Starting /dee2/code/volunteer_pipeline.sh SRR17234929 current disk space = 3049120378880 free memory = 1582578656 SRR17234929 SRAfilesize b1ed876162ee91cc27edb1ebdf8375f6 SRR17234929.sra SRR17234929.sra file validated SRR17234929 is paired end SRR17234929 is conventional basespace SRR17234929 read1 length is 92-141 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR17234929_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 92-141 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3875 37.0 37.0 37.0 37.0 37.0 2 36.5925 37.0 37.0 37.0 37.0 37.0 3 36.4365 37.0 37.0 37.0 37.0 37.0 4 36.627 37.0 37.0 37.0 37.0 37.0 5 36.2485 37.0 37.0 37.0 37.0 37.0 6 36.44 37.0 37.0 37.0 37.0 37.0 7 35.885 37.0 37.0 37.0 37.0 37.0 8 36.5405 37.0 37.0 37.0 37.0 37.0 9 36.5305 37.0 37.0 37.0 37.0 37.0 10-14 36.4287 37.0 37.0 37.0 37.0 37.0 15-19 36.4114 37.0 37.0 37.0 37.0 37.0 20-24 36.359700000000004 37.0 37.0 37.0 37.0 37.0 25-29 36.3149 37.0 37.0 37.0 37.0 37.0 30-34 36.2602 37.0 37.0 37.0 37.0 37.0 35-39 36.3268 37.0 37.0 37.0 37.0 37.0 40-44 36.3822 37.0 37.0 37.0 37.0 37.0 45-49 36.3253 37.0 37.0 37.0 37.0 37.0 50-54 36.31099999999999 37.0 37.0 37.0 37.0 37.0 55-59 36.3575 37.0 37.0 37.0 37.0 37.0 60-64 36.282 37.0 37.0 37.0 37.0 37.0 65-69 36.242000000000004 37.0 37.0 37.0 37.0 37.0 70-74 36.016999999999996 37.0 37.0 37.0 37.0 37.0 75-79 35.9846 37.0 37.0 37.0 37.0 37.0 80-84 36.29259999999999 37.0 37.0 37.0 37.0 37.0 85-89 36.259699999999995 37.0 37.0 37.0 37.0 37.0 90-94 35.913209483214615 37.0 37.0 37.0 37.0 37.0 95-99 36.27598389973949 37.0 37.0 37.0 37.0 37.0 100-104 36.135846794523005 37.0 37.0 37.0 37.0 37.0 105-109 36.1043467257446 37.0 37.0 37.0 37.0 37.0 110-114 36.087204082590276 37.0 37.0 37.0 37.0 37.0 115-119 36.002404700732555 37.0 37.0 37.0 37.0 37.0 120-124 36.15420967832971 37.0 37.0 37.0 37.0 37.0 125-129 36.100480193937564 37.0 37.0 37.0 37.0 37.0 130-134 35.910399999999996 37.0 37.0 37.0 37.0 37.0 135-139 36.081714285714284 37.0 37.0 37.0 37.0 37.0 140-141 35.81628571428571 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 3.0 24 3.0 25 3.0 26 5.0 27 7.0 28 9.0 29 21.0 30 27.0 31 33.0 32 56.0 33 62.0 34 124.0 35 347.0 36 2907.0 37 393.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 19.15 11.675 41.725 27.450000000000003 2 18.25 16.6 25.5 39.65 3 23.875 24.7 22.325 29.099999999999998 4 25.55 30.225 23.925 20.3 5 17.474999999999998 32.375 27.975 22.175 6 14.45 26.424999999999997 41.925000000000004 17.2 7 16.35 23.674999999999997 35.975 24.0 8 16.925 21.925 36.575 24.575 9 17.875 37.1 25.174999999999997 19.85 10-14 21.015 27.18 26.974999999999998 24.83 15-19 21.175 27.68 27.915 23.23 20-24 20.765 28.485 27.015 23.735 25-29 20.215 28.865000000000002 27.029999999999998 23.89 30-34 20.845 27.834999999999997 27.04 24.279999999999998 35-39 20.919999999999998 28.13 27.46 23.49 40-44 21.005 28.21 27.52 23.265 45-49 20.31 28.485 27.534999999999997 23.669999999999998 50-54 20.71 27.905 27.884999999999998 23.5 55-59 20.385 28.16 26.724999999999998 24.73 60-64 20.28 27.150000000000002 28.310000000000002 24.26 65-69 20.4 27.884999999999998 27.33 24.385 70-74 20.49 27.395000000000003 28.04 24.075 75-79 20.57 27.92 27.944999999999997 23.565 80-84 21.02 27.495000000000005 27.91 23.575 85-89 21.16 28.110000000000003 27.36 23.369999999999997 90-94 20.896493071189155 27.660213117214465 27.695232377807795 23.748061433788585 95-99 21.127755081454584 27.321329500176528 27.57855449639381 23.972360921975085 100-104 21.049420378279436 28.41671751067724 27.094773235712832 23.439088875330487 105-109 20.750064217826868 27.510917030567683 27.747238633444642 23.9917801181608 110-114 20.638475158837622 27.471096760754087 28.15852515362983 23.73190292677846 115-119 20.801911842804035 27.66861391396707 28.06160382368561 23.46787041954328 120-124 20.687966037119686 28.296957491971913 27.589397485440593 23.42567898546781 125-129 20.586249578035332 27.900303814560594 27.21390795544053 24.29953865196354 130-134 20.405714285714286 28.108571428571427 27.6 23.885714285714286 135-139 21.245714285714286 27.931428571428572 26.371428571428574 24.451428571428572 140-141 20.771428571428572 28.528571428571432 26.91428571428571 23.785714285714285 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 1.0 22 2.5 23 4.0 24 3.0 25 1.5 26 1.5 27 7.5 28 11.0 29 13.0 30 20.5 31 26.5 32 35.5 33 41.5 34 48.5 35 64.0 36 85.5 37 110.5 38 126.0 39 140.5 40 171.5 41 207.5 42 231.0 43 235.0 44 247.0 45 263.5 46 266.0 47 257.0 48 239.5 49 212.0 50 176.0 51 147.0 52 131.0 53 116.0 54 88.5 55 68.0 56 51.0 57 40.0 58 33.0 59 24.5 60 16.0 61 8.0 62 7.5 63 7.0 64 5.0 65 3.0 66 1.0 67 0.0 68 0.5 69 1.5 70 1.0 71 0.5 72 0.5 73 1.0 74 1.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-141 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 92-93 8.0 94-95 17.0 96-97 19.0 98-99 9.0 100-101 14.0 102-103 11.0 104-105 17.0 106-107 23.0 108-109 24.0 110-111 15.0 112-113 26.0 114-115 30.0 116-117 39.0 118-119 32.0 120-121 40.0 122-123 45.0 124-125 51.0 126-127 53.0 128-129 27.0 130-131 0.0 132-133 0.0 134-135 0.0 136-137 0.0 138-139 0.0 140-141 3500.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 87.5 #Duplication Level Percentage of deduplicated Percentage of total 1 87.8 76.825 2 10.342857142857142 18.099999999999998 3 1.685714285714286 4.425 4 0.1142857142857143 0.4 5 0.05714285714285715 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TGAGATCTGGAAGGTAAGAAAGAGTCTCGAACTTCTTCAATCCAGTTGGT 5 0.125 No Hit CCCGATTCAGCATCCGAATCCAGAAGCTAAAAACAAAAACAAAGTAGAAT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR17234929 read2 length is 92-141 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR17234929_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 92-141 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.271 37.0 37.0 37.0 37.0 37.0 2 36.4155 37.0 37.0 37.0 37.0 37.0 3 36.517 37.0 37.0 37.0 37.0 37.0 4 36.3035 37.0 37.0 37.0 37.0 37.0 5 36.3185 37.0 37.0 37.0 37.0 37.0 6 36.3935 37.0 37.0 37.0 37.0 37.0 7 36.2475 37.0 37.0 37.0 37.0 37.0 8 36.186 37.0 37.0 37.0 37.0 37.0 9 35.8255 37.0 37.0 37.0 37.0 37.0 10-14 36.3327 37.0 37.0 37.0 37.0 37.0 15-19 36.161 37.0 37.0 37.0 37.0 37.0 20-24 36.0736 37.0 37.0 37.0 37.0 37.0 25-29 36.168800000000005 37.0 37.0 37.0 37.0 37.0 30-34 36.2371 37.0 37.0 37.0 37.0 37.0 35-39 36.2718 37.0 37.0 37.0 37.0 37.0 40-44 36.065099999999994 37.0 37.0 37.0 37.0 37.0 45-49 36.0866 37.0 37.0 37.0 37.0 37.0 50-54 36.2007 37.0 37.0 37.0 37.0 37.0 55-59 36.00320000000001 37.0 37.0 37.0 34.6 37.0 60-64 36.2436 37.0 37.0 37.0 37.0 37.0 65-69 35.9655 37.0 37.0 37.0 37.0 37.0 70-74 35.914300000000004 37.0 37.0 37.0 37.0 37.0 75-79 35.6447 37.0 37.0 37.0 34.6 37.0 80-84 35.909299999999995 37.0 37.0 37.0 34.6 37.0 85-89 35.9272 37.0 37.0 37.0 37.0 37.0 90-94 35.934288877730445 37.0 37.0 37.0 37.0 37.0 95-99 35.65719771650705 37.0 37.0 37.0 34.6 37.0 100-104 35.97738664777112 37.0 37.0 37.0 37.0 37.0 105-109 35.72295883350817 37.0 37.0 37.0 34.6 37.0 110-114 35.70284891882176 37.0 37.0 37.0 37.0 37.0 115-119 35.97959769114209 37.0 37.0 37.0 37.0 37.0 120-124 35.90268024025228 37.0 37.0 37.0 37.0 37.0 125-129 35.647001506144385 37.0 37.0 37.0 34.6 37.0 130-134 35.67406348298542 37.0 37.0 37.0 37.0 37.0 135-139 35.79039176436946 37.0 37.0 37.0 37.0 37.0 140-141 35.49528167000286 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 2.0 22 1.0 23 1.0 24 0.0 25 4.0 26 7.0 27 8.0 28 9.0 29 14.0 30 30.0 31 43.0 32 52.0 33 90.0 34 205.0 35 640.0 36 2661.0 37 232.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 22.625 26.950000000000003 32.625 17.8 2 20.474999999999998 29.525000000000002 29.875 20.125 3 27.200000000000003 33.525 21.825 17.45 4 22.3 39.625 21.625 16.45 5 19.15 36.05 25.900000000000002 18.9 6 21.349999999999998 22.2 36.199999999999996 20.25 7 19.825 24.3 30.175 25.7 8 22.325 24.625 30.3 22.75 9 25.825 32.525 23.175 18.475 10-14 24.185000000000002 26.740000000000002 27.07 22.005 15-19 24.32 28.075 27.810000000000002 19.794999999999998 20-24 24.4 28.425 26.450000000000003 20.724999999999998 25-29 24.135 28.505000000000003 27.12 20.24 30-34 23.785 27.785 27.21 21.22 35-39 23.974999999999998 28.07 27.83 20.125 40-44 23.89 27.845 27.54 20.724999999999998 45-49 23.849999999999998 28.345 26.650000000000002 21.154999999999998 50-54 23.78 28.435 27.060000000000002 20.724999999999998 55-59 24.07 27.375 27.815 20.74 60-64 23.56 27.48 27.615000000000002 21.345 65-69 23.865 27.755000000000003 27.584999999999997 20.794999999999998 70-74 23.369999999999997 28.765 27.115000000000002 20.75 75-79 24.055 27.92 27.060000000000002 20.965 80-84 23.5 27.29 27.589999999999996 21.62 85-89 24.305 27.29 27.575 20.830000000000002 90-94 23.798088948921908 28.105458001901045 26.664665566061334 21.431787483115713 95-99 23.416061339790154 27.925746569814365 27.567594834543986 21.090597255851492 100-104 23.81630473478106 27.24406245232162 27.625489498042004 21.314143314855315 105-109 23.73438865189906 27.774065888883175 27.131623580202497 21.359921879015264 110-114 23.94747811588162 27.511463109629013 27.459358065860773 21.081700708628595 115-119 23.194643711142994 27.992985812211064 27.64227642276423 21.170094053881716 120-124 23.587732200250585 28.425123930925533 27.31383123604075 20.673312632783134 125-129 24.26222122099572 27.62446496958775 27.162649245325525 20.950664564091014 130-134 23.214183585930797 28.344295110094365 27.337718044037747 21.10380325993709 135-139 23.551615670574776 28.670288818987704 26.731484129253648 21.046611381183872 140-141 24.10637689448098 28.23849013440092 26.965970832141835 20.689162138976265 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.5 22 0.5 23 0.0 24 1.5 25 2.5 26 2.0 27 4.0 28 6.5 29 10.5 30 13.0 31 13.0 32 17.5 33 30.0 34 51.0 35 63.5 36 75.5 37 102.5 38 128.5 39 156.0 40 187.0 41 212.5 42 233.5 43 268.5 44 277.0 45 259.0 46 258.5 47 266.0 48 257.0 49 218.0 50 193.0 51 162.5 52 126.0 53 106.5 54 80.0 55 59.5 56 45.5 57 31.0 58 24.5 59 21.5 60 12.5 61 4.0 62 4.5 63 5.0 64 3.0 65 2.0 66 0.5 67 0.5 68 0.5 69 0.0 70 1.0 71 1.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-141 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 92-93 8.0 94-95 17.0 96-97 20.0 98-99 9.0 100-101 14.0 102-103 11.0 104-105 17.0 106-107 24.0 108-109 24.0 110-111 15.0 112-113 26.0 114-115 30.0 116-117 39.0 118-119 33.0 120-121 40.0 122-123 45.0 124-125 52.0 126-127 53.0 128-129 26.0 130-131 0.0 132-133 0.0 134-135 0.0 136-137 0.0 138-139 0.0 140-141 3497.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 88.2 #Duplication Level Percentage of deduplicated Percentage of total 1 88.40702947845806 77.97500000000001 2 10.062358276643991 17.75 3 1.3605442176870748 3.5999999999999996 4 0.1417233560090703 0.5 5 0.0 0.0 6 0.0 0.0 7 0.02834467120181406 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTGATTTCATCG 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1547185 spots for SRR17234929.sra Written 1547185 spots for SRR17234929.sra Read 1547185 spots for SRR17234929.sra Written 1547185 spots for SRR17234929.sra Read 1547185 spots for SRR17234929.sra Written 1547185 spots for SRR17234929.sra Read 1547185 spots for SRR17234929.sra Written 1547185 spots for SRR17234929.sra Read 1547185 spots for SRR17234929.sra Written 1547185 spots for SRR17234929.sra Read 1547185 spots for SRR17234929.sra Written 1547185 spots for SRR17234929.sra Read 1547185 spots for SRR17234929.sra Written 1547185 spots for SRR17234929.sra Read 1547185 spots for SRR17234929.sra Written 1547185 spots for SRR17234929.sra Read 1547185 spots for SRR17234929.sra Written 1547185 spots for SRR17234929.sra Read 1547185 spots for SRR17234929.sra Written 1547185 spots for SRR17234929.sra Read 1547185 spots for SRR17234929.sra Written 1547185 spots for SRR17234929.sra Read 1547185 spots for SRR17234929.sra Written 1547185 spots for SRR17234929.sra Read 1547185 spots for SRR17234929.sra Written 1547185 spots for SRR17234929.sra Read 1547185 spots for SRR17234929.sra Written 1547185 spots for SRR17234929.sra Read 1547185 spots for SRR17234929.sra Written 1547185 spots for SRR17234929.sra Read 1547185 spots for SRR17234929.sra Written 1547185 spots for SRR17234929.sra Read 1547199 spots for SRR17234929.sra Written 1547199 spots for SRR17234929.sra Read 1547185 spots for SRR17234929.sra Written 1547185 spots for SRR17234929.sra Read 1547185 spots for SRR17234929.sra Written 1547185 spots for SRR17234929.sra Read 1547185 spots for SRR17234929.sra Written 1547185 spots for SRR17234929.sra SRR ids: ['SRR17234929.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_jnqia784 SRR17234929.sra spots: 30943714 blocks: [[1, 1547185], [1547186, 3094370], [3094371, 4641555], [4641556, 6188740], [6188741, 7735925], [7735926, 9283110], [9283111, 10830295], [10830296, 12377480], [12377481, 13924665], [13924666, 15471850], [15471851, 17019035], [17019036, 18566220], [18566221, 20113405], [20113406, 21660590], [21660591, 23207775], [23207776, 24754960], [24754961, 26302145], [26302146, 27849330], [27849331, 29396515], [29396516, 30943714]] SRR17234929 file size 9719094 SRR17234929 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR17234929 SRR17234929_1.fastq SRR17234929_2.fastq Input file: SRR17234929_1.fastq Paired file: SRR17234929_2.fastq trimmed: SRR17234929-trimmed-pair1.fastq, SRR17234929-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 04:58:35 2025 >> started Wed Feb 12 04:59:06 2025 >> done (31.432s) 30943714 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 0 ( 0.00%) empty read pairs filtered out after trimming by size control 30943714 (100.00%) read pairs available; of these: 122679 ( 0.40%) trimmed read pairs available after processing 30821035 (99.60%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 89 465 0.00% 90 578 0.00% 91 558 0.00% 92 20076 0.06% 93 22405 0.07% 94 25576 0.08% 95 28721 0.09% 96 30700 0.10% 97 33706 0.11% 98 36416 0.12% 99 39113 0.13% 100 43264 0.14% 101 46072 0.15% 102 51334 0.17% 103 56686 0.18% 104 60715 0.20% 105 64944 0.21% 106 70063 0.23% 107 73205 0.24% 108 76946 0.25% 109 80983 0.26% 110 86840 0.28% 111 91193 0.29% 112 98749 0.32% 113 104768 0.34% 114 110027 0.36% 115 117392 0.38% 116 123330 0.40% 117 126822 0.41% 118 133822 0.43% 119 134837 0.44% 120 138160 0.45% 121 145237 0.47% 122 150463 0.49% 123 160494 0.52% 124 166628 0.54% 125 170526 0.55% 126 171332 0.55% 127 179351 0.58% 128 180727 0.58% 129 2024 0.01% 130 2751 0.01% 131 2716 0.01% 132 7887 0.03% 133 10751 0.03% 134 32823 0.11% 135 0 0.00% 136 535 0.00% 137 1285 0.00% 138 5570 0.02% 139 7997 0.03% 140 29115 0.09% 141 27387036 88.51% 30943714 reads passed initial QC criterion=sequence-density sequence-density=1.11 sequence-density-rank=1 fanout-score=2.04 fanout-score-rank=19 prefix-density=1.14 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=23 fanout-score=79.42 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=6.4 sequence=TCAACAATTCTCGCCCGATTCAGCATCCGAATCCAGAAGCTAAAAACAAAAACAAAGTAGAATGATATTCATCTCCAAAAACCCAATAAAAA criterion=sequence-density sequence-density=0.89 sequence-density-rank=1 fanout-score=2.03 fanout-score-rank=20 prefix-density=0.87 prefix-fanout=2.0 sequence=TACCTTCTTCGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=25 fanout-score=79.97 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=7.3 sequence=CAAAACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTGATTTCATCGGCGGCCGTTGCCACAGTTAACCGCACCCCTGCACAGGCCAACATGGTTGCACCATTCAACGGCCTCAAGTCTACCTCAGCTTTCCCGGTCACCAGAAAGGC SRR17234929 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 04:59:44 Started mapping on | Feb 12 04:59:45 Finished on | Feb 12 05:01:46 Mapping speed, Million of reads per hour | 920.64 Number of input reads | 30943714 Average input read length | 276 UNIQUE READS: Uniquely mapped reads number | 23647981 Uniquely mapped reads % | 76.42% Average mapped length | 278.70 Number of splices: Total | 22048719 Number of splices: Annotated (sjdb) | 21739513 Number of splices: GT/AG | 21602284 Number of splices: GC/AG | 389087 Number of splices: AT/AC | 13001 Number of splices: Non-canonical | 44347 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.02% Deletion average length | 1.93 Insertion rate per base | 0.01% Insertion average length | 2.13 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 704239 % of reads mapped to multiple loci | 2.28% Number of reads mapped to too many loci | 313808 % of reads mapped to too many loci | 1.01% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 20.16% % of reads unmapped: other | 0.13% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 6591494 6591494 6591494 N_multimapping 704239 704239 704239 N_noFeature 569231 23430072 619438 N_ambiguous 467329 1894 298603 UnstrandedReadsAssigned:22611421 PositiveStrandReadsAssigned:216015 NegativeStrandReadsAssigned:22729940 Dataset is classified negative stranded MeadianReadLen=141 20thPercentileLength=141 echo kmer=137 SRR17234929 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR17234929-trimmed-pair1.fastq SRR17234929-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 30,943,714 reads, 28,672,928 reads pseudoaligned [quant] estimated average fragment length: 179.229 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,134 rounds 52401 SRR17234929.ke.tsv 34699 SRR17234929.se.tsv 87100 total ==> SRR17234929.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1839.77 460 9.33887 Potri.005G024800.1.v4.1 1035 856.771 129 5.62374 Potri.004G059700.1.v4.1 961 782.771 37 1.7655 Potri.007G009000.2.v4.1 1416 1237.77 26 0.784573 Potri.003G141000.2.v4.1 2943 2764.77 575.608 7.77622 Potri.016G087400.1.v4.1 270 103.264 1025 370.743 Potri.015G069301.1.v4.1 564 385.879 0 0 Potri.010G195200.1.v4.1 1773 1594.77 5 0.117104 Potri.012G127500.1.v4.1 977 798.771 789 36.8939 ==> SRR17234929.se.tsv <== Potri.001G166300.v4.1 2 Potri.001G448400.v4.1 73 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 235 Potri.001G212900.v4.1 184 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 146 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 3 SRR17234929 completed mapping pipeline successfully