Starting /dee2/code/volunteer_pipeline.sh SRR17200372 current disk space = 3049652396032 free memory = 1577382460 SRR17200372 SRAfilesize b13aada646dad796069af66449638475 SRR17200372.sra SRR17200372.sra file validated SRR17200372 is paired end SRR17200372 is conventional basespace SRR17200372 read1 length is 92-141 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR17200372_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 92-141 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.436 37.0 37.0 37.0 37.0 37.0 2 36.634 37.0 37.0 37.0 37.0 37.0 3 36.4665 37.0 37.0 37.0 37.0 37.0 4 36.631 37.0 37.0 37.0 37.0 37.0 5 36.282 37.0 37.0 37.0 37.0 37.0 6 36.4805 37.0 37.0 37.0 37.0 37.0 7 35.9525 37.0 37.0 37.0 37.0 37.0 8 36.525 37.0 37.0 37.0 37.0 37.0 9 36.5585 37.0 37.0 37.0 37.0 37.0 10-14 36.47500000000001 37.0 37.0 37.0 37.0 37.0 15-19 36.460300000000004 37.0 37.0 37.0 37.0 37.0 20-24 36.467299999999994 37.0 37.0 37.0 37.0 37.0 25-29 36.3864 37.0 37.0 37.0 37.0 37.0 30-34 36.3073 37.0 37.0 37.0 37.0 37.0 35-39 36.4447 37.0 37.0 37.0 37.0 37.0 40-44 36.4128 37.0 37.0 37.0 37.0 37.0 45-49 36.422700000000006 37.0 37.0 37.0 37.0 37.0 50-54 36.3824 37.0 37.0 37.0 37.0 37.0 55-59 36.406000000000006 37.0 37.0 37.0 37.0 37.0 60-64 36.3523 37.0 37.0 37.0 37.0 37.0 65-69 36.2996 37.0 37.0 37.0 37.0 37.0 70-74 36.11319999999999 37.0 37.0 37.0 37.0 37.0 75-79 36.06230000000001 37.0 37.0 37.0 37.0 37.0 80-84 36.3512 37.0 37.0 37.0 37.0 37.0 85-89 36.2687 37.0 37.0 37.0 37.0 37.0 90-94 35.896838639362194 37.0 37.0 37.0 37.0 37.0 95-99 36.274246023157005 37.0 37.0 37.0 37.0 37.0 100-104 36.17452529986147 37.0 37.0 37.0 37.0 37.0 105-109 36.16081616423001 37.0 37.0 37.0 37.0 37.0 110-114 36.099517698345004 37.0 37.0 37.0 37.0 37.0 115-119 36.01717577126577 37.0 37.0 37.0 37.0 37.0 120-124 36.15006675028209 37.0 37.0 37.0 37.0 37.0 125-129 36.11580596958159 37.0 37.0 37.0 37.0 37.0 130-134 35.95445983379501 37.0 37.0 37.0 37.0 37.0 135-139 36.11601108033241 37.0 37.0 37.0 37.0 37.0 140-141 35.73407202216066 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 0.0 23 0.0 24 1.0 25 5.0 26 5.0 27 6.0 28 8.0 29 13.0 30 19.0 31 31.0 32 40.0 33 73.0 34 125.0 35 359.0 36 2948.0 37 366.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 19.05 11.525 40.400000000000006 29.025000000000002 2 18.975 17.0 26.174999999999997 37.85 3 24.224999999999998 24.125 23.225 28.425 4 24.05 28.175 25.674999999999997 22.1 5 16.900000000000002 32.6 29.125 21.375 6 14.549999999999999 26.424999999999997 41.225 17.8 7 18.325 21.475 34.425 25.775 8 17.825 21.55 35.8 24.825 9 17.325 36.275 26.625 19.775000000000002 10-14 21.315 27.139999999999997 26.884999999999998 24.66 15-19 21.27 28.244999999999997 27.13 23.355 20-24 21.29 27.650000000000002 27.065 23.995 25-29 20.515 27.61 28.115000000000002 23.76 30-34 21.36 27.779999999999998 26.815 24.044999999999998 35-39 20.555 28.134999999999998 27.155 24.154999999999998 40-44 20.605 28.494999999999997 26.99 23.91 45-49 20.474999999999998 28.075 27.82 23.630000000000003 50-54 21.14 27.295 27.839999999999996 23.724999999999998 55-59 21.055 27.415 27.61 23.919999999999998 60-64 20.885 28.285 27.034999999999997 23.794999999999998 65-69 21.075 28.215 26.52 24.19 70-74 20.97 28.03 27.6 23.400000000000002 75-79 20.595 27.01 28.62 23.775 80-84 21.135 27.595 27.055 24.215 85-89 21.154999999999998 27.794999999999998 27.33 23.72 90-94 21.15317297594639 27.88418262739411 27.539130869630448 23.423513527029055 95-99 21.53753512645524 27.22300281011642 27.84022480931353 23.399237254114812 100-104 20.813155770782892 28.833736884584344 27.037933817594833 23.31517352703793 105-109 20.777568571573966 28.141061523586586 27.55076077553305 23.530609129306395 110-114 21.30640840717082 27.493303111477434 27.31300226663919 23.88728621471255 115-119 20.606187072878086 27.96703010068339 27.2784182795138 24.14836454692472 120-124 20.86461161688761 27.03508491721237 27.67928445935154 24.421019006548477 125-129 20.620757608933655 27.7096562294723 27.83008539522663 23.83950076636742 130-134 20.681440443213297 27.911357340720222 27.689750692520775 23.71745152354571 135-139 21.52908587257618 27.51246537396122 27.008310249307478 23.950138504155124 140-141 21.191135734072024 27.991689750692522 26.0803324099723 24.736842105263158 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.5 23 2.0 24 1.5 25 4.0 26 5.5 27 6.5 28 8.5 29 16.0 30 21.5 31 22.0 32 29.0 33 36.0 34 42.0 35 63.5 36 87.0 37 85.5 38 91.5 39 131.0 40 164.0 41 182.0 42 229.5 43 257.0 44 253.0 45 269.5 46 277.5 47 259.0 48 246.0 49 238.5 50 213.5 51 177.0 52 126.5 53 102.5 54 95.5 55 60.0 56 42.5 57 42.5 58 35.5 59 31.5 60 19.0 61 6.5 62 4.0 63 3.5 64 1.5 65 1.0 66 1.5 67 1.0 68 1.0 69 1.0 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-141 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 92-93 2.0 94-95 7.0 96-97 12.0 98-99 5.0 100-101 9.0 102-103 12.0 104-105 11.0 106-107 21.0 108-109 23.0 110-111 13.0 112-113 23.0 114-115 15.0 116-117 29.0 118-119 25.0 120-121 34.0 122-123 43.0 124-125 44.0 126-127 36.0 128-129 26.0 130-131 0.0 132-133 0.0 134-135 0.0 136-137 0.0 138-139 0.0 140-141 3610.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 87.325 #Duplication Level Percentage of deduplicated Percentage of total 1 87.48926424277126 76.4 2 10.793014600629832 18.85 3 1.4600629831090752 3.8249999999999997 4 0.22902948754652158 0.8 5 0.028628685943315198 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCCGATTCAGCATCCGAATCCAGAAGCTAAAAACAAAAACAAAGTAGAAT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR17200372 read2 length is 92-141 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR17200372_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 92-141 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.244 37.0 37.0 37.0 37.0 37.0 2 36.436 37.0 37.0 37.0 37.0 37.0 3 36.459 37.0 37.0 37.0 37.0 37.0 4 36.3395 37.0 37.0 37.0 37.0 37.0 5 36.321 37.0 37.0 37.0 37.0 37.0 6 36.3755 37.0 37.0 37.0 37.0 37.0 7 36.3315 37.0 37.0 37.0 37.0 37.0 8 36.0645 37.0 37.0 37.0 37.0 37.0 9 35.887 37.0 37.0 37.0 37.0 37.0 10-14 36.3255 37.0 37.0 37.0 37.0 37.0 15-19 36.108999999999995 37.0 37.0 37.0 37.0 37.0 20-24 36.063 37.0 37.0 37.0 37.0 37.0 25-29 36.1046 37.0 37.0 37.0 37.0 37.0 30-34 36.233799999999995 37.0 37.0 37.0 37.0 37.0 35-39 36.2781 37.0 37.0 37.0 37.0 37.0 40-44 36.0826 37.0 37.0 37.0 37.0 37.0 45-49 36.09499999999999 37.0 37.0 37.0 37.0 37.0 50-54 36.1673 37.0 37.0 37.0 37.0 37.0 55-59 35.9948 37.0 37.0 37.0 34.6 37.0 60-64 36.2139 37.0 37.0 37.0 37.0 37.0 65-69 35.868300000000005 37.0 37.0 37.0 34.6 37.0 70-74 35.9453 37.0 37.0 37.0 37.0 37.0 75-79 35.6374 37.0 37.0 37.0 34.6 37.0 80-84 35.9513 37.0 37.0 37.0 34.6 37.0 85-89 35.968399999999995 37.0 37.0 37.0 37.0 37.0 90-94 35.836093270046305 37.0 37.0 37.0 37.0 37.0 95-99 35.751599137848174 37.0 37.0 37.0 34.6 37.0 100-104 35.93374181831474 37.0 37.0 37.0 37.0 37.0 105-109 35.60599112192851 37.0 37.0 37.0 34.6 37.0 110-114 35.67197133900693 37.0 37.0 37.0 37.0 37.0 115-119 36.00037226829513 37.0 37.0 37.0 37.0 37.0 120-124 35.87516411630394 37.0 37.0 37.0 37.0 37.0 125-129 35.53729544968204 37.0 37.0 37.0 34.6 37.0 130-134 35.62933038184836 37.0 37.0 37.0 37.0 37.0 135-139 35.76546762589928 37.0 37.0 37.0 37.0 37.0 140-141 35.44355285002767 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 0.0 15 0.0 16 1.0 17 0.0 18 0.0 19 1.0 20 1.0 21 0.0 22 2.0 23 3.0 24 2.0 25 2.0 26 3.0 27 10.0 28 6.0 29 18.0 30 19.0 31 41.0 32 61.0 33 99.0 34 189.0 35 680.0 36 2681.0 37 180.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 21.65 26.85 32.45 19.05 2 21.275 26.974999999999998 31.6 20.150000000000002 3 26.174999999999997 34.849999999999994 20.724999999999998 18.25 4 22.85 38.6 22.225 16.325 5 19.725 36.475 25.724999999999998 18.075 6 22.3 21.2 36.825 19.675 7 19.825 23.425 29.9 26.85 8 20.599999999999998 25.8 28.825 24.775 9 23.95 33.375 23.875 18.8 10-14 24.404999999999998 27.05 26.35 22.195 15-19 24.175 27.905 27.205000000000002 20.715 20-24 23.835 27.91 27.04 21.215 25-29 23.195 28.71 27.21 20.885 30-34 24.240000000000002 27.79 26.46 21.51 35-39 23.415 27.639999999999997 27.68 21.265 40-44 23.14 26.88 28.389999999999997 21.59 45-49 23.974999999999998 27.634999999999998 26.875 21.515 50-54 24.43 27.55 27.474999999999998 20.544999999999998 55-59 23.11 27.694999999999997 27.860000000000003 21.335 60-64 24.325 28.044999999999998 26.015 21.615000000000002 65-69 23.86 27.505000000000003 27.534999999999997 21.099999999999998 70-74 23.49 27.625 27.785 21.099999999999998 75-79 23.65 27.97 27.375 21.005 80-84 23.68 27.32 27.77 21.23 85-89 23.98 27.805000000000003 27.05 21.165 90-94 24.25485097019404 26.59531906381276 27.60552110422084 21.544308861772354 95-99 24.33124215809285 26.7603513174404 27.924717691342533 20.983688833124216 100-104 23.05286521388216 27.370863599677158 28.2183212267958 21.357949959644877 105-109 23.614715310639596 28.26540477280822 27.293542970538848 20.82633694601333 110-114 23.685430293042177 26.90425915434928 27.790080856980996 21.620229695627543 115-119 23.19082377476538 27.742440041710115 26.960375391032326 22.10636079249218 120-124 24.079787234042556 28.46808510638298 26.622340425531917 20.829787234042556 125-129 23.863387978142075 28.78142076502732 26.7103825136612 20.6448087431694 130-134 23.480907581627005 28.727172108467077 27.459878251245158 20.33204205866076 135-139 24.299944659656887 28.162700608743773 26.458218040951852 21.07913669064748 140-141 24.280575539568343 28.66629773104593 26.45268400664084 20.60044272274488 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 0.0 25 0.5 26 2.0 27 5.0 28 7.0 29 10.5 30 13.0 31 15.0 32 20.5 33 25.0 34 35.0 35 51.0 36 73.0 37 96.5 38 117.5 39 151.0 40 190.0 41 211.0 42 223.0 43 255.5 44 274.5 45 271.0 46 278.0 47 277.5 48 252.0 49 217.0 50 184.5 51 154.0 52 129.0 53 103.0 54 85.5 55 68.5 56 53.0 57 44.5 58 30.5 59 23.0 60 20.0 61 12.0 62 6.0 63 3.5 64 2.0 65 1.5 66 1.0 67 0.5 68 0.5 69 1.5 70 1.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-141 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 92-93 3.0 94-95 7.0 96-97 11.0 98-99 5.0 100-101 9.0 102-103 12.0 104-105 11.0 106-107 20.0 108-109 23.0 110-111 13.0 112-113 23.0 114-115 14.0 116-117 28.0 118-119 25.0 120-121 34.0 122-123 41.0 124-125 41.0 126-127 38.0 128-129 28.0 130-131 0.0 132-133 0.0 134-135 0.0 136-137 0.0 138-139 0.0 140-141 3614.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 88.275 #Duplication Level Percentage of deduplicated Percentage of total 1 88.21863494760692 77.875 2 10.39365618804871 18.35 3 1.274426508071368 3.375 4 0.11328235627301048 0.4 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGGCTGT 10 0.009203441 131.2375 9 TGCCAAT 15 0.0027713943 65.61875 40-41 >>END_MODULE Read 1615794 spots for SRR17200372.sra Written 1615794 spots for SRR17200372.sra Read 1615794 spots for SRR17200372.sra Written 1615794 spots for SRR17200372.sra Read 1615794 spots for SRR17200372.sra Written 1615794 spots for SRR17200372.sra Read 1615794 spots for SRR17200372.sra Written 1615794 spots for SRR17200372.sra Read 1615794 spots for SRR17200372.sra Written 1615794 spots for SRR17200372.sra Read 1615794 spots for SRR17200372.sra Written 1615794 spots for SRR17200372.sra Read 1615794 spots for SRR17200372.sra Written 1615794 spots for SRR17200372.sra Read 1615794 spots for SRR17200372.sra Written 1615794 spots for SRR17200372.sra Read 1615794 spots for SRR17200372.sra Written 1615794 spots for SRR17200372.sra Read 1615794 spots for SRR17200372.sra Written 1615794 spots for SRR17200372.sra Read 1615794 spots for SRR17200372.sra Written 1615794 spots for SRR17200372.sra Read 1615794 spots for SRR17200372.sra Written 1615794 spots for SRR17200372.sra Read 1615800 spots for SRR17200372.sra Written 1615800 spots for SRR17200372.sra Read 1615794 spots for SRR17200372.sra Written 1615794 spots for SRR17200372.sra Read 1615794 spots for SRR17200372.sra Written 1615794 spots for SRR17200372.sra Read 1615794 spots for SRR17200372.sra Written 1615794 spots for SRR17200372.sra Read 1615794 spots for SRR17200372.sra Written 1615794 spots for SRR17200372.sra Read 1615794 spots for SRR17200372.sra Written 1615794 spots for SRR17200372.sra Read 1615794 spots for SRR17200372.sra Written 1615794 spots for SRR17200372.sra Read 1615794 spots for SRR17200372.sra Written 1615794 spots for SRR17200372.sra SRR ids: ['SRR17200372.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_g6hbbhmp SRR17200372.sra spots: 32315886 blocks: [[1, 1615794], [1615795, 3231588], [3231589, 4847382], [4847383, 6463176], [6463177, 8078970], [8078971, 9694764], [9694765, 11310558], [11310559, 12926352], [12926353, 14542146], [14542147, 16157940], [16157941, 17773734], [17773735, 19389528], [19389529, 21005322], [21005323, 22621116], [22621117, 24236910], [24236911, 25852704], [25852705, 27468498], [27468499, 29084292], [29084293, 30700086], [30700087, 32315886]] SRR17200372 file size 10178320 SRR17200372 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR17200372 SRR17200372_1.fastq SRR17200372_2.fastq Input file: SRR17200372_1.fastq Paired file: SRR17200372_2.fastq trimmed: SRR17200372-trimmed-pair1.fastq, SRR17200372-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 05:44:18 2025 >> started Wed Feb 12 05:44:59 2025 >> done (40.263s) 32315886 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 0 ( 0.00%) empty read pairs filtered out after trimming by size control 32315886 (100.00%) read pairs available; of these: 111735 ( 0.35%) trimmed read pairs available after processing 32204151 (99.65%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 89 340 0.00% 90 405 0.00% 91 456 0.00% 92 16362 0.05% 93 18090 0.06% 94 20866 0.06% 95 22596 0.07% 96 25241 0.08% 97 27379 0.08% 98 29928 0.09% 99 32095 0.10% 100 35627 0.11% 101 39141 0.12% 102 42881 0.13% 103 47891 0.15% 104 51962 0.16% 105 55486 0.17% 106 59954 0.19% 107 62803 0.19% 108 66825 0.21% 109 71148 0.22% 110 76456 0.24% 111 80261 0.25% 112 87542 0.27% 113 92705 0.29% 114 98238 0.30% 115 105150 0.33% 116 110850 0.34% 117 114713 0.35% 118 121869 0.38% 119 123357 0.38% 120 127174 0.39% 121 134210 0.42% 122 138334 0.43% 123 147936 0.46% 124 154404 0.48% 125 160638 0.50% 126 160010 0.50% 127 169304 0.52% 128 170215 0.53% 129 1893 0.01% 130 2619 0.01% 131 2759 0.01% 132 7766 0.02% 133 9793 0.03% 134 35023 0.11% 135 0 0.00% 136 543 0.00% 137 1181 0.00% 138 5284 0.02% 139 8114 0.03% 140 28156 0.09% 141 29111913 90.09% 32315886 reads passed initial QC criterion=sequence-density sequence-density=1.00 sequence-density-rank=1 fanout-score=2.05 fanout-score-rank=19 prefix-density=1.02 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.02 sequence-density-rank=23 fanout-score=59.56 fanout-score-rank=1 prefix-density=0.67 prefix-fanout=1.8 sequence=TGAATGGTGCACATTACGGGTCCATGGCACAAAATCAGAGGATAACAATATCCATTCAAGACTATGCAACAATATAATTTGATTATCCTTAGAAAGTGCTTCTCCTTACACACCCACAAGCCTAGAAAAGGAATTAGAATTTGTAAGTGCAGCTTCCATCATCACTCCTTGCAGTTGGATCAAAGTTTGCTGCATTTGGATCAGTACAGCCTTCAGCGACAGGCACCTTTACTTGCTGTGCCGCTTGGCC criterion=sequence-density sequence-density=0.81 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=24 prefix-density=0.80 prefix-fanout=2.0 sequence=TACCTTCTTCGC criterion=fanout-score sequence-density=0.02 sequence-density-rank=25 fanout-score=25.65 fanout-score-rank=1 prefix-density=0.16 prefix-fanout=3.7 sequence=CTGCATTTGCTAGCTAGAAGTCACTCTACCCTTCGCATTACTTCCTCAATCAACCACTGCTGTTTGATCATGGCAGCAACCATCTCAACCGTTGGAGCTGTCAACACAGCACCGCTGGCTTTGAATGGCTCTGGCGCTGGATCCACAGTCCCAAATTCAGCTTTCTTTGGCAACAGCTTGAAGAAAGTGAGCTCATCAAGGTTCACAAACTCCAAAATTTCACCAGGGAGCTTCAAGGTTGTTGCAGAGTACGATGAGAAGAAGCAGACCGACAAGGACAGATGGGGAGGCCTTGTTACAGACATGTCTGATGACCAACAAGATATCAGCAGAGGAAAGGGTATGGTGGACTCTCTTTTCCAAGCCCCCCAGGGAACTGGAACTCACAACCCCGTTTTGAATTCTTATGAGTATCTCAGTCAAGGTCTTCGTACGTACAACTTGGACAACAACATGGATGGTTTCTACATTGCTCCTGCTTTCATGGACAAGCTTGTTGTTCACATCTCCA SRR17200372 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 05:45:35 Started mapping on | Feb 12 05:45:35 Finished on | Feb 12 05:47:27 Mapping speed, Million of reads per hour | 1038.72 Number of input reads | 32315886 Average input read length | 277 UNIQUE READS: Uniquely mapped reads number | 25330096 Uniquely mapped reads % | 78.38% Average mapped length | 279.06 Number of splices: Total | 22879214 Number of splices: Annotated (sjdb) | 22543874 Number of splices: GT/AG | 22410079 Number of splices: GC/AG | 407198 Number of splices: AT/AC | 14384 Number of splices: Non-canonical | 47553 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.01% Deletion average length | 2.04 Insertion rate per base | 0.01% Insertion average length | 2.31 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 754243 % of reads mapped to multiple loci | 2.33% Number of reads mapped to too many loci | 196728 % of reads mapped to too many loci | 0.61% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 18.59% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 6231547 6231547 6231547 N_multimapping 754243 754243 754243 N_noFeature 865626 25091387 924079 N_ambiguous 479546 1960 298013 UnstrandedReadsAssigned:23984924 PositiveStrandReadsAssigned:236749 NegativeStrandReadsAssigned:24108004 Dataset is classified negative stranded MeadianReadLen=141 20thPercentileLength=141 echo kmer=137 SRR17200372 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR17200372-trimmed-pair1.fastq SRR17200372-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 32,315,886 reads, 29,639,544 reads pseudoaligned [quant] estimated average fragment length: 182.927 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,131 rounds 52401 SRR17200372.ke.tsv 34699 SRR17200372.se.tsv 87100 total ==> SRR17200372.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1836.07 518 10.191 Potri.005G024800.1.v4.1 1035 853.073 140 5.92812 Potri.004G059700.1.v4.1 961 779.079 45 2.08644 Potri.007G009000.2.v4.1 1416 1234.07 9 0.263437 Potri.003G141000.2.v4.1 2943 2761.07 684 8.94857 Potri.016G087400.1.v4.1 270 101.316 991 353.321 Potri.015G069301.1.v4.1 564 382.168 0 0 Potri.010G195200.1.v4.1 1773 1591.07 0 0 Potri.012G127500.1.v4.1 977 795.073 698 31.712 ==> SRR17200372.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 81 Potri.001G233950.v4.1 5 Potri.001G122700.v4.1 355 Potri.001G212900.v4.1 34 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 291 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR17200372 completed mapping pipeline successfully