Starting /dee2/code/volunteer_pipeline.sh SRR17200369 current disk space = 3048974008320 free memory = 1511641276 SRR17200369 SRAfilesize 2c134524016034782fcec9b06e6c8475 SRR17200369.sra SRR17200369.sra file validated SRR17200369 is paired end SRR17200369 is conventional basespace SRR17200369 read1 length is 92-141 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR17200369_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 92-141 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3705 37.0 37.0 37.0 37.0 37.0 2 36.696 37.0 37.0 37.0 37.0 37.0 3 36.443 37.0 37.0 37.0 37.0 37.0 4 36.551 37.0 37.0 37.0 37.0 37.0 5 36.5125 37.0 37.0 37.0 37.0 37.0 6 36.4725 37.0 37.0 37.0 37.0 37.0 7 36.0195 37.0 37.0 37.0 37.0 37.0 8 36.5335 37.0 37.0 37.0 37.0 37.0 9 36.531 37.0 37.0 37.0 37.0 37.0 10-14 36.47189999999999 37.0 37.0 37.0 37.0 37.0 15-19 36.47180000000001 37.0 37.0 37.0 37.0 37.0 20-24 36.4579 37.0 37.0 37.0 37.0 37.0 25-29 36.3305 37.0 37.0 37.0 37.0 37.0 30-34 36.3175 37.0 37.0 37.0 37.0 37.0 35-39 36.408300000000004 37.0 37.0 37.0 37.0 37.0 40-44 36.4268 37.0 37.0 37.0 37.0 37.0 45-49 36.3803 37.0 37.0 37.0 37.0 37.0 50-54 36.33149999999999 37.0 37.0 37.0 37.0 37.0 55-59 36.3832 37.0 37.0 37.0 37.0 37.0 60-64 36.3381 37.0 37.0 37.0 37.0 37.0 65-69 36.2997 37.0 37.0 37.0 37.0 37.0 70-74 36.1122 37.0 37.0 37.0 37.0 37.0 75-79 36.051500000000004 37.0 37.0 37.0 37.0 37.0 80-84 36.33069999999999 37.0 37.0 37.0 37.0 37.0 85-89 36.2969 37.0 37.0 37.0 37.0 37.0 90-94 35.934387853824184 37.0 37.0 37.0 37.0 37.0 95-99 36.323888346541295 37.0 37.0 37.0 37.0 37.0 100-104 36.17526988064137 37.0 37.0 37.0 37.0 37.0 105-109 36.18843914698188 37.0 37.0 37.0 37.0 37.0 110-114 36.12239727201491 37.0 37.0 37.0 37.0 37.0 115-119 36.012998690179174 37.0 37.0 37.0 37.0 37.0 120-124 36.14014007182685 37.0 37.0 37.0 37.0 37.0 125-129 36.08399676243762 37.0 37.0 37.0 37.0 37.0 130-134 35.90764966740576 37.0 37.0 37.0 37.0 37.0 135-139 36.049778270509975 37.0 37.0 37.0 37.0 37.0 140-141 35.894678492239464 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 0.0 22 2.0 23 2.0 24 3.0 25 1.0 26 5.0 27 3.0 28 10.0 29 12.0 30 19.0 31 38.0 32 40.0 33 74.0 34 120.0 35 349.0 36 2920.0 37 401.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 19.1 10.65 41.375 28.875 2 18.7 15.75 25.974999999999998 39.574999999999996 3 24.95 23.75 22.825 28.475 4 23.125 29.975 25.2 21.7 5 17.349999999999998 32.074999999999996 28.525 22.05 6 15.525 26.1 40.6 17.775 7 16.8 23.525 35.75 23.925 8 19.075 21.224999999999998 33.15 26.55 9 17.125 36.725 27.025 19.125 10-14 20.474999999999998 27.455000000000002 27.54 24.529999999999998 15-19 20.445 28.244999999999997 28.044999999999998 23.265 20-24 20.64 27.245 27.305 24.81 25-29 20.48 27.21 28.044999999999998 24.265 30-34 20.369999999999997 28.76 27.485 23.385 35-39 20.845 28.244999999999997 27.235 23.674999999999997 40-44 20.13 28.449999999999996 27.76 23.66 45-49 20.505000000000003 28.110000000000003 27.51 23.875 50-54 20.775 28.1 27.08 24.044999999999998 55-59 19.85 28.46 27.900000000000002 23.79 60-64 20.7 27.944999999999997 27.384999999999998 23.97 65-69 20.5 27.339999999999996 27.005000000000003 25.155 70-74 20.435 28.12 27.615000000000002 23.830000000000002 75-79 20.72 28.08 27.839999999999996 23.36 80-84 20.405 27.92 27.689999999999998 23.985 85-89 20.61 27.87 27.284999999999997 24.235 90-94 21.3367352043624 27.830306668667763 27.194957226474557 23.638000900495275 95-99 20.36906677393403 27.664923572003218 27.72526146419952 24.240748189863233 100-104 21.119206638332322 27.939688322201985 27.44889698441611 23.492208055049584 105-109 20.018374846876277 28.215598203348307 27.720498162515312 24.045528787260107 110-114 19.664169465254457 28.173598553345393 27.36243864634461 24.799793335055544 115-119 20.531680151308183 27.582221288221078 28.09708941893454 23.789009141536198 120-124 20.83221620462223 26.864711244570756 28.232076786959087 24.07099576384793 125-129 20.213175100269215 28.031426844678865 28.047909455524422 23.707488599527498 130-134 20.288248337028826 28.403547671840357 27.278270509977826 24.029933481152995 135-139 20.875831485587586 27.77161862527716 27.67738359201774 23.675166297117517 140-141 21.078159645232816 28.686252771618626 26.746119733924612 23.489467849223946 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.5 24 2.0 25 3.0 26 4.5 27 6.5 28 9.0 29 14.5 30 21.5 31 23.5 32 33.0 33 45.5 34 62.0 35 74.5 36 83.5 37 105.0 38 123.5 39 159.5 40 180.5 41 183.5 42 207.5 43 244.5 44 262.5 45 252.5 46 260.0 47 266.5 48 242.5 49 210.0 50 175.0 51 152.0 52 133.0 53 102.5 54 80.0 55 58.5 56 46.0 57 40.0 58 28.0 59 23.0 60 19.0 61 12.5 62 11.0 63 12.5 64 9.5 65 3.0 66 0.5 67 1.0 68 3.5 69 2.5 70 0.5 71 1.0 72 1.0 73 1.0 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-141 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 92-93 9.0 94-95 9.0 96-97 8.0 98-99 13.0 100-101 8.0 102-103 8.0 104-105 20.0 106-107 14.0 108-109 20.0 110-111 20.0 112-113 19.0 114-115 31.0 116-117 29.0 118-119 29.0 120-121 35.0 122-123 33.0 124-125 36.0 126-127 38.0 128-129 13.0 130-131 0.0 132-133 0.0 134-135 0.0 136-137 0.0 138-139 0.0 140-141 3608.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 88.375 #Duplication Level Percentage of deduplicated Percentage of total 1 88.45827439886845 78.175 2 10.212164073550213 18.05 3 1.0466760961810466 2.775 4 0.2828854314002829 1.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0125 0.0 66-67 0.0 0.0 0.0 0.025 0.0 68-69 0.0 0.0 0.0 0.025 0.0 70-71 0.0 0.0 0.0 0.025 0.0 72-73 0.0 0.0 0.0 0.025 0.0 74-75 0.0 0.0 0.0 0.025 0.0 76-77 0.0 0.0 0.0 0.025 0.0 78-79 0.0 0.0 0.0 0.025 0.0 80-81 0.0 0.0 0.0 0.025 0.0 82-83 0.0 0.0 0.0 0.025 0.0 84-85 0.0 0.0 0.0 0.025 0.0 86-87 0.0 0.0 0.0 0.025 0.0 88-89 0.0 0.0 0.0 0.025 0.0 90-91 0.0 0.0 0.0 0.025 0.0 92-93 0.0 0.0 0.0 0.025 0.0 94-95 0.0 0.0 0.0 0.025 0.0 96-97 0.0 0.0 0.0 0.025 0.0 98-99 0.0 0.0 0.0 0.025 0.0 100-101 0.0 0.0 0.0 0.025 0.0 102-103 0.0 0.0 0.0 0.025 0.0 104-105 0.0 0.0 0.0 0.025 0.0 106-107 0.0 0.0 0.0 0.025 0.0 108-109 0.0 0.0 0.0 0.025 0.0 110-111 0.0 0.0 0.0 0.025 0.0 112-113 0.0 0.0 0.0 0.025 0.0 114-115 0.0 0.0 0.0 0.025 0.0 116-117 0.0 0.0 0.0 0.025 0.0 118-119 0.0 0.0 0.0 0.025 0.0 120-121 0.0 0.0 0.0 0.025 0.0 122-123 0.0 0.0 0.0 0.025 0.0 124-125 0.0 0.0 0.0 0.025 0.0 126-127 0.0 0.0 0.0 0.025 0.0 128-129 0.0 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTACTGC 10 0.008891043 132.7625 7 TACTGCG 10 0.008891043 132.7625 8 >>END_MODULE SRR17200369 read2 length is 92-141 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR17200369_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 92-141 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3165 37.0 37.0 37.0 37.0 37.0 2 36.382 37.0 37.0 37.0 37.0 37.0 3 36.526 37.0 37.0 37.0 37.0 37.0 4 36.261 37.0 37.0 37.0 37.0 37.0 5 36.4595 37.0 37.0 37.0 37.0 37.0 6 36.266 37.0 37.0 37.0 37.0 37.0 7 36.2795 37.0 37.0 37.0 37.0 37.0 8 36.2175 37.0 37.0 37.0 37.0 37.0 9 36.053 37.0 37.0 37.0 37.0 37.0 10-14 36.347300000000004 37.0 37.0 37.0 37.0 37.0 15-19 36.1766 37.0 37.0 37.0 37.0 37.0 20-24 36.0546 37.0 37.0 37.0 37.0 37.0 25-29 36.0548 37.0 37.0 37.0 37.0 37.0 30-34 36.199400000000004 37.0 37.0 37.0 37.0 37.0 35-39 36.252599999999994 37.0 37.0 37.0 37.0 37.0 40-44 36.088300000000004 37.0 37.0 37.0 37.0 37.0 45-49 36.1207 37.0 37.0 37.0 37.0 37.0 50-54 36.185500000000005 37.0 37.0 37.0 37.0 37.0 55-59 35.9878 37.0 37.0 37.0 34.6 37.0 60-64 36.2338 37.0 37.0 37.0 37.0 37.0 65-69 35.970299999999995 37.0 37.0 37.0 37.0 37.0 70-74 35.9593 37.0 37.0 37.0 37.0 37.0 75-79 35.674400000000006 37.0 37.0 37.0 34.6 37.0 80-84 35.9293 37.0 37.0 37.0 34.6 37.0 85-89 35.9833 37.0 37.0 37.0 37.0 37.0 90-94 35.91793677008845 37.0 37.0 37.0 37.0 37.0 95-99 35.73983042148916 37.0 37.0 37.0 34.6 37.0 100-104 35.96806486880033 37.0 37.0 37.0 37.0 37.0 105-109 35.75707612787907 37.0 37.0 37.0 34.6 37.0 110-114 35.75382561682922 37.0 37.0 37.0 34.6 37.0 115-119 35.9236447958804 37.0 37.0 37.0 37.0 37.0 120-124 35.870599313468254 37.0 37.0 37.0 37.0 37.0 125-129 35.56681247671158 37.0 37.0 37.0 34.6 37.0 130-134 35.69291251384274 37.0 37.0 37.0 37.0 37.0 135-139 35.80753045404208 37.0 37.0 37.0 37.0 37.0 140-141 35.53959025470654 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 1.0 24 3.0 25 4.0 26 7.0 27 6.0 28 16.0 29 7.0 30 24.0 31 25.0 32 60.0 33 99.0 34 206.0 35 674.0 36 2686.0 37 181.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 21.05 27.025 32.2 19.725 2 20.75 28.425 30.85 19.975 3 25.1 36.05 20.349999999999998 18.5 4 23.625 39.825 20.974999999999998 15.575 5 21.349999999999998 36.6 25.324999999999996 16.725 6 22.175 21.099999999999998 36.55 20.175 7 18.85 24.525 30.925000000000004 25.7 8 23.724999999999998 25.0 27.35 23.925 9 23.325000000000003 31.924999999999997 26.474999999999998 18.275 10-14 24.215 27.12 26.815 21.85 15-19 23.615 28.01 27.48 20.895 20-24 23.62 28.685 26.729999999999997 20.965 25-29 23.575 28.38 27.21 20.835 30-34 23.965 27.815 27.310000000000002 20.91 35-39 23.385 27.87 27.834999999999997 20.91 40-44 23.075000000000003 28.43 28.17 20.325 45-49 23.830000000000002 28.08 27.089999999999996 21.0 50-54 23.810000000000002 28.175 26.985 21.029999999999998 55-59 23.335 27.884999999999998 27.57 21.21 60-64 23.855 28.005000000000003 27.41 20.73 65-69 24.16 26.99 27.98 20.87 70-74 23.49 27.860000000000003 27.560000000000002 21.09 75-79 23.925 28.185 27.150000000000002 20.74 80-84 24.055 27.865000000000002 27.315 20.765 85-89 23.215 27.950000000000003 27.98 20.855 90-94 24.137068534267133 28.809404702351177 26.768384192096047 20.28514257128564 95-99 23.943095561252704 28.32654702659227 27.140200070376512 20.590157341778514 100-104 23.460974252617735 27.38631190247357 28.054023976933586 21.09868986797511 105-109 23.631168035923867 28.279838750829207 27.141909475940196 20.94708373730673 110-114 23.670075405433323 28.018799710773678 27.39386427022002 20.917260613572978 115-119 24.0526923480634 27.62674504041146 27.511283719953816 20.809278891571324 120-124 23.66391774659955 28.17821570097462 27.465995501767164 20.69187105065867 125-129 24.224965706447186 27.873799725651576 27.37997256515775 20.521262002743484 130-134 24.13621262458472 28.322259136212622 26.99889258028793 20.54263565891473 135-139 24.047619047619047 28.660022148394244 26.356589147286826 20.93576965669989 140-141 23.172757475083056 29.332779623477297 27.61627906976744 19.878183831672203 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 3.5 24 5.0 25 2.0 26 3.5 27 8.0 28 9.0 29 11.5 30 17.0 31 25.0 32 29.5 33 33.5 34 48.0 35 66.0 36 84.5 37 117.5 38 137.5 39 142.5 40 178.0 41 212.5 42 234.0 43 258.0 44 278.0 45 286.0 46 263.5 47 257.5 48 238.5 49 193.5 50 170.5 51 133.0 52 109.5 53 113.0 54 93.5 55 60.0 56 39.5 57 26.0 58 20.0 59 21.5 60 20.0 61 15.0 62 11.5 63 9.0 64 4.0 65 2.5 66 4.0 67 3.0 68 2.0 69 1.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-141 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 92-93 8.0 94-95 9.0 96-97 8.0 98-99 13.0 100-101 8.0 102-103 8.0 104-105 20.0 106-107 14.0 108-109 20.0 110-111 20.0 112-113 18.0 114-115 29.0 116-117 29.0 118-119 28.0 120-121 35.0 122-123 33.0 124-125 37.0 126-127 36.0 128-129 15.0 130-131 0.0 132-133 0.0 134-135 0.0 136-137 0.0 138-139 0.0 140-141 3612.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 88.675 #Duplication Level Percentage of deduplicated Percentage of total 1 88.66647871440654 78.625 2 10.149422046800114 18.0 3 1.0149422046800112 2.7 4 0.11277135607555681 0.4 5 0.028192839018889203 0.125 6 0.028192839018889203 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TTGGGTCTACCGCGAGCACCACCAGTCCCCAGGGTACTATGATGGACGCT 6 0.15 No Hit GGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTGATTTCAT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAAGATC 10 0.008891043 132.7625 1 >>END_MODULE Read 1585197 spots for SRR17200369.sra Written 1585197 spots for SRR17200369.sra Read 1585197 spots for SRR17200369.sra Written 1585197 spots for SRR17200369.sra Read 1585197 spots for SRR17200369.sra Written 1585197 spots for SRR17200369.sra Read 1585197 spots for SRR17200369.sra Written 1585197 spots for SRR17200369.sra Read 1585197 spots for SRR17200369.sra Written 1585197 spots for SRR17200369.sra Read 1585197 spots for SRR17200369.sra Written 1585197 spots for SRR17200369.sra Read 1585197 spots for SRR17200369.sra Written 1585197 spots for SRR17200369.sra Read 1585197 spots for SRR17200369.sra Written 1585197 spots for SRR17200369.sra Read 1585197 spots for SRR17200369.sra Written 1585197 spots for SRR17200369.sra Read 1585197 spots for SRR17200369.sra Written 1585197 spots for SRR17200369.sra Read 1585197 spots for SRR17200369.sra Written 1585197 spots for SRR17200369.sra Read 1585197 spots for SRR17200369.sra Written 1585197 spots for SRR17200369.sra Read 1585197 spots for SRR17200369.sra Written 1585197 spots for SRR17200369.sra Read 1585197 spots for SRR17200369.sra Written 1585197 spots for SRR17200369.sra Read 1585197 spots for SRR17200369.sra Written 1585197 spots for SRR17200369.sra Read 1585197 spots for SRR17200369.sra Written 1585197 spots for SRR17200369.sra Read 1585197 spots for SRR17200369.sra Written 1585197 spots for SRR17200369.sra Read 1585198 spots for SRR17200369.sra Written 1585198 spots for SRR17200369.sra Read 1585197 spots for SRR17200369.sra Written 1585197 spots for SRR17200369.sra Read 1585197 spots for SRR17200369.sra Written 1585197 spots for SRR17200369.sra SRR ids: ['SRR17200369.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_qb_kxabf SRR17200369.sra spots: 31703941 blocks: [[1, 1585197], [1585198, 3170394], [3170395, 4755591], [4755592, 6340788], [6340789, 7925985], [7925986, 9511182], [9511183, 11096379], [11096380, 12681576], [12681577, 14266773], [14266774, 15851970], [15851971, 17437167], [17437168, 19022364], [19022365, 20607561], [20607562, 22192758], [22192759, 23777955], [23777956, 25363152], [25363153, 26948349], [26948350, 28533546], [28533547, 30118743], [30118744, 31703941]] SRR17200369 file size 9996715 SRR17200369 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR17200369 SRR17200369_1.fastq SRR17200369_2.fastq Input file: SRR17200369_1.fastq Paired file: SRR17200369_2.fastq trimmed: SRR17200369-trimmed-pair1.fastq, SRR17200369-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 05:20:16 2025 >> started Wed Feb 12 05:20:48 2025 >> done (31.980s) 31703941 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 0 ( 0.00%) empty read pairs filtered out after trimming by size control 31703941 (100.00%) read pairs available; of these: 98513 ( 0.31%) trimmed read pairs available after processing 31605428 (99.69%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 89 378 0.00% 90 351 0.00% 91 457 0.00% 92 15755 0.05% 93 17194 0.05% 94 19272 0.06% 95 21316 0.07% 96 23720 0.07% 97 25422 0.08% 98 27263 0.09% 99 29674 0.09% 100 32584 0.10% 101 35829 0.11% 102 39311 0.12% 103 43439 0.14% 104 47073 0.15% 105 49914 0.16% 106 54467 0.17% 107 56528 0.18% 108 60224 0.19% 109 64214 0.20% 110 68357 0.22% 111 71526 0.23% 112 78686 0.25% 113 83471 0.26% 114 88120 0.28% 115 94471 0.30% 116 98292 0.31% 117 103386 0.33% 118 108018 0.34% 119 110787 0.35% 120 113055 0.36% 121 119367 0.38% 122 125156 0.39% 123 133197 0.42% 124 139411 0.44% 125 144659 0.46% 126 144974 0.46% 127 154534 0.49% 128 155813 0.49% 129 1714 0.01% 130 2469 0.01% 131 2636 0.01% 132 7254 0.02% 133 9397 0.03% 134 34517 0.11% 135 0 0.00% 136 439 0.00% 137 1009 0.00% 138 4781 0.02% 139 6767 0.02% 140 24494 0.08% 141 28808799 90.87% 31703941 reads passed initial QC criterion=sequence-density sequence-density=0.91 sequence-density-rank=1 fanout-score=2.04 fanout-score-rank=21 prefix-density=0.93 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.16 sequence-density-rank=16 fanout-score=85.29 fanout-score-rank=1 prefix-density=0.93 prefix-fanout=14.7 sequence=TCTTCTTCTTCTCTGGTTCAAGGGGT criterion=sequence-density sequence-density=0.73 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=26 prefix-density=0.72 prefix-fanout=2.0 sequence=TACCTTCTTCGC criterion=fanout-score sequence-density=0.16 sequence-density-rank=18 fanout-score=74.90 fanout-score-rank=1 prefix-density=0.93 prefix-fanout=13.0 sequence=AGAAGAAGAAGAGTTACTTTGAGCAAGCCAAGGACATGATACCAGCATATAAGAAAACTGAAGA SRR17200369 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 05:21:27 Started mapping on | Feb 12 05:21:28 Finished on | Feb 12 05:23:24 Mapping speed, Million of reads per hour | 983.92 Number of input reads | 31703941 Average input read length | 277 UNIQUE READS: Uniquely mapped reads number | 24867178 Uniquely mapped reads % | 78.44% Average mapped length | 279.16 Number of splices: Total | 22300237 Number of splices: Annotated (sjdb) | 21829154 Number of splices: GT/AG | 21883344 Number of splices: GC/AG | 366093 Number of splices: AT/AC | 11477 Number of splices: Non-canonical | 39323 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.02% Deletion average length | 2.00 Insertion rate per base | 0.01% Insertion average length | 2.20 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 580349 % of reads mapped to multiple loci | 1.83% Number of reads mapped to too many loci | 370296 % of reads mapped to too many loci | 1.17% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 18.43% % of reads unmapped: other | 0.14% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 6256414 6256414 6256414 N_multimapping 580349 580349 580349 N_noFeature 899034 24632063 967393 N_ambiguous 426935 1702 259407 UnstrandedReadsAssigned:23541209 PositiveStrandReadsAssigned:233413 NegativeStrandReadsAssigned:23640378 Dataset is classified negative stranded MeadianReadLen=141 20thPercentileLength=141 echo kmer=137 SRR17200369 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR17200369-trimmed-pair1.fastq SRR17200369-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 31,703,941 reads, 28,592,824 reads pseudoaligned [quant] estimated average fragment length: 187.702 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,086 rounds 52401 SRR17200369.ke.tsv 34699 SRR17200369.se.tsv 87100 total ==> SRR17200369.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1831.3 650 13.0327 Potri.005G024800.1.v4.1 1035 848.298 574 24.8452 Potri.004G059700.1.v4.1 961 774.298 12 0.569053 Potri.007G009000.2.v4.1 1416 1229.3 5 0.149346 Potri.003G141000.2.v4.1 2943 2756.3 1812.55 24.1459 Potri.016G087400.1.v4.1 270 99.3691 884.66 326.892 Potri.015G069301.1.v4.1 564 377.42 0 0 Potri.010G195200.1.v4.1 1773 1586.3 20 0.46294 Potri.012G127500.1.v4.1 977 790.298 7418 344.648 ==> SRR17200369.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 527 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 308 Potri.001G212900.v4.1 12 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 244 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR17200369 completed mapping pipeline successfully