Starting /dee2/code/volunteer_pipeline.sh SRR17200373 current disk space = 3048986435584 free memory = 1482982320 SRR17200373 SRAfilesize 131ca7ffbfd630ba7419abc2e63d3104 SRR17200373.sra SRR17200373.sra file validated SRR17200373 is paired end SRR17200373 is conventional basespace SRR17200373 read1 length is 92-141 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR17200373_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 92-141 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.4825 37.0 37.0 37.0 37.0 37.0 2 36.5535 37.0 37.0 37.0 37.0 37.0 3 36.5355 37.0 37.0 37.0 37.0 37.0 4 36.546 37.0 37.0 37.0 37.0 37.0 5 36.4515 37.0 37.0 37.0 37.0 37.0 6 36.485 37.0 37.0 37.0 37.0 37.0 7 35.873 37.0 37.0 37.0 37.0 37.0 8 36.4345 37.0 37.0 37.0 37.0 37.0 9 36.5725 37.0 37.0 37.0 37.0 37.0 10-14 36.477700000000006 37.0 37.0 37.0 37.0 37.0 15-19 36.4753 37.0 37.0 37.0 37.0 37.0 20-24 36.4582 37.0 37.0 37.0 37.0 37.0 25-29 36.3722 37.0 37.0 37.0 37.0 37.0 30-34 36.271 37.0 37.0 37.0 37.0 37.0 35-39 36.3553 37.0 37.0 37.0 37.0 37.0 40-44 36.4234 37.0 37.0 37.0 37.0 37.0 45-49 36.336 37.0 37.0 37.0 37.0 37.0 50-54 36.298199999999994 37.0 37.0 37.0 37.0 37.0 55-59 36.405899999999995 37.0 37.0 37.0 37.0 37.0 60-64 36.343399999999995 37.0 37.0 37.0 37.0 37.0 65-69 36.2886 37.0 37.0 37.0 37.0 37.0 70-74 36.148999999999994 37.0 37.0 37.0 37.0 37.0 75-79 36.0564 37.0 37.0 37.0 37.0 37.0 80-84 36.3089 37.0 37.0 37.0 37.0 37.0 85-89 36.2595 37.0 37.0 37.0 37.0 37.0 90-94 35.95713618607354 37.0 37.0 37.0 37.0 37.0 95-99 36.24918328788927 37.0 37.0 37.0 37.0 37.0 100-104 36.210123907180325 37.0 37.0 37.0 37.0 37.0 105-109 36.223997547742314 37.0 37.0 37.0 37.0 37.0 110-114 36.12792670431776 37.0 37.0 37.0 37.0 37.0 115-119 36.001805317054455 37.0 37.0 37.0 37.0 37.0 120-124 36.08326403643515 37.0 37.0 37.0 37.0 37.0 125-129 35.99144678246913 37.0 37.0 37.0 37.0 37.0 130-134 35.90860335195531 37.0 37.0 37.0 37.0 37.0 135-139 36.04234636871509 37.0 37.0 37.0 37.0 37.0 140-141 35.913128491620114 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 2.0 25 1.0 26 3.0 27 7.0 28 12.0 29 22.0 30 26.0 31 32.0 32 47.0 33 53.0 34 119.0 35 363.0 36 2954.0 37 359.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 19.5 11.425 40.6 28.475 2 17.575 16.2 26.674999999999997 39.550000000000004 3 24.075 23.525 23.674999999999997 28.725 4 22.975 29.275000000000002 25.275 22.475 5 17.75 32.25 26.875 23.125 6 14.45 25.275 43.175000000000004 17.1 7 16.950000000000003 22.275 36.55 24.224999999999998 8 16.75 23.175 35.825 24.25 9 17.25 35.025 27.500000000000004 20.225 10-14 21.305 26.540000000000003 27.534999999999997 24.62 15-19 20.525 28.08 27.575 23.82 20-24 20.59 27.810000000000002 27.42 24.18 25-29 20.66 28.065 27.46 23.815 30-34 20.405 27.71 27.915 23.97 35-39 21.065 27.175 27.51 24.25 40-44 20.525 27.68 27.450000000000003 24.345 45-49 21.015 28.22 27.52 23.244999999999997 50-54 21.04 27.29 27.505000000000003 24.165 55-59 20.735 27.965 27.42 23.880000000000003 60-64 20.575 28.03 27.215 24.18 65-69 20.625 28.01 26.96 24.404999999999998 70-74 20.815 27.6 27.27 24.315 75-79 20.974999999999998 28.17 27.255000000000003 23.599999999999998 80-84 20.805 28.025 26.93 24.240000000000002 85-89 21.295 27.224999999999998 27.415 24.065 90-94 21.43035758939735 27.396849212303074 27.47186796699175 23.700925231307828 95-99 20.7640945830614 27.636929564737184 27.38591294743712 24.213062904764296 100-104 21.075507934903467 27.90356817952087 27.797432528050138 23.22349135752552 105-109 21.283542495663706 27.58902152841547 27.104377104377104 24.02305887154372 110-114 21.47689129873483 27.487735605473794 27.11076684740511 23.92460624838626 115-119 21.055118110236222 27.443569553805773 27.853018372703414 23.648293963254595 120-124 20.52713511192227 27.870524451124588 27.47329432605078 24.129046110902355 125-129 20.508866615265998 28.312589492234828 27.2496971032052 23.928846789293974 130-134 20.6536312849162 26.70391061452514 28.16201117318436 24.480446927374302 135-139 21.720670391061454 27.70391061452514 26.759776536312852 23.81564245810056 140-141 21.689944134078214 27.346368715083795 27.68156424581006 23.282122905027933 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 0.0 23 0.0 24 1.5 25 3.0 26 4.5 27 8.5 28 13.0 29 14.5 30 17.5 31 23.5 32 27.5 33 35.5 34 41.0 35 59.0 36 96.5 37 111.0 38 111.5 39 139.0 40 169.5 41 199.5 42 237.5 43 249.5 44 243.5 45 246.0 46 267.5 47 255.0 48 230.0 49 219.0 50 186.0 51 148.0 52 113.0 53 101.5 54 99.5 55 83.0 56 55.5 57 38.5 58 32.0 59 32.5 60 33.0 61 22.5 62 12.5 63 5.5 64 4.0 65 4.0 66 2.0 67 0.0 68 0.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-141 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 92-93 4.0 94-95 6.0 96-97 12.0 98-99 9.0 100-101 13.0 102-103 9.0 104-105 17.0 106-107 19.0 108-109 13.0 110-111 23.0 112-113 28.0 114-115 18.0 116-117 37.0 118-119 25.0 120-121 43.0 122-123 40.0 124-125 29.0 126-127 39.0 128-129 36.0 130-131 0.0 132-133 0.0 134-135 0.0 136-137 0.0 138-139 0.0 140-141 3580.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 86.825 #Duplication Level Percentage of deduplicated Percentage of total 1 87.01410883961994 75.55 2 11.114310394471637 19.3 3 1.61243881370573 4.2 4 0.20155485171321624 0.7000000000000001 5 0.05758710048949035 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CGCCCATCATAGGTGTTCAGATAGGGAATTCCTTTCTGCCCAAACTGAAT 5 0.125 No Hit CCATCTCCTCCTGAAGCTTCCTGGCAAGATCCTCATGGCTATGAAATGCT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAGGGGG 10 0.008923652 132.6 9 CCTTTTA 10 0.008923652 132.6 1 CAAGGGG 10 0.008923652 132.6 8 TCCAAGG 10 0.008923652 132.6 6 CCAAGGG 10 0.008923652 132.6 7 GACCCAC 15 0.0026602047 66.299995 52-53 >>END_MODULE SRR17200373 read2 length is 92-141 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR17200373_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 92-141 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.0445 37.0 37.0 37.0 37.0 37.0 2 36.4035 37.0 37.0 37.0 37.0 37.0 3 36.526 37.0 37.0 37.0 37.0 37.0 4 36.3205 37.0 37.0 37.0 37.0 37.0 5 36.358 37.0 37.0 37.0 37.0 37.0 6 36.3585 37.0 37.0 37.0 37.0 37.0 7 36.3405 37.0 37.0 37.0 37.0 37.0 8 36.285 37.0 37.0 37.0 37.0 37.0 9 36.12 37.0 37.0 37.0 37.0 37.0 10-14 36.374 37.0 37.0 37.0 37.0 37.0 15-19 36.1899 37.0 37.0 37.0 37.0 37.0 20-24 36.058 37.0 37.0 37.0 37.0 37.0 25-29 36.163799999999995 37.0 37.0 37.0 37.0 37.0 30-34 36.2353 37.0 37.0 37.0 37.0 37.0 35-39 36.2992 37.0 37.0 37.0 37.0 37.0 40-44 36.065799999999996 37.0 37.0 37.0 37.0 37.0 45-49 36.0984 37.0 37.0 37.0 37.0 37.0 50-54 36.2153 37.0 37.0 37.0 37.0 37.0 55-59 36.0334 37.0 37.0 37.0 34.6 37.0 60-64 36.2241 37.0 37.0 37.0 37.0 37.0 65-69 35.996500000000005 37.0 37.0 37.0 37.0 37.0 70-74 36.017399999999995 37.0 37.0 37.0 37.0 37.0 75-79 35.738499999999995 37.0 37.0 37.0 34.6 37.0 80-84 36.0313 37.0 37.0 37.0 37.0 37.0 85-89 36.0024 37.0 37.0 37.0 37.0 37.0 90-94 35.949341776510195 37.0 37.0 37.0 37.0 37.0 95-99 35.84312837892753 37.0 37.0 37.0 37.0 37.0 100-104 36.03777932907188 37.0 37.0 37.0 37.0 37.0 105-109 35.75845014383117 37.0 37.0 37.0 34.6 37.0 110-114 35.77079551794746 37.0 37.0 37.0 37.0 37.0 115-119 35.94550598747416 37.0 37.0 37.0 37.0 37.0 120-124 35.884436993479014 37.0 37.0 37.0 37.0 37.0 125-129 35.733058563617746 37.0 37.0 37.0 34.6 37.0 130-134 35.741340782122904 37.0 37.0 37.0 37.0 37.0 135-139 35.86201117318435 37.0 37.0 37.0 37.0 37.0 140-141 35.65614525139665 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 1.0 23 0.0 24 3.0 25 6.0 26 10.0 27 5.0 28 7.0 29 16.0 30 26.0 31 31.0 32 50.0 33 91.0 34 182.0 35 594.0 36 2729.0 37 247.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 21.8 24.625 34.599999999999994 18.975 2 19.575 27.825 32.300000000000004 20.3 3 26.55 33.0 21.325 19.125 4 24.925 37.925 21.375 15.775 5 19.625 37.824999999999996 24.875 17.675 6 22.675 20.25 35.75 21.325 7 19.45 23.375 30.775000000000002 26.400000000000002 8 23.325000000000003 24.6 28.225 23.849999999999998 9 24.625 33.475 23.875 18.025 10-14 24.16 27.505000000000003 26.529999999999998 21.805 15-19 23.765 28.235 26.895000000000003 21.105 20-24 23.745 28.43 26.840000000000003 20.985 25-29 24.099999999999998 28.435 26.655 20.810000000000002 30-34 24.065 28.810000000000002 26.165 20.96 35-39 24.14 27.93 27.015 20.915 40-44 24.060000000000002 27.700000000000003 27.72 20.52 45-49 23.64 27.715 27.3 21.345 50-54 23.965 27.445000000000004 27.505000000000003 21.085 55-59 24.27 26.96 27.474999999999998 21.295 60-64 23.75 27.455000000000002 27.13 21.665 65-69 23.885 27.834999999999997 26.8 21.48 70-74 23.555 28.165000000000003 27.279999999999998 21.0 75-79 24.32 27.355 26.83 21.495 80-84 23.94 27.650000000000002 27.465 20.945 85-89 23.885 27.229999999999997 27.57 21.315 90-94 24.956239059764943 27.461865466366593 26.5666416604151 21.015253813453363 95-99 24.13879682635332 27.52335040674902 27.176860500150646 21.160992266747012 100-104 23.578181082857288 27.6730195642283 27.34442141448865 21.40437793842576 105-109 23.610756748481908 28.427820584783387 27.192937694545083 20.768484972189622 110-114 23.85330578512397 27.24173553719008 28.40909090909091 20.49586776859504 115-119 23.94499265169011 27.17824900272937 27.524669326055008 21.352089019525508 120-124 23.924009874423096 28.20650423956209 26.886336803692174 20.983149082322637 125-129 24.28949107732981 27.968715576118086 27.131526768010577 20.610266578541527 130-134 24.011173184357542 28.430167597765365 26.860335195530727 20.698324022346366 135-139 23.743016759776538 28.569832402234635 25.98324022346369 21.70391061452514 140-141 23.268156424581004 28.687150837988828 26.662011173184357 21.382681564245807 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 0.5 23 0.5 24 1.0 25 2.0 26 2.0 27 4.5 28 9.0 29 13.5 30 15.0 31 14.5 32 19.5 33 31.0 34 45.0 35 55.5 36 70.5 37 92.5 38 118.0 39 142.5 40 173.5 41 221.5 42 248.5 43 255.0 44 253.0 45 243.5 46 263.5 47 265.5 48 233.5 49 221.5 50 194.5 51 150.0 52 122.5 53 106.0 54 105.5 55 79.5 56 50.5 57 41.0 58 33.5 59 33.5 60 23.0 61 14.5 62 12.5 63 7.5 64 2.0 65 3.0 66 2.0 67 0.0 68 0.0 69 0.0 70 1.0 71 1.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-141 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 92-93 4.0 94-95 7.0 96-97 12.0 98-99 9.0 100-101 13.0 102-103 9.0 104-105 17.0 106-107 19.0 108-109 13.0 110-111 23.0 112-113 28.0 114-115 18.0 116-117 34.0 118-119 26.0 120-121 43.0 122-123 40.0 124-125 31.0 126-127 39.0 128-129 35.0 130-131 0.0 132-133 0.0 134-135 0.0 136-137 0.0 138-139 0.0 140-141 3580.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 87.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 87.52146536920435 76.44999999999999 2 10.70406410990269 18.7 3 1.5741270749856897 4.125 4 0.17172295363480253 0.6 5 0.028620492272467084 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AAGAATTGCTCTTACTGCTGATGAGAATGCTCAGCCGGTTAGAGTTTGTG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGCTACT 10 0.008923652 132.6 1 GGCAGAT 10 0.008923652 132.6 9 AGAGCAC 15 0.0026602047 66.299995 60-61 >>END_MODULE Read 1324108 spots for SRR17200373.sra Written 1324108 spots for SRR17200373.sra Read 1324108 spots for SRR17200373.sra Written 1324108 spots for SRR17200373.sra Read 1324108 spots for SRR17200373.sra Written 1324108 spots for SRR17200373.sra Read 1324108 spots for SRR17200373.sra Written 1324108 spots for SRR17200373.sra Read 1324108 spots for SRR17200373.sra Written 1324108 spots for SRR17200373.sra Read 1324108 spots for SRR17200373.sra Written 1324108 spots for SRR17200373.sra Read 1324108 spots for SRR17200373.sra Written 1324108 spots for SRR17200373.sra Read 1324108 spots for SRR17200373.sra Written 1324108 spots for SRR17200373.sra Read 1324118 spots for SRR17200373.sra Written 1324118 spots for SRR17200373.sra Read 1324108 spots for SRR17200373.sra Written 1324108 spots for SRR17200373.sra Read 1324108 spots for SRR17200373.sra Written 1324108 spots for SRR17200373.sra Read 1324108 spots for SRR17200373.sra Written 1324108 spots for SRR17200373.sra Read 1324108 spots for SRR17200373.sra Written 1324108 spots for SRR17200373.sra Read 1324108 spots for SRR17200373.sra Written 1324108 spots for SRR17200373.sra Read 1324108 spots for SRR17200373.sra Written 1324108 spots for SRR17200373.sra Read 1324108 spots for SRR17200373.sra Written 1324108 spots for SRR17200373.sra Read 1324108 spots for SRR17200373.sra Written 1324108 spots for SRR17200373.sra Read 1324108 spots for SRR17200373.sra Written 1324108 spots for SRR17200373.sra Read 1324108 spots for SRR17200373.sra Written 1324108 spots for SRR17200373.sra Read 1324108 spots for SRR17200373.sra Written 1324108 spots for SRR17200373.sra SRR ids: ['SRR17200373.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_anzrgw5d SRR17200373.sra spots: 26482170 blocks: [[1, 1324108], [1324109, 2648216], [2648217, 3972324], [3972325, 5296432], [5296433, 6620540], [6620541, 7944648], [7944649, 9268756], [9268757, 10592864], [10592865, 11916972], [11916973, 13241080], [13241081, 14565188], [14565189, 15889296], [15889297, 17213404], [17213405, 18537512], [18537513, 19861620], [19861621, 21185728], [21185729, 22509836], [22509837, 23833944], [23833945, 25158052], [25158053, 26482170]] SRR17200373 file size 8327693 SRR17200373 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR17200373 SRR17200373_1.fastq SRR17200373_2.fastq Input file: SRR17200373_1.fastq Paired file: SRR17200373_2.fastq trimmed: SRR17200373-trimmed-pair1.fastq, SRR17200373-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 05:16:45 2025 >> started Wed Feb 12 05:17:13 2025 >> done (27.427s) 26482170 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 0 ( 0.00%) empty read pairs filtered out after trimming by size control 26482170 (100.00%) read pairs available; of these: 89623 ( 0.34%) trimmed read pairs available after processing 26392547 (99.66%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 89 282 0.00% 90 330 0.00% 91 413 0.00% 92 14247 0.05% 93 15951 0.06% 94 18475 0.07% 95 20440 0.08% 96 22433 0.08% 97 24127 0.09% 98 26310 0.10% 99 28523 0.11% 100 31719 0.12% 101 34886 0.13% 102 38038 0.14% 103 42158 0.16% 104 45598 0.17% 105 48903 0.18% 106 53145 0.20% 107 56149 0.21% 108 59166 0.22% 109 62562 0.24% 110 67253 0.25% 111 71518 0.27% 112 77453 0.29% 113 82448 0.31% 114 86198 0.33% 115 92608 0.35% 116 97568 0.37% 117 100887 0.38% 118 105785 0.40% 119 108098 0.41% 120 111295 0.42% 121 117567 0.44% 122 122194 0.46% 123 130207 0.49% 124 135417 0.51% 125 139012 0.52% 126 140948 0.53% 127 146505 0.55% 128 149320 0.56% 129 1591 0.01% 130 2345 0.01% 131 2332 0.01% 132 6362 0.02% 133 8545 0.03% 134 29603 0.11% 135 0 0.00% 136 392 0.00% 137 861 0.00% 138 4135 0.02% 139 6058 0.02% 140 21967 0.08% 141 23671843 89.39% 26482170 reads passed initial QC criterion=sequence-density sequence-density=0.87 sequence-density-rank=1 fanout-score=2.05 fanout-score-rank=20 prefix-density=0.90 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.02 sequence-density-rank=24 fanout-score=63.68 fanout-score-rank=1 prefix-density=0.62 prefix-fanout=1.8 sequence=TGAATGGTGCACATTACGGGTCCATGGCACAAAATCAGAGGATAACAATATCCATTCAAGACTATGCAACAATATAATTTGATTATCCTTAGAAAGTGCTTCTCCTTACACACCCACAAGCCTAGAAAAGGAATTAGAATTTGTAAGTGCAGCTTCCATCATCACTCCTTGCAGTTGGATCAAAGTTTGCTGCATTTGGATCAGTACAGCCTTCAGCGACAGGCACCTTTACTTGCTGTGCCGCTTGGCC criterion=sequence-density sequence-density=0.71 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=22 prefix-density=0.70 prefix-fanout=2.0 sequence=TACCTTCTTCGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=22.88 fanout-score-rank=1 prefix-density=0.03 prefix-fanout=4.9 sequence=AAAACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTGATTTCATCGGCGGCCGTTGCCACAGTTAACCGCACCCCTGCACAGGCCAACATGGTTGCACCATTCAACGGCCTCAAGTCTACCTCAGCTTTCCCGGTCACCAGAAAGGC SRR17200373 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 05:17:51 Started mapping on | Feb 12 05:17:52 Finished on | Feb 12 05:19:33 Mapping speed, Million of reads per hour | 943.92 Number of input reads | 26482170 Average input read length | 276 UNIQUE READS: Uniquely mapped reads number | 19860517 Uniquely mapped reads % | 75.00% Average mapped length | 278.71 Number of splices: Total | 17940611 Number of splices: Annotated (sjdb) | 17669461 Number of splices: GT/AG | 17574333 Number of splices: GC/AG | 317317 Number of splices: AT/AC | 11484 Number of splices: Non-canonical | 37477 Mismatch rate per base, % | 0.22% Deletion rate per base | 0.01% Deletion average length | 2.08 Insertion rate per base | 0.01% Insertion average length | 2.46 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 616779 % of reads mapped to multiple loci | 2.33% Number of reads mapped to too many loci | 507347 % of reads mapped to too many loci | 1.92% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 20.54% % of reads unmapped: other | 0.22% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 6004874 6004874 6004874 N_multimapping 616779 616779 616779 N_noFeature 803751 19668183 850612 N_ambiguous 387607 1729 241044 UnstrandedReadsAssigned:18669159 PositiveStrandReadsAssigned:190605 NegativeStrandReadsAssigned:18768861 Dataset is classified negative stranded MeadianReadLen=141 20thPercentileLength=141 echo kmer=137 SRR17200373 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR17200373-trimmed-pair1.fastq SRR17200373-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 26,482,170 reads, 23,670,931 reads pseudoaligned [quant] estimated average fragment length: 180.832 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,145 rounds 52401 SRR17200373.ke.tsv 34699 SRR17200373.se.tsv 87100 total ==> SRR17200373.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1838.17 365 8.84876 Potri.005G024800.1.v4.1 1035 855.168 204 10.6305 Potri.004G059700.1.v4.1 961 781.175 33 1.88252 Potri.007G009000.2.v4.1 1416 1236.17 6 0.216296 Potri.003G141000.2.v4.1 2943 2763.17 651 10.499 Potri.016G087400.1.v4.1 270 102.916 768 332.548 Potri.015G069301.1.v4.1 564 384.259 0 0 Potri.010G195200.1.v4.1 1773 1593.17 8 0.223771 Potri.012G127500.1.v4.1 977 797.175 694 38.7954 ==> SRR17200373.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 119 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 292 Potri.001G212900.v4.1 3 Potri.001G182400.v4.1 5 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 325 Potri.001G416900.v4.1 4 Potri.001G452600.v4.1 1 SRR17200373 completed mapping pipeline successfully