Starting /dee2/code/volunteer_pipeline.sh SRR17200371 current disk space = 3048854605824 free memory = 1577052048 SRR17200371 SRAfilesize 4d8a8d889d6a25e7a347d5e4d6ca3903 SRR17200371.sra SRR17200371.sra file validated SRR17200371 is paired end SRR17200371 is conventional basespace SRR17200371 read1 length is 92-141 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR17200371_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 92-141 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.4285 37.0 37.0 37.0 37.0 37.0 2 36.5745 37.0 37.0 37.0 37.0 37.0 3 36.3875 37.0 37.0 37.0 37.0 37.0 4 36.545 37.0 37.0 37.0 37.0 37.0 5 36.3635 37.0 37.0 37.0 37.0 37.0 6 36.394 37.0 37.0 37.0 37.0 37.0 7 35.9995 37.0 37.0 37.0 37.0 37.0 8 36.491 37.0 37.0 37.0 37.0 37.0 9 36.553 37.0 37.0 37.0 37.0 37.0 10-14 36.446600000000004 37.0 37.0 37.0 37.0 37.0 15-19 36.4415 37.0 37.0 37.0 37.0 37.0 20-24 36.4437 37.0 37.0 37.0 37.0 37.0 25-29 36.3369 37.0 37.0 37.0 37.0 37.0 30-34 36.3307 37.0 37.0 37.0 37.0 37.0 35-39 36.373599999999996 37.0 37.0 37.0 37.0 37.0 40-44 36.3769 37.0 37.0 37.0 37.0 37.0 45-49 36.355399999999996 37.0 37.0 37.0 37.0 37.0 50-54 36.2652 37.0 37.0 37.0 37.0 37.0 55-59 36.318 37.0 37.0 37.0 37.0 37.0 60-64 36.262100000000004 37.0 37.0 37.0 37.0 37.0 65-69 36.1973 37.0 37.0 37.0 37.0 37.0 70-74 36.0015 37.0 37.0 37.0 37.0 37.0 75-79 36.012699999999995 37.0 37.0 37.0 37.0 37.0 80-84 36.2602 37.0 37.0 37.0 37.0 37.0 85-89 36.2302 37.0 37.0 37.0 37.0 37.0 90-94 35.89026829821991 37.0 37.0 37.0 37.0 37.0 95-99 36.23806257511001 37.0 37.0 37.0 37.0 37.0 100-104 36.097237439739764 37.0 37.0 37.0 37.0 37.0 105-109 36.05254157050744 37.0 37.0 37.0 37.0 37.0 110-114 36.076177703833636 37.0 37.0 37.0 37.0 37.0 115-119 35.991632413982835 37.0 37.0 37.0 37.0 37.0 120-124 36.03087526221661 37.0 37.0 37.0 37.0 37.0 125-129 35.986439420674614 37.0 37.0 37.0 37.0 37.0 130-134 35.727545909849745 37.0 37.0 37.0 37.0 37.0 135-139 35.967390094602116 37.0 37.0 37.0 37.0 37.0 140-141 35.60740122426266 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 2.0 21 0.0 22 1.0 23 1.0 24 2.0 25 2.0 26 3.0 27 5.0 28 14.0 29 20.0 30 27.0 31 42.0 32 50.0 33 83.0 34 121.0 35 385.0 36 2842.0 37 400.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 18.0 10.75 40.45 30.8 2 18.099999999999998 16.7 25.074999999999996 40.125 3 23.325000000000003 24.575 22.85 29.25 4 24.425 28.050000000000004 25.775 21.75 5 18.3 31.474999999999998 26.75 23.474999999999998 6 14.124999999999998 25.374999999999996 41.199999999999996 19.3 7 16.5 23.125 35.55 24.825 8 16.875 20.200000000000003 36.3 26.625 9 18.475 34.125 27.625 19.775000000000002 10-14 21.279999999999998 26.22 27.6 24.9 15-19 20.65 26.645000000000003 28.18 24.525 20-24 21.14 27.400000000000002 26.83 24.63 25-29 21.005 26.72 27.61 24.665 30-34 20.849999999999998 27.49 26.76 24.9 35-39 20.125 27.315 27.284999999999997 25.275 40-44 21.505 26.405 26.825 25.264999999999997 45-49 20.775 26.665 27.955000000000002 24.605 50-54 20.59 27.089999999999996 27.134999999999998 25.185000000000002 55-59 19.88 26.985 28.000000000000004 25.135 60-64 21.135 26.69 27.555000000000003 24.62 65-69 20.645 27.07 26.775 25.509999999999998 70-74 20.715 27.060000000000002 26.945000000000004 25.28 75-79 20.785 26.93 27.01 25.275 80-84 21.12 26.69 27.36 24.83 85-89 21.525 26.700000000000003 26.905 24.87 90-94 20.64825930372149 27.380952380952383 27.606042416966787 24.364745898359345 95-99 21.065837013247695 26.299678843837814 27.488960256924933 25.14552388598956 100-104 20.622096546152292 26.600686729953544 27.423752777216727 25.35346394667744 105-109 20.28556858745538 27.81234064252932 26.986231514533397 24.915859255481898 110-114 20.859560416881642 27.226292436281085 27.422350634609433 24.49179651222784 115-119 20.886142243636744 26.9299256310883 27.21273698544045 24.971195139834503 120-124 20.471723398552665 28.02465826856071 27.247386759581882 24.256231573304742 125-129 21.032946482591715 26.54969473626313 26.978714042131895 25.438644739013256 130-134 20.400667779632723 26.605453533667223 27.62381747356706 25.370061213133 135-139 20.779076238174735 26.872565386755703 27.134112409571507 25.21424596549805 140-141 20.993322203672786 26.766833611574846 27.810239287701727 24.42960489705064 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.5 19 0.5 20 1.0 21 1.0 22 2.5 23 3.5 24 2.5 25 3.0 26 5.5 27 8.5 28 10.5 29 15.0 30 22.0 31 27.5 32 29.0 33 35.5 34 54.0 35 73.5 36 91.0 37 102.5 38 116.0 39 146.5 40 152.5 41 153.0 42 181.5 43 203.5 44 234.0 45 247.0 46 225.0 47 232.5 48 227.0 49 193.5 50 159.5 51 142.0 52 136.0 53 115.0 54 105.0 55 90.5 56 70.0 57 62.5 58 54.0 59 46.5 60 34.5 61 24.5 62 33.0 63 30.0 64 16.0 65 10.0 66 8.0 67 6.5 68 7.5 69 8.5 70 9.0 71 6.0 72 6.5 73 11.0 74 6.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-141 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 92-93 5.0 94-95 4.0 96-97 10.0 98-99 8.0 100-101 11.0 102-103 15.0 104-105 12.0 106-107 25.0 108-109 14.0 110-111 18.0 112-113 23.0 114-115 18.0 116-117 33.0 118-119 34.0 120-121 40.0 122-123 36.0 124-125 35.0 126-127 39.0 128-129 26.0 130-131 0.0 132-133 0.0 134-135 0.0 136-137 0.0 138-139 0.0 140-141 3594.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 86.15 #Duplication Level Percentage of deduplicated Percentage of total 1 86.59315147997678 74.6 2 11.375507835171213 19.6 3 1.5670342426001163 4.05 4 0.4062681369704005 1.4000000000000001 5 0.0 0.0 6 0.0 0.0 7 0.05803830528148578 0.35000000000000003 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TCGGCAATCGGACGGCGGGCGCACGCGTCGCATCTAGCCCGGATTCTGAC 7 0.17500000000000002 No Hit TCCTACTCATCGGGGCCTGGCGCTTGCCCCGACGGCCGGGTATAGGTCGC 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CACTATT 10 0.008871054 132.8625 3 TTTGCTG 10 0.008871054 132.8625 7 >>END_MODULE SRR17200371 read2 length is 92-141 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR17200371_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 92-141 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.303 37.0 37.0 37.0 37.0 37.0 2 36.3745 37.0 37.0 37.0 37.0 37.0 3 36.375 37.0 37.0 37.0 37.0 37.0 4 36.3 37.0 37.0 37.0 37.0 37.0 5 36.3565 37.0 37.0 37.0 37.0 37.0 6 36.372 37.0 37.0 37.0 37.0 37.0 7 36.3255 37.0 37.0 37.0 37.0 37.0 8 36.2545 37.0 37.0 37.0 37.0 37.0 9 35.9615 37.0 37.0 37.0 37.0 37.0 10-14 36.322300000000006 37.0 37.0 37.0 37.0 37.0 15-19 36.1803 37.0 37.0 37.0 37.0 37.0 20-24 36.12329999999999 37.0 37.0 37.0 37.0 37.0 25-29 36.1304 37.0 37.0 37.0 37.0 37.0 30-34 36.22500000000001 37.0 37.0 37.0 37.0 37.0 35-39 36.2739 37.0 37.0 37.0 37.0 37.0 40-44 36.0501 37.0 37.0 37.0 37.0 37.0 45-49 36.1496 37.0 37.0 37.0 37.0 37.0 50-54 36.2184 37.0 37.0 37.0 37.0 37.0 55-59 36.0212 37.0 37.0 37.0 34.6 37.0 60-64 36.2311 37.0 37.0 37.0 37.0 37.0 65-69 35.9313 37.0 37.0 37.0 37.0 37.0 70-74 35.966499999999996 37.0 37.0 37.0 37.0 37.0 75-79 35.6353 37.0 37.0 37.0 34.6 37.0 80-84 35.9188 37.0 37.0 37.0 34.6 37.0 85-89 35.9661 37.0 37.0 37.0 37.0 37.0 90-94 35.90926730085111 37.0 37.0 37.0 37.0 37.0 95-99 35.75603811331277 37.0 37.0 37.0 34.6 37.0 100-104 35.958665728195825 37.0 37.0 37.0 37.0 37.0 105-109 35.7392340198456 37.0 37.0 37.0 34.6 37.0 110-114 35.78617465322022 37.0 37.0 37.0 37.0 37.0 115-119 35.9261138330032 37.0 37.0 37.0 37.0 37.0 120-124 35.916529790190054 37.0 37.0 37.0 37.0 37.0 125-129 35.65409157908045 37.0 37.0 37.0 34.6 37.0 130-134 35.72022222222222 37.0 37.0 37.0 37.0 37.0 135-139 35.79322222222222 37.0 37.0 37.0 37.0 37.0 140-141 35.594166666666666 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 1.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 1.0 24 2.0 25 4.0 26 6.0 27 6.0 28 15.0 29 18.0 30 23.0 31 32.0 32 52.0 33 94.0 34 200.0 35 675.0 36 2646.0 37 225.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 22.725 25.45 32.9 18.925 2 22.425 27.775 30.099999999999998 19.7 3 25.575 36.375 20.525 17.525 4 24.675 38.775 21.025 15.525 5 20.200000000000003 37.724999999999994 25.0 17.075000000000003 6 22.25 21.9 35.675000000000004 20.175 7 19.325 23.875 30.15 26.650000000000002 8 23.724999999999998 24.099999999999998 27.700000000000003 24.474999999999998 9 24.8 32.925 22.875 19.400000000000002 10-14 25.27 26.919999999999998 25.974999999999998 21.834999999999997 15-19 24.51 28.055000000000003 26.69 20.745 20-24 24.775 27.405 27.015 20.805 25-29 24.57 28.349999999999998 26.215 20.865000000000002 30-34 24.82 28.58 25.945 20.655 35-39 24.23 27.58 26.784999999999997 21.404999999999998 40-44 24.685000000000002 28.005000000000003 26.71 20.599999999999998 45-49 24.945 27.975 26.27 20.810000000000002 50-54 25.1 27.229999999999997 26.935 20.735 55-59 24.5 27.500000000000004 27.485 20.515 60-64 25.369999999999997 27.065 26.064999999999998 21.5 65-69 24.91 26.939999999999998 26.96 21.19 70-74 24.565 27.605 26.55 21.279999999999998 75-79 24.895 26.955000000000002 26.8 21.349999999999998 80-84 25.259999999999998 26.815 26.565 21.36 85-89 24.685000000000002 27.625 26.775 20.915 90-94 24.754901960784316 27.120848339335733 26.91076430572229 21.213485394157665 95-99 24.99498294200281 27.919927754364842 26.103752759381898 20.98133654425045 100-104 24.795599071363682 27.485616230947812 26.78913899263147 20.92964570505703 105-109 25.057318999337646 27.487644571253885 26.55525551536149 20.899780914046975 110-114 24.090299969075353 27.352850221626635 27.17245644778889 21.384393361509122 115-119 24.437820311682877 27.256563121012444 26.634243279991633 21.671373287313042 120-124 25.306362712045804 27.227484347407287 25.868250655535935 21.59790228501097 125-129 24.655352337013237 28.36821002910968 25.86917119789092 21.10726643598616 130-134 24.772222222222222 27.505555555555556 25.811111111111114 21.91111111111111 135-139 24.877777777777776 28.338888888888892 25.822222222222223 20.961111111111112 140-141 24.02777777777778 28.77777777777778 25.805555555555554 21.38888888888889 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 1.0 24 1.5 25 1.0 26 2.0 27 4.0 28 6.5 29 8.0 30 12.0 31 22.0 32 32.5 33 42.0 34 46.5 35 62.0 36 80.5 37 99.0 38 112.0 39 128.0 40 159.0 41 197.0 42 229.5 43 232.0 44 230.5 45 248.5 46 254.5 47 241.0 48 212.5 49 192.0 50 174.5 51 148.0 52 123.0 53 105.0 54 102.0 55 88.5 56 74.0 57 63.0 58 56.0 59 52.0 60 38.0 61 24.0 62 20.0 63 18.0 64 12.0 65 5.0 66 5.0 67 6.5 68 6.5 69 4.0 70 6.0 71 5.0 72 0.0 73 1.0 74 1.5 75 1.0 76 1.0 77 1.5 78 1.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-141 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 92-93 5.0 94-95 4.0 96-97 8.0 98-99 8.0 100-101 11.0 102-103 15.0 104-105 11.0 106-107 24.0 108-109 14.0 110-111 18.0 112-113 23.0 114-115 16.0 116-117 33.0 118-119 32.0 120-121 42.0 122-123 36.0 124-125 35.0 126-127 43.0 128-129 22.0 130-131 0.0 132-133 0.0 134-135 0.0 136-137 0.0 138-139 0.0 140-141 3600.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 87.225 #Duplication Level Percentage of deduplicated Percentage of total 1 87.5895672112353 76.4 2 10.805388363427916 18.85 3 1.2037833190025795 3.15 4 0.2579535683576956 0.8999999999999999 5 0.08598452278589853 0.375 6 0.028661507595299514 0.15 7 0.028661507595299514 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TAATTCTAGAGCTAATACGTGCAACAAACCCCGACTTCTGGAAGGGACGC 7 0.17500000000000002 No Hit TTAGTTTTACCCTACTGATGACAGTGTCGCAATAGTAATCCAACCTAGTA 6 0.15 No Hit TGAAGATGGCTACAAGGACTGCTAGGACTGAACTTGCAGGAGAGAATGCA 5 0.125 No Hit TCAAAGTGAAGAAATTCAACCAAGCGCGGGTAAACGGCGGGAGTAACTAT 5 0.125 No Hit CACTGTTTCGGTGCGGGCCGCGAGAGCGGTACCAAATCGAGGCAAACTCT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1619161 spots for SRR17200371.sra Written 1619161 spots for SRR17200371.sra Read 1619147 spots for SRR17200371.sra Written 1619147 spots for SRR17200371.sra Read 1619147 spots for SRR17200371.sra Written 1619147 spots for SRR17200371.sra Read 1619147 spots for SRR17200371.sra Written 1619147 spots for SRR17200371.sra Read 1619147 spots for SRR17200371.sra Written 1619147 spots for SRR17200371.sra Read 1619147 spots for SRR17200371.sra Written 1619147 spots for SRR17200371.sra Read 1619147 spots for SRR17200371.sra Written 1619147 spots for SRR17200371.sra Read 1619147 spots for SRR17200371.sra Written 1619147 spots for SRR17200371.sra Read 1619147 spots for SRR17200371.sra Written 1619147 spots for SRR17200371.sra Read 1619147 spots for SRR17200371.sra Written 1619147 spots for SRR17200371.sra Read 1619147 spots for SRR17200371.sra Written 1619147 spots for SRR17200371.sra Read 1619147 spots for SRR17200371.sra Written 1619147 spots for SRR17200371.sra Read 1619147 spots for SRR17200371.sra Written 1619147 spots for SRR17200371.sra Read 1619147 spots for SRR17200371.sra Written 1619147 spots for SRR17200371.sra Read 1619147 spots for SRR17200371.sra Written 1619147 spots for SRR17200371.sra Read 1619147 spots for SRR17200371.sra Written 1619147 spots for SRR17200371.sra Read 1619147 spots for SRR17200371.sra Written 1619147 spots for SRR17200371.sra Read 1619147 spots for SRR17200371.sra Written 1619147 spots for SRR17200371.sra Read 1619147 spots for SRR17200371.sra Written 1619147 spots for SRR17200371.sra Read 1619147 spots for SRR17200371.sra Written 1619147 spots for SRR17200371.sra SRR ids: ['SRR17200371.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_0oercwg4 SRR17200371.sra spots: 32382954 blocks: [[1, 1619147], [1619148, 3238294], [3238295, 4857441], [4857442, 6476588], [6476589, 8095735], [8095736, 9714882], [9714883, 11334029], [11334030, 12953176], [12953177, 14572323], [14572324, 16191470], [16191471, 17810617], [17810618, 19429764], [19429765, 21048911], [21048912, 22668058], [22668059, 24287205], [24287206, 25906352], [25906353, 27525499], [27525500, 29144646], [29144647, 30763793], [30763794, 32382954]] SRR17200371 file size 10198860 SRR17200371 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR17200371 SRR17200371_1.fastq SRR17200371_2.fastq Input file: SRR17200371_1.fastq Paired file: SRR17200371_2.fastq trimmed: SRR17200371-trimmed-pair1.fastq, SRR17200371-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 05:39:51 2025 >> started Wed Feb 12 05:40:29 2025 >> done (37.214s) 32382954 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 0 ( 0.00%) empty read pairs filtered out after trimming by size control 32382954 (100.00%) read pairs available; of these: 110347 ( 0.34%) trimmed read pairs available after processing 32272607 (99.66%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 89 426 0.00% 90 425 0.00% 91 570 0.00% 92 17907 0.06% 93 19930 0.06% 94 22283 0.07% 95 24484 0.08% 96 27538 0.09% 97 29646 0.09% 98 32055 0.10% 99 34752 0.11% 100 38485 0.12% 101 41163 0.13% 102 45709 0.14% 103 49028 0.15% 104 53562 0.17% 105 57588 0.18% 106 60574 0.19% 107 65602 0.20% 108 68279 0.21% 109 72056 0.22% 110 76127 0.24% 111 81297 0.25% 112 87938 0.27% 113 92158 0.28% 114 97175 0.30% 115 104328 0.32% 116 108293 0.33% 117 113024 0.35% 118 117709 0.36% 119 121838 0.38% 120 122761 0.38% 121 128832 0.40% 122 135111 0.42% 123 141906 0.44% 124 147140 0.45% 125 153536 0.47% 126 154763 0.48% 127 163072 0.50% 128 164753 0.51% 129 1988 0.01% 130 4575 0.01% 131 2941 0.01% 132 7318 0.02% 133 9557 0.03% 134 38993 0.12% 135 0 0.00% 136 491 0.00% 137 1219 0.00% 138 5386 0.02% 139 7856 0.02% 140 25705 0.08% 141 29203102 90.18% 32382954 reads passed initial QC criterion=sequence-density sequence-density=0.76 sequence-density-rank=1 fanout-score=2.04 fanout-score-rank=19 prefix-density=0.78 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.09 sequence-density-rank=27 fanout-score=17.66 fanout-score-rank=1 prefix-density=0.64 prefix-fanout=2.5 sequence=CGCATCGCCGGCCCCCATCCACTTCCCTCCCGACAATTTCAAGCACTCTTTGACTCTCTTTTCAAAGTCCTTTTCATCTTTCCCTCGCGGTACTTGTTTGCTATCGGTCTCTCGCCCGTATTTAGCCTTGGACGGAATTTACCGCCCGATTGGGGCTGCATTCCCAAACAACCCGACTCGCAGACAGCGCCTCGTGGTGCGGCAGGGTCCAGCCACGACGGGGCTCTCACCCTCTCCGGCGCCCCTTTCCAGGGGACTTGGGCCTGGTCCGCCGCTGAGGACGCTTCTCCAGACTACAATTCGGACGCCGCAGGCGCCAGATTCTCAAGCTGGGCATTTCCCGGTTCGCTCGCCGTTACTAGGGGAATCCTTGTAAGTTTCTTTTCCT criterion=sequence-density sequence-density=0.61 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=26 prefix-density=0.59 prefix-fanout=2.0 sequence=TACCTTCTTCGC criterion=fanout-score sequence-density=0.13 sequence-density-rank=23 fanout-score=7.38 fanout-score-rank=1 prefix-density=0.54 prefix-fanout=1.8 sequence=TGGTGCATGGCTGTCGTCAGCTCGTGCCGTAAGGTGTTGGGTTAAGTCCCGCAACGAGCGCAACCCTCGTGTTTAGTTGCCACCGTTGAGTTTGGAACCCTGAACAGACTGCCGGTGATAAGCCGGAGGAAGGTGAGGATGACGTCAAGTCATCATGCCCCTTATGCCCTGGGCGACACACGTGCTACAATGGCCGGGACAAAGGGTCGCGATCCCGCGAGGGTGAGCTAACTCCAAAAACCCGTCCTCAGTTCGGATTGCAGGCTGCAACTCGCCTGCATGAAGCCGGAATCGCTAGTAATCGCCGGTCAGCCATACGGCGGTGAATTCGTTCCCGGGCCTTGTACACACC SRR17200371 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 05:41:06 Started mapping on | Feb 12 05:41:06 Finished on | Feb 12 05:43:58 Mapping speed, Million of reads per hour | 677.78 Number of input reads | 32382954 Average input read length | 277 UNIQUE READS: Uniquely mapped reads number | 22656846 Uniquely mapped reads % | 69.97% Average mapped length | 278.92 Number of splices: Total | 19149315 Number of splices: Annotated (sjdb) | 18736702 Number of splices: GT/AG | 18790007 Number of splices: GC/AG | 307659 Number of splices: AT/AC | 11177 Number of splices: Non-canonical | 40472 Mismatch rate per base, % | 0.27% Deletion rate per base | 0.02% Deletion average length | 2.02 Insertion rate per base | 0.02% Insertion average length | 2.98 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 816356 % of reads mapped to multiple loci | 2.52% Number of reads mapped to too many loci | 2997218 % of reads mapped to too many loci | 9.26% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 17.22% % of reads unmapped: other | 1.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 8909752 8909752 8909752 N_multimapping 816356 816356 816356 N_noFeature 1602716 22352778 1680226 N_ambiguous 462639 2563 234433 UnstrandedReadsAssigned:20591491 PositiveStrandReadsAssigned:301505 NegativeStrandReadsAssigned:20742187 Dataset is classified negative stranded MeadianReadLen=141 20thPercentileLength=141 echo kmer=137 SRR17200371 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR17200371-trimmed-pair1.fastq SRR17200371-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 32,382,954 reads, 27,308,834 reads pseudoaligned [quant] estimated average fragment length: 185.513 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,154 rounds 52401 SRR17200371.ke.tsv 34699 SRR17200371.se.tsv 87100 total ==> SRR17200371.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1833.49 537 9.53353 Potri.005G024800.1.v4.1 1035 850.487 448 17.1462 Potri.004G059700.1.v4.1 961 776.487 9 0.377282 Potri.007G009000.2.v4.1 1416 1231.49 4 0.105727 Potri.003G141000.2.v4.1 2943 2758.49 1212.66 14.3096 Potri.016G087400.1.v4.1 270 99.9723 980 319.083 Potri.015G069301.1.v4.1 564 379.601 0 0 Potri.010G195200.1.v4.1 1773 1588.49 6 0.122949 Potri.012G127500.1.v4.1 977 792.487 9318 382.726 ==> SRR17200371.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 469 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 270 Potri.001G212900.v4.1 8 Potri.001G182400.v4.1 8 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 188 Potri.001G416900.v4.1 3 Potri.001G452600.v4.1 1 SRR17200371 completed mapping pipeline successfully