Starting /dee2/code/volunteer_pipeline.sh SRR17200368 current disk space = 3048927006720 free memory = 1326053964 SRR17200368 SRAfilesize f93b44254d78db475eb8333775e0a6a9 SRR17200368.sra SRR17200368.sra file validated SRR17200368 is paired end SRR17200368 is conventional basespace SRR17200368 read1 length is 93-141 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR17200368_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 93-141 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.676 37.0 37.0 37.0 37.0 37.0 2 36.6365 37.0 37.0 37.0 37.0 37.0 3 36.6265 37.0 37.0 37.0 37.0 37.0 4 36.5945 37.0 37.0 37.0 37.0 37.0 5 36.5705 37.0 37.0 37.0 37.0 37.0 6 36.4415 37.0 37.0 37.0 37.0 37.0 7 36.4535 37.0 37.0 37.0 37.0 37.0 8 36.55475 37.0 37.0 37.0 37.0 37.0 9 36.565 37.0 37.0 37.0 37.0 37.0 10-14 36.594899999999996 37.0 37.0 37.0 37.0 37.0 15-19 36.5477 37.0 37.0 37.0 37.0 37.0 20-24 36.4763 37.0 37.0 37.0 37.0 37.0 25-29 36.4743 37.0 37.0 37.0 37.0 37.0 30-34 36.4959 37.0 37.0 37.0 37.0 37.0 35-39 36.485200000000006 37.0 37.0 37.0 37.0 37.0 40-44 36.4835 37.0 37.0 37.0 37.0 37.0 45-49 36.4677 37.0 37.0 37.0 37.0 37.0 50-54 36.4599 37.0 37.0 37.0 37.0 37.0 55-59 36.413399999999996 37.0 37.0 37.0 37.0 37.0 60-64 36.3846 37.0 37.0 37.0 37.0 37.0 65-69 36.3798 37.0 37.0 37.0 37.0 37.0 70-74 36.370799999999996 37.0 37.0 37.0 37.0 37.0 75-79 36.372899999999994 37.0 37.0 37.0 37.0 37.0 80-84 36.3449 37.0 37.0 37.0 37.0 37.0 85-89 36.33669999999999 37.0 37.0 37.0 37.0 37.0 90-94 36.33763491745873 37.0 37.0 37.0 37.0 37.0 95-99 36.262432960689615 37.0 37.0 37.0 37.0 37.0 100-104 36.18482811327101 37.0 37.0 37.0 37.0 37.0 105-109 36.10776059189378 37.0 37.0 37.0 37.0 37.0 110-114 36.17718785330688 37.0 37.0 37.0 37.0 37.0 115-119 36.059241403165686 37.0 37.0 37.0 37.0 37.0 120-124 36.13030893312974 37.0 37.0 37.0 37.0 37.0 125-129 36.12956060644977 37.0 37.0 37.0 37.0 37.0 130-134 36.116731517509734 37.0 37.0 37.0 37.0 37.0 135-139 36.01734296831573 37.0 37.0 37.0 37.0 37.0 140-141 35.92523624235686 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 2.0 20 0.0 21 0.0 22 1.0 23 0.0 24 2.0 25 1.0 26 3.0 27 8.0 28 12.0 29 15.0 30 23.0 31 32.0 32 35.0 33 67.0 34 117.0 35 265.0 36 2706.0 37 711.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 50.224999999999994 8.325000000000001 6.05 35.4 2 18.8 11.4 41.8 28.000000000000004 3 19.35 16.775000000000002 26.625 37.25 4 23.525 25.05 22.400000000000002 29.025000000000002 5 22.675 27.150000000000002 26.775 23.400000000000002 6 19.35 30.925000000000004 27.775 21.95 7 14.7 25.124999999999996 42.075 18.099999999999998 8 16.429107276819206 21.45536384096024 37.83445861465366 24.281070267566893 9 17.424999999999997 22.475 35.675000000000004 24.425 10-14 20.835 28.910000000000004 27.134999999999998 23.119999999999997 15-19 20.32 27.99 27.944999999999997 23.745 20-24 20.560000000000002 27.694999999999997 27.644999999999996 24.099999999999998 25-29 20.785 27.71 27.700000000000003 23.805 30-34 20.630000000000003 28.15 27.150000000000002 24.07 35-39 20.095 27.74 28.375 23.79 40-44 21.21 27.24 27.38 24.169999999999998 45-49 20.635 27.894999999999996 27.544999999999998 23.925 50-54 20.87 28.205000000000002 27.58 23.345 55-59 20.82 28.365000000000002 27.33 23.485 60-64 20.965 27.750000000000004 27.46 23.825 65-69 20.875 27.584999999999997 27.455000000000002 24.085 70-74 21.25 27.82 27.694999999999997 23.235 75-79 20.419999999999998 28.38 27.439999999999998 23.76 80-84 20.61 27.375 27.339999999999996 24.675 85-89 20.79 27.57 28.155 23.485 90-94 20.347034703470346 27.667766776677666 28.257825782578255 23.72737273727373 95-99 20.781304849305453 27.481069154004313 27.50112832856928 24.236497668120958 100-104 21.20234012507565 27.60238047205971 27.819245511398023 23.376033891466612 105-109 21.054770856620262 27.1415506554212 28.330454222131895 23.473224265826644 110-114 21.115107913669064 26.99383350462487 28.216855087358685 23.674203494347378 115-119 21.505039427646352 27.280797952895714 27.36435322993368 23.849809389524257 120-124 21.192547910105162 27.683766615064325 27.646399402124594 23.47728607270592 125-129 21.033311417926804 26.61626123164585 28.172255095332016 24.178172255095333 130-134 20.722623679822124 27.871039466370206 27.231795441912173 24.174541411895497 135-139 21.167315175097276 27.75430794886048 27.526403557531964 23.55197331851028 140-141 20.622568093385212 27.57087270705948 28.168426903835464 23.638132295719842 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 2.0 22 2.0 23 1.0 24 3.0 25 7.0 26 6.5 27 4.5 28 8.5 29 17.0 30 20.5 31 22.5 32 27.5 33 29.0 34 42.5 35 60.5 36 69.0 37 100.0 38 127.0 39 121.0 40 139.5 41 185.0 42 213.5 43 228.0 44 267.0 45 292.0 46 280.5 47 257.5 48 242.0 49 218.5 50 195.0 51 177.0 52 134.5 53 115.5 54 93.5 55 60.5 56 43.5 57 38.5 58 40.0 59 32.0 60 26.0 61 16.5 62 11.0 63 7.0 64 0.0 65 2.5 66 3.5 67 1.5 68 3.0 69 3.5 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.025 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-141 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 93 2.0 94 0.0 95 5.0 96 7.0 97 2.0 98 4.0 99 6.0 100 2.0 101 7.0 102 4.0 103 5.0 104 4.0 105 8.0 106 8.0 107 7.0 108 8.0 109 9.0 110 8.0 111 12.0 112 7.0 113 18.0 114 12.0 115 10.0 116 12.0 117 17.0 118 16.0 119 19.0 120 17.0 121 16.0 122 17.0 123 22.0 124 16.0 125 14.0 126 22.0 127 32.0 128 27.0 129 0.0 130 0.0 131 0.0 132 0.0 133 0.0 134 0.0 135 0.0 136 0.0 137 0.0 138 0.0 139 0.0 140 0.0 141 3598.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 82.575 #Duplication Level Percentage of deduplicated Percentage of total 1 82.89433848016954 68.45 2 14.047835301241296 23.200000000000003 3 2.300938540720557 5.7 4 0.5752346351801393 1.9 5 0.18165304268846502 0.75 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGCCACACCTGCATGCATTGAACTCTTCCGCCATTGCTTGCAATGGAAGT 5 0.125 No Hit GGAGCCCTAATTGGTATCCAAATCATTAATCTACATTGACATGCTCATAG 5 0.125 No Hit GTTTCGTTACCCTTGAAAGTTTAGTACAGAAAGAAGAAAATTTCTTTATC 5 0.125 No Hit GTGACTTCTCCATAGAACTTGGTAGAGATGTTACTTAGATGGCTTTCGAC 5 0.125 No Hit GGAAATAATACCAGTTGAGCTATGGCTCGTTGGCAAAAATTATGTAGTTT 5 0.125 No Hit GGCGGCAATAAAGCTGATGCACTGCACTTGACGCGTGTTGTCGAATCCGA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACAAAGA 10 0.00905313 131.9625 7 TAATCCT 10 0.00905313 131.9625 9 GTGAAAG 10 0.00905313 131.9625 7 TGAAAGC 10 0.00905313 131.9625 8 >>END_MODULE SRR17200368 read2 length is 93-141 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR17200368_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 93-141 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.7415 37.0 37.0 37.0 37.0 37.0 2 36.6155 37.0 37.0 37.0 37.0 37.0 3 36.553 37.0 37.0 37.0 37.0 37.0 4 36.487 37.0 37.0 37.0 37.0 37.0 5 36.5395 37.0 37.0 37.0 37.0 37.0 6 36.4915 37.0 37.0 37.0 37.0 37.0 7 36.5665 37.0 37.0 37.0 37.0 37.0 8 36.568 37.0 37.0 37.0 37.0 37.0 9 36.565 37.0 37.0 37.0 37.0 37.0 10-14 36.5844 37.0 37.0 37.0 37.0 37.0 15-19 36.485400000000006 37.0 37.0 37.0 37.0 37.0 20-24 36.4878 37.0 37.0 37.0 37.0 37.0 25-29 36.4771 37.0 37.0 37.0 37.0 37.0 30-34 36.4642 37.0 37.0 37.0 37.0 37.0 35-39 36.389300000000006 37.0 37.0 37.0 37.0 37.0 40-44 36.4543 37.0 37.0 37.0 37.0 37.0 45-49 36.3426 37.0 37.0 37.0 37.0 37.0 50-54 36.3437 37.0 37.0 37.0 37.0 37.0 55-59 36.35039999999999 37.0 37.0 37.0 37.0 37.0 60-64 36.318200000000004 37.0 37.0 37.0 37.0 37.0 65-69 36.2987 37.0 37.0 37.0 37.0 37.0 70-74 36.3091 37.0 37.0 37.0 37.0 37.0 75-79 36.245400000000004 37.0 37.0 37.0 37.0 37.0 80-84 36.1854 37.0 37.0 37.0 37.0 37.0 85-89 36.2473 37.0 37.0 37.0 37.0 37.0 90-94 36.150718509254624 37.0 37.0 37.0 37.0 37.0 95-99 36.09823477294356 37.0 37.0 37.0 37.0 37.0 100-104 36.123528814668575 37.0 37.0 37.0 37.0 37.0 105-109 36.1465575866295 37.0 37.0 37.0 37.0 37.0 110-114 36.09962439346806 37.0 37.0 37.0 37.0 37.0 115-119 36.0181448602464 37.0 37.0 37.0 37.0 37.0 120-124 36.01031909737705 37.0 37.0 37.0 37.0 37.0 125-129 35.941177243556325 37.0 37.0 37.0 37.0 37.0 130-134 35.84613674263479 37.0 37.0 37.0 37.0 37.0 135-139 35.74685936631462 37.0 37.0 37.0 37.0 37.0 140-141 35.753474152306836 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 0.0 23 3.0 24 1.0 25 4.0 26 3.0 27 8.0 28 11.0 29 20.0 30 15.0 31 25.0 32 35.0 33 64.0 34 126.0 35 360.0 36 2907.0 37 417.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 54.074999999999996 23.25 7.049999999999999 15.625 2 20.925 30.225 31.574999999999996 17.275 3 20.150000000000002 30.45 30.4 19.0 4 24.575 36.225 20.974999999999998 18.224999999999998 5 23.45 39.425 21.875 15.25 6 20.8 37.25 24.375 17.575 7 20.1 22.400000000000002 37.1 20.4 8 20.025000000000002 25.05 29.2 25.724999999999998 9 21.625 26.200000000000003 28.125 24.05 10-14 25.335 27.584999999999997 25.840000000000003 21.240000000000002 15-19 23.855 28.52 27.21 20.415 20-24 23.330000000000002 28.59 26.66 21.42 25-29 24.58 28.63 26.810000000000002 19.98 30-34 23.494999999999997 28.685 26.875 20.945 35-39 23.25 29.020000000000003 26.99 20.74 40-44 23.28 27.67 28.225 20.825 45-49 23.3 27.96 26.740000000000002 22.0 50-54 22.84 28.055000000000003 27.915 21.19 55-59 23.285 27.665 27.765 21.285 60-64 24.02 27.065 27.839999999999996 21.075 65-69 23.5 27.425 27.925 21.15 70-74 23.445 27.884999999999998 27.32 21.349999999999998 75-79 23.465 28.24 26.795 21.5 80-84 23.91 27.655 27.229999999999997 21.205 85-89 23.990000000000002 27.08 27.58 21.349999999999998 90-94 24.227422742274225 27.997799779978 27.16271627162716 20.612061206120615 95-99 23.238553733513868 27.05481169449877 28.383732009427813 21.322902562559552 100-104 24.37966512003228 27.930199717571114 27.057696187210006 20.632438975186602 105-109 24.316912138141188 27.12544438801422 27.50634840020315 21.051295073641445 110-114 23.12788906009245 28.08423215202876 27.519260400616336 21.268618387262457 115-119 23.351949475442353 27.751970353358736 27.433582128503573 21.462498042695337 120-124 23.823749066467514 27.72858209751414 26.81105302464526 21.63661581137309 125-129 23.698472655608473 28.357146767394752 26.950238134340616 20.994142442656155 130-134 23.835464146748194 28.449138410227903 26.725958866036688 20.989438576987215 135-139 23.87437465258477 28.65480822679266 26.548082267926628 20.922734852695942 140-141 23.262923846581433 28.779877709838797 26.8899388549194 21.067259588660367 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 1.0 18 1.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 1.5 25 1.5 26 2.5 27 6.5 28 5.5 29 6.5 30 13.5 31 24.0 32 32.0 33 37.0 34 45.5 35 43.0 36 59.5 37 103.5 38 129.0 39 164.0 40 188.5 41 195.5 42 234.5 43 248.0 44 253.5 45 265.0 46 269.0 47 281.5 48 243.5 49 205.0 50 193.5 51 160.5 52 127.5 53 99.5 54 93.0 55 76.5 56 51.5 57 40.0 58 22.5 59 20.0 60 18.0 61 8.0 62 7.5 63 6.5 64 3.0 65 2.0 66 1.5 67 2.5 68 1.5 69 0.5 70 1.0 71 1.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-141 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 93 2.0 94 0.0 95 5.0 96 7.0 97 2.0 98 4.0 99 6.0 100 2.0 101 7.0 102 4.0 103 5.0 104 4.0 105 6.0 106 8.0 107 7.0 108 8.0 109 9.0 110 8.0 111 12.0 112 7.0 113 18.0 114 12.0 115 10.0 116 12.0 117 17.0 118 16.0 119 19.0 120 17.0 121 15.0 122 17.0 123 22.0 124 16.0 125 14.0 126 20.0 127 33.0 128 31.0 129 0.0 130 0.0 131 0.0 132 0.0 133 0.0 134 0.0 135 0.0 136 0.0 137 0.0 138 0.0 139 0.0 140 0.0 141 3598.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 83.1 #Duplication Level Percentage of deduplicated Percentage of total 1 83.39350180505414 69.3 2 13.628158844765343 22.650000000000002 3 2.3766546329723224 5.925 4 0.45126353790613716 1.5 5 0.15042117930204574 0.625 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTTTGCCCAATTTTTAGAATAATTTCCTAGATAAATTTCTTGATTTCAAG 5 0.125 No Hit GTAAAGGTGTATCCTGATGGGGCAGAAGAGCCTGTTGAGATTACTGCCGG 5 0.125 No Hit AGCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTGATTTCATCGGCGGCC 5 0.125 No Hit GCAACATGTCAAAGAGACAACAGAGGTTGGTGAAGGGAAACTTTTCTCCC 5 0.125 No Hit GAAGGGGTGGAATTTTTCAGCCCTGTCTACTTGTTTGATGAAGGCTCTTC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1626340 spots for SRR17200368.sra Written 1626340 spots for SRR17200368.sra Read 1626340 spots for SRR17200368.sra Written 1626340 spots for SRR17200368.sra Read 1626351 spots for SRR17200368.sra Written 1626351 spots for SRR17200368.sra Read 1626340 spots for SRR17200368.sra Written 1626340 spots for SRR17200368.sra Read 1626340 spots for SRR17200368.sra Written 1626340 spots for SRR17200368.sra Read 1626340 spots for SRR17200368.sra Written 1626340 spots for SRR17200368.sra Read 1626340 spots for SRR17200368.sra Written 1626340 spots for SRR17200368.sra Read 1626340 spots for SRR17200368.sra Written 1626340 spots for SRR17200368.sra Read 1626340 spots for SRR17200368.sra Written 1626340 spots for SRR17200368.sra Read 1626340 spots for SRR17200368.sra Written 1626340 spots for SRR17200368.sra Read 1626340 spots for SRR17200368.sra Written 1626340 spots for SRR17200368.sra Read 1626340 spots for SRR17200368.sra Written 1626340 spots for SRR17200368.sra Read 1626340 spots for SRR17200368.sra Written 1626340 spots for SRR17200368.sra Read 1626340 spots for SRR17200368.sra Written 1626340 spots for SRR17200368.sra Read 1626340 spots for SRR17200368.sra Written 1626340 spots for SRR17200368.sra Read 1626340 spots for SRR17200368.sra Written 1626340 spots for SRR17200368.sra Read 1626340 spots for SRR17200368.sra Written 1626340 spots for SRR17200368.sra Read 1626340 spots for SRR17200368.sra Written 1626340 spots for SRR17200368.sra Read 1626340 spots for SRR17200368.sra Written 1626340 spots for SRR17200368.sra Read 1626340 spots for SRR17200368.sra Written 1626340 spots for SRR17200368.sra SRR ids: ['SRR17200368.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_k5zvvinp SRR17200368.sra spots: 32526811 blocks: [[1, 1626340], [1626341, 3252680], [3252681, 4879020], [4879021, 6505360], [6505361, 8131700], [8131701, 9758040], [9758041, 11384380], [11384381, 13010720], [13010721, 14637060], [14637061, 16263400], [16263401, 17889740], [17889741, 19516080], [19516081, 21142420], [21142421, 22768760], [22768761, 24395100], [24395101, 26021440], [26021441, 27647780], [27647781, 29274120], [29274121, 30900460], [30900461, 32526811]] SRR17200368 file size 10248244 SRR17200368 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR17200368 SRR17200368_1.fastq SRR17200368_2.fastq Input file: SRR17200368_1.fastq Paired file: SRR17200368_2.fastq trimmed: SRR17200368-trimmed-pair1.fastq, SRR17200368-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 05:28:44 2025 >> started Wed Feb 12 05:29:20 2025 >> done (35.871s) 32526811 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 0 ( 0.00%) empty read pairs filtered out after trimming by size control 32526811 (100.00%) read pairs available; of these: 1363857 ( 4.19%) trimmed read pairs available after processing 31162954 (95.81%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 90 5537 0.02% 91 6482 0.02% 92 17010 0.05% 93 20121 0.06% 94 22038 0.07% 95 24527 0.08% 96 27077 0.08% 97 29646 0.09% 98 31949 0.10% 99 34349 0.11% 100 37389 0.11% 101 41579 0.13% 102 45231 0.14% 103 49407 0.15% 104 53026 0.16% 105 57778 0.18% 106 61768 0.19% 107 65955 0.20% 108 68734 0.21% 109 73094 0.22% 110 77958 0.24% 111 83212 0.26% 112 87326 0.27% 113 93053 0.29% 114 99113 0.30% 115 104088 0.32% 116 110471 0.34% 117 117042 0.36% 118 120369 0.37% 119 124685 0.38% 120 129385 0.40% 121 133483 0.41% 122 139400 0.43% 123 147282 0.45% 124 152436 0.47% 125 159111 0.49% 126 166417 0.51% 127 110734 0.34% 128 116552 0.36% 129 2322 0.01% 130 2661 0.01% 131 2847 0.01% 132 8382 0.03% 133 9812 0.03% 134 34250 0.11% 135 0 0.00% 136 2175 0.01% 137 4683 0.01% 138 33777 0.10% 139 72972 0.22% 140 220560 0.68% 141 29087556 89.43% 32526811 reads passed initial QC criterion=sequence-density sequence-density=0.95 sequence-density-rank=1 fanout-score=2.04 fanout-score-rank=19 prefix-density=0.97 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.15 sequence-density-rank=16 fanout-score=89.89 fanout-score-rank=1 prefix-density=0.88 prefix-fanout=15.3 sequence=TCTTCTTCTTCTCTGGTTCAAGGGGT criterion=sequence-density sequence-density=0.79 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=25 prefix-density=0.77 prefix-fanout=2.0 sequence=TACCTTCTTCGC criterion=fanout-score sequence-density=0.15 sequence-density-rank=21 fanout-score=82.80 fanout-score-rank=1 prefix-density=0.91 prefix-fanout=13.7 sequence=AGAAGAAGAAGAGTTACTTTGAGCAAGCCAAGGA SRR17200368 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 05:30:01 Started mapping on | Feb 12 05:30:01 Finished on | Feb 12 05:31:59 Mapping speed, Million of reads per hour | 992.34 Number of input reads | 32526811 Average input read length | 277 UNIQUE READS: Uniquely mapped reads number | 28579007 Uniquely mapped reads % | 87.86% Average mapped length | 275.66 Number of splices: Total | 24806336 Number of splices: Annotated (sjdb) | 24288179 Number of splices: GT/AG | 24339595 Number of splices: GC/AG | 411851 Number of splices: AT/AC | 13606 Number of splices: Non-canonical | 41284 Mismatch rate per base, % | 0.22% Deletion rate per base | 0.02% Deletion average length | 2.05 Insertion rate per base | 0.01% Insertion average length | 2.14 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 675513 % of reads mapped to multiple loci | 2.08% Number of reads mapped to too many loci | 313699 % of reads mapped to too many loci | 0.96% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 8.97% % of reads unmapped: other | 0.13% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 3272291 3272291 3272291 N_multimapping 675513 675513 675513 N_noFeature 1028168 28320429 1108557 N_ambiguous 387098 1174 208573 UnstrandedReadsAssigned:27163741 PositiveStrandReadsAssigned:257404 NegativeStrandReadsAssigned:27261877 Dataset is classified negative stranded MeadianReadLen=141 20thPercentileLength=141 echo kmer=137 SRR17200368 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR17200368-trimmed-pair1.fastq SRR17200368-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 32,526,811 reads, 29,661,807 reads pseudoaligned [quant] estimated average fragment length: 182.536 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,159 rounds 52401 SRR17200368.ke.tsv 34699 SRR17200368.se.tsv 87100 total ==> SRR17200368.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1836.46 634 12.4436 Potri.005G024800.1.v4.1 1035 853.464 568 23.9885 Potri.004G059700.1.v4.1 961 779.464 21 0.9711 Potri.007G009000.2.v4.1 1416 1234.46 9 0.262788 Potri.003G141000.2.v4.1 2943 2761.46 1533 20.0098 Potri.016G087400.1.v4.1 270 100.267 784 281.839 Potri.015G069301.1.v4.1 564 382.583 0 0 Potri.010G195200.1.v4.1 1773 1591.46 31 0.702111 Potri.012G127500.1.v4.1 977 795.464 7573 343.153 ==> SRR17200368.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 232 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 357 Potri.001G212900.v4.1 11 Potri.001G182400.v4.1 4 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 176 Potri.001G416900.v4.1 3 Potri.001G452600.v4.1 2 SRR17200368 completed mapping pipeline successfully