139519 0.41% 118 144312 0.42% 119 147825 0.43% 120 152236 0.45% 121 159628 0.47% 122 166493 0.49% 123 172005 0.51% 124 180748 0.53% 125 186034 0.55% 126 187835 0.55% 127 195313 0.57% 128 198035 0.58% 129 1934 0.01% 130 2112 0.01% 131 2894 0.01% 132 8312 0.02% 133 11545 0.03% 134 36039 0.11% 135 0 0.00% 136 514 0.00% 137 1287 0.00% 138 5708 0.02% 139 8852 0.03% 140 32003 0.09% 141 30118433 88.63% 33983242 reads passed initial QC criterion=sequence-density sequence-density=0.48 sequence-density-rank=1 fanout-score=2.05 fanout-score-rank=22 prefix-density=0.49 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.10 sequence-density-rank=23 fanout-score=92.50 fanout-score-rank=1 prefix-density=0.77 prefix-fanout=12.6 sequence=CTTCTTCTCCTTGGCATCTCCTTCATGGGAAACTGCAGCTTCAGGGGAAACATGTTCAGGAGCTGGAGGAGGGACCTCGTCAGCTTTCTTATGTCCTGGCAATTTCTCCTTGATTTTGTCAAGGAAACCCTTCTT criterion=sequence-density sequence-density=0.99 sequence-density-rank=1 fanout-score=2.27 fanout-score-rank=22 prefix-density=1.02 prefix-fanout=2.2 sequence=ACAAAGCTGGTA criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=49.67 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=2.7 sequence=AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACAACTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTGTCTTCTTCA SRR17200367 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 05:26:35 Started mapping on | Feb 12 05:26:36 Finished on | Feb 12 05:28:44 Mapping speed, Million of reads per hour | 955.78 Number of input reads | 33983242 Average input read length | 276 UNIQUE READS: Uniquely mapped reads number | 26168495 Uniquely mapped reads % | 77.00% Average mapped length | 278.58 Number of splices: Total | 25195400 Number of splices: Annotated (sjdb) | 24636859 Number of splices: GT/AG | 24784163 Number of splices: GC/AG | 346380 Number of splices: AT/AC | 14268 Number of splices: Non-canonical | 50589 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.02% Deletion average length | 2.15 Insertion rate per base | 0.01% Insertion average length | 2.23 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 567396 % of reads mapped to multiple loci | 1.67% Number of reads mapped to too many loci | 376100 % of reads mapped to too many loci | 1.11% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 20.08% % of reads unmapped: other | 0.14% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 7247351 7247351 7247351 N_multimapping 567396 567396 567396 N_noFeature 902817 25908130 980174 N_ambiguous 489993 2282 305815 UnstrandedReadsAssigned:24775685 PositiveStrandReadsAssigned:258083 NegativeStrandReadsAssigned:24882506 Dataset is classified negative stranded MeadianReadLen=141 20thPercentileLength=141 echo kmer=137 SRR17200367 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR17200367-trimmed-pair1.fastq SRR17200367-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 33,983,242 reads, 31,052,229 reads pseudoaligned [quant] estimated average fragment length: 178.777 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,242 rounds 52401 SRR17200367.ke.tsv 34699 SRR17200367.se.tsv 87100 total ==> SRR17200367.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1840.22 1074 19.3514 Potri.005G024800.1.v4.1 1035 857.223 977 37.7902 Potri.004G059700.1.v4.1 961 783.223 23 0.973691 Potri.007G009000.2.v4.1 1416 1238.22 0 0 Potri.003G141000.2.v4.1 2943 2765.22 1848.32 22.1628 Potri.016G087400.1.v4.1 270 103.501 1934 619.569 Potri.015G069301.1.v4.1 564 386.32 0 0 Potri.010G195200.1.v4.1 1773 1595.22 146 3.03466 Potri.012G127500.1.v4.1 977 799.223 12141 503.692 ==> SRR17200367.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 680 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 345 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 178 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 6 SRR17200367 completed mapping pipeline successfully