Starting /dee2/code/volunteer_pipeline.sh SRR17234930 current disk space = 3049124864000 free memory = 1515885052 SRR17234930 SRAfilesize 1d6c5d4cb4286c0e822387848b221ab8 SRR17234930.sra SRR17234930.sra file validated SRR17234930 is paired end SRR17234930 is conventional basespace SRR17234930 read1 length is 92-141 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR17234930_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 92-141 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.434 37.0 37.0 37.0 37.0 37.0 2 36.653 37.0 37.0 37.0 37.0 37.0 3 36.435 37.0 37.0 37.0 37.0 37.0 4 36.6845 37.0 37.0 37.0 37.0 37.0 5 36.418 37.0 37.0 37.0 37.0 37.0 6 36.51 37.0 37.0 37.0 37.0 37.0 7 36.0805 37.0 37.0 37.0 37.0 37.0 8 36.4885 37.0 37.0 37.0 37.0 37.0 9 36.5795 37.0 37.0 37.0 37.0 37.0 10-14 36.4142 37.0 37.0 37.0 37.0 37.0 15-19 36.439499999999995 37.0 37.0 37.0 37.0 37.0 20-24 36.4264 37.0 37.0 37.0 37.0 37.0 25-29 36.3768 37.0 37.0 37.0 37.0 37.0 30-34 36.3472 37.0 37.0 37.0 37.0 37.0 35-39 36.423500000000004 37.0 37.0 37.0 37.0 37.0 40-44 36.4527 37.0 37.0 37.0 37.0 37.0 45-49 36.367000000000004 37.0 37.0 37.0 37.0 37.0 50-54 36.3391 37.0 37.0 37.0 37.0 37.0 55-59 36.39 37.0 37.0 37.0 37.0 37.0 60-64 36.324400000000004 37.0 37.0 37.0 37.0 37.0 65-69 36.3391 37.0 37.0 37.0 37.0 37.0 70-74 36.1497 37.0 37.0 37.0 37.0 37.0 75-79 36.089099999999995 37.0 37.0 37.0 37.0 37.0 80-84 36.3817 37.0 37.0 37.0 37.0 37.0 85-89 36.3366 37.0 37.0 37.0 37.0 37.0 90-94 35.93101855108189 37.0 37.0 37.0 37.0 37.0 95-99 36.275925219359394 37.0 37.0 37.0 37.0 37.0 100-104 36.13183455123324 37.0 37.0 37.0 37.0 37.0 105-109 36.09496400291866 37.0 37.0 37.0 37.0 37.0 110-114 36.07840717735626 37.0 37.0 37.0 37.0 37.0 115-119 36.031628153649635 37.0 37.0 37.0 37.0 37.0 120-124 36.14686913650748 37.0 37.0 37.0 37.0 37.0 125-129 36.087735607869504 37.0 37.0 37.0 37.0 37.0 130-134 35.8475138121547 37.0 37.0 37.0 37.0 37.0 135-139 36.05060773480663 37.0 37.0 37.0 37.0 37.0 140-141 35.77016574585635 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 1.0 25 1.0 26 5.0 27 6.0 28 13.0 29 21.0 30 22.0 31 25.0 32 46.0 33 65.0 34 115.0 35 366.0 36 2950.0 37 364.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 18.3 11.25 42.65 27.800000000000004 2 19.425 16.775000000000002 25.174999999999997 38.625 3 23.325000000000003 25.650000000000002 22.900000000000002 28.125 4 24.925 28.499999999999996 25.7 20.875 5 17.299999999999997 32.300000000000004 28.625 21.775 6 14.575 25.525 42.375 17.525 7 16.45 22.675 36.125 24.75 8 18.224999999999998 22.975 35.375 23.425 9 19.15 33.25 27.750000000000004 19.85 10-14 21.355 27.495000000000005 27.415 23.735 15-19 21.12 28.255000000000003 27.615000000000002 23.01 20-24 20.735 27.02 28.744999999999997 23.5 25-29 20.28 28.375 27.55 23.794999999999998 30-34 20.36 27.500000000000004 28.044999999999998 24.095 35-39 20.57 28.549999999999997 27.435 23.445 40-44 20.735 27.415 27.639999999999997 24.21 45-49 21.13 27.605 27.405 23.86 50-54 20.990000000000002 27.589999999999996 27.650000000000002 23.77 55-59 21.245 26.43 28.315 24.01 60-64 20.775 27.500000000000004 27.99 23.735 65-69 20.75 27.565 27.465 24.22 70-74 21.154999999999998 27.465 27.939999999999998 23.44 75-79 21.51 27.22 27.200000000000003 24.07 80-84 21.115000000000002 28.075 26.950000000000003 23.86 85-89 21.205 27.450000000000003 27.6 23.745 90-94 21.090272568142034 27.03675918979745 28.132033008252062 23.740935233808454 95-99 20.679105226201226 26.406861269936805 28.272645200120373 24.6413883037416 100-104 21.05050912390362 27.210404274624455 27.795140639177333 23.943945962294585 105-109 20.989284444670155 27.383068406886395 27.55065766086029 24.07698948758316 110-114 21.579378907451062 27.231731064876495 27.754432714973866 23.434457312698576 115-119 21.09638867238244 27.077162899454404 27.75785918420369 24.068589243959472 120-124 21.089808274470233 27.86658877263795 27.55855329544851 23.485049657443305 125-129 20.460748990064417 26.8861229391855 28.21814608581723 24.43498198493285 130-134 20.685082872928177 27.082872928176794 28.607734806629836 23.624309392265193 135-139 21.259668508287294 27.32596685082873 27.176795580110497 24.23756906077348 140-141 21.53314917127072 28.162983425414367 26.450276243093924 23.853591160220994 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 2.5 25 2.5 26 2.5 27 6.0 28 6.0 29 13.0 30 22.5 31 23.5 32 26.0 33 33.0 34 50.5 35 69.5 36 84.5 37 105.5 38 119.5 39 144.5 40 185.5 41 217.5 42 225.0 43 234.5 44 245.0 45 256.0 46 264.0 47 253.0 48 236.0 49 220.0 50 191.0 51 148.5 52 126.0 53 111.0 54 94.0 55 64.5 56 43.5 57 45.5 58 38.0 59 30.5 60 22.0 61 6.5 62 3.5 63 7.5 64 8.0 65 3.5 66 1.0 67 2.0 68 1.5 69 0.5 70 1.0 71 1.0 72 1.0 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-141 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 92-93 3.0 94-95 7.0 96-97 4.0 98-99 7.0 100-101 13.0 102-103 7.0 104-105 15.0 106-107 13.0 108-109 9.0 110-111 17.0 112-113 25.0 114-115 21.0 116-117 20.0 118-119 28.0 120-121 52.0 122-123 29.0 124-125 47.0 126-127 41.0 128-129 22.0 130-131 0.0 132-133 0.0 134-135 0.0 136-137 0.0 138-139 0.0 140-141 3620.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 88.44999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 88.52459016393442 78.3 2 10.062182023742228 17.8 3 1.2719050310910118 3.375 4 0.11305822498586772 0.4 5 0.02826455624646693 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCCGATTCAGCATCCGAATCCAGAAGCTAAAAACAAAAACAAAGTAGAAT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGAAAAC 10 0.008921138 132.61249 2 GTCTCCA 10 0.008921138 132.61249 3 >>END_MODULE SRR17234930 read2 length is 92-141 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR17234930_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 92-141 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.032 37.0 37.0 37.0 37.0 37.0 2 36.487 37.0 37.0 37.0 37.0 37.0 3 36.418 37.0 37.0 37.0 37.0 37.0 4 36.373 37.0 37.0 37.0 37.0 37.0 5 36.3815 37.0 37.0 37.0 37.0 37.0 6 36.3425 37.0 37.0 37.0 37.0 37.0 7 36.3895 37.0 37.0 37.0 37.0 37.0 8 36.193 37.0 37.0 37.0 37.0 37.0 9 36.124 37.0 37.0 37.0 37.0 37.0 10-14 36.4001 37.0 37.0 37.0 37.0 37.0 15-19 36.195100000000004 37.0 37.0 37.0 37.0 37.0 20-24 36.1572 37.0 37.0 37.0 37.0 37.0 25-29 36.120000000000005 37.0 37.0 37.0 37.0 37.0 30-34 36.2238 37.0 37.0 37.0 37.0 37.0 35-39 36.282799999999995 37.0 37.0 37.0 37.0 37.0 40-44 36.13090000000001 37.0 37.0 37.0 37.0 37.0 45-49 36.200199999999995 37.0 37.0 37.0 37.0 37.0 50-54 36.214999999999996 37.0 37.0 37.0 37.0 37.0 55-59 36.0757 37.0 37.0 37.0 34.6 37.0 60-64 36.276799999999994 37.0 37.0 37.0 37.0 37.0 65-69 36.0257 37.0 37.0 37.0 37.0 37.0 70-74 36.0218 37.0 37.0 37.0 37.0 37.0 75-79 35.70139999999999 37.0 37.0 37.0 34.6 37.0 80-84 36.0028 37.0 37.0 37.0 37.0 37.0 85-89 36.0441 37.0 37.0 37.0 37.0 37.0 90-94 35.944850463460405 37.0 37.0 37.0 37.0 37.0 95-99 35.88808129741945 37.0 37.0 37.0 37.0 37.0 100-104 36.06754447868636 37.0 37.0 37.0 37.0 37.0 105-109 35.77786998724834 37.0 37.0 37.0 34.6 37.0 110-114 35.856288157306025 37.0 37.0 37.0 37.0 37.0 115-119 36.007960263235326 37.0 37.0 37.0 37.0 37.0 120-124 35.851155000670644 37.0 37.0 37.0 37.0 37.0 125-129 35.677636278333566 37.0 37.0 37.0 34.6 37.0 130-134 35.70309392265193 37.0 37.0 37.0 37.0 37.0 135-139 35.86662983425414 37.0 37.0 37.0 37.0 37.0 140-141 35.52596685082873 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 1.0 23 2.0 24 2.0 25 2.0 26 4.0 27 7.0 28 9.0 29 6.0 30 25.0 31 29.0 32 46.0 33 98.0 34 213.0 35 653.0 36 2697.0 37 205.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 22.575 28.000000000000004 31.874999999999996 17.549999999999997 2 19.650000000000002 28.475 30.275000000000002 21.6 3 25.025 34.975 21.4 18.6 4 24.2 38.6 20.849999999999998 16.35 5 20.349999999999998 36.65 24.85 18.15 6 22.175 20.4 37.1 20.325 7 19.5 23.375 31.775 25.35 8 22.725 25.05 28.349999999999998 23.875 9 23.825 34.449999999999996 23.9 17.825 10-14 24.42 27.08 26.16 22.34 15-19 23.400000000000002 28.884999999999998 26.325 21.39 20-24 23.599999999999998 28.52 26.669999999999998 21.21 25-29 22.93 28.884999999999998 27.21 20.974999999999998 30-34 24.45 28.470000000000002 26.195 20.885 35-39 23.785 27.715 27.47 21.029999999999998 40-44 23.75 28.705000000000002 27.04 20.505000000000003 45-49 23.32 28.415000000000003 26.815 21.45 50-54 23.805 28.09 27.139999999999997 20.965 55-59 24.16 27.725 26.790000000000003 21.325 60-64 23.880000000000003 28.155 26.939999999999998 21.025 65-69 24.13 27.965 26.674999999999997 21.23 70-74 23.544999999999998 27.900000000000002 27.3 21.255 75-79 23.78 28.060000000000002 26.47 21.69 80-84 23.915 27.63 26.779999999999998 21.675 85-89 23.285 27.334999999999997 28.205000000000002 21.175 90-94 23.320830207551886 28.10202550637659 27.591897974493623 20.985246311577892 95-99 23.964289296820144 27.420002006219278 27.379877620623933 21.235831076336645 100-104 24.024599253957053 28.14295795947172 27.144873475148707 20.68756931142252 105-109 23.33079461792333 28.464077176948464 26.73775069814674 21.467377506981467 110-114 24.163549725880003 27.75016652149408 27.391504841932672 20.69477891069324 115-119 23.813977656534167 27.63315146791374 27.362951415952196 21.189919459599896 120-124 24.04035041146801 28.63286434828776 26.46137509954871 20.865410140695513 125-129 23.990615451767788 28.219118288956786 26.527717154081188 21.26254910519424 130-134 23.116022099447513 29.259668508287294 26.712707182320443 20.911602209944753 135-139 24.38121546961326 28.254143646408842 26.14364640883978 21.22099447513812 140-141 24.30939226519337 27.720994475138124 26.33977900552486 21.629834254143645 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 0.0 24 0.5 25 1.0 26 2.0 27 4.0 28 5.0 29 7.0 30 10.0 31 20.0 32 28.0 33 30.5 34 38.5 35 49.5 36 77.5 37 108.0 38 129.0 39 149.5 40 176.5 41 217.5 42 255.5 43 261.5 44 246.5 45 271.0 46 273.5 47 263.5 48 260.5 49 214.0 50 171.5 51 136.0 52 116.0 53 115.5 54 99.5 55 74.0 56 50.0 57 35.0 58 30.5 59 23.0 60 13.5 61 10.0 62 8.5 63 2.5 64 4.0 65 3.5 66 0.0 67 0.5 68 1.5 69 1.5 70 0.5 71 1.0 72 1.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-141 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 92-93 3.0 94-95 7.0 96-97 4.0 98-99 7.0 100-101 13.0 102-103 7.0 104-105 14.0 106-107 13.0 108-109 9.0 110-111 17.0 112-113 26.0 114-115 21.0 116-117 20.0 118-119 28.0 120-121 51.0 122-123 28.0 124-125 46.0 126-127 42.0 128-129 24.0 130-131 0.0 132-133 0.0 134-135 0.0 136-137 0.0 138-139 0.0 140-141 3620.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 88.625 #Duplication Level Percentage of deduplicated Percentage of total 1 88.71650211565584 78.625 2 9.92947813822285 17.599999999999998 3 1.1847672778561353 3.15 4 0.14104372355430184 0.5 5 0.028208744710860365 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTGATTT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TAAAAGA 20 0.008306273 49.729687 44-45 >>END_MODULE Read 1388156 spots for SRR17234930.sra Written 1388156 spots for SRR17234930.sra Read 1388156 spots for SRR17234930.sra Written 1388156 spots for SRR17234930.sra Read 1388156 spots for SRR17234930.sra Written 1388156 spots for SRR17234930.sra Read 1388156 spots for SRR17234930.sra Written 1388156 spots for SRR17234930.sra Read 1388156 spots for SRR17234930.sra Written 1388156 spots for SRR17234930.sra Read 1388156 spots for SRR17234930.sra Written 1388156 spots for SRR17234930.sra Read 1388156 spots for SRR17234930.sra Written 1388156 spots for SRR17234930.sra Read 1388156 spots for SRR17234930.sra Written 1388156 spots for SRR17234930.sra Read 1388156 spots for SRR17234930.sra Written 1388156 spots for SRR17234930.sra Read 1388160 spots for SRR17234930.sra Written 1388160 spots for SRR17234930.sra Read 1388156 spots for SRR17234930.sra Written 1388156 spots for SRR17234930.sra Read 1388156 spots for SRR17234930.sra Written 1388156 spots for SRR17234930.sra Read 1388156 spots for SRR17234930.sra Written 1388156 spots for SRR17234930.sra Read 1388156 spots for SRR17234930.sra Written 1388156 spots for SRR17234930.sra Read 1388156 spots for SRR17234930.sra Written 1388156 spots for SRR17234930.sra Read 1388156 spots for SRR17234930.sra Written 1388156 spots for SRR17234930.sra Read 1388156 spots for SRR17234930.sra Written 1388156 spots for SRR17234930.sra Read 1388156 spots for SRR17234930.sra Written 1388156 spots for SRR17234930.sra Read 1388156 spots for SRR17234930.sra Written 1388156 spots for SRR17234930.sra Read 1388156 spots for SRR17234930.sra Written 1388156 spots for SRR17234930.sra SRR ids: ['SRR17234930.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ueyi0mci SRR17234930.sra spots: 27763124 blocks: [[1, 1388156], [1388157, 2776312], [2776313, 4164468], [4164469, 5552624], [5552625, 6940780], [6940781, 8328936], [8328937, 9717092], [9717093, 11105248], [11105249, 12493404], [12493405, 13881560], [13881561, 15269716], [15269717, 16657872], [16657873, 18046028], [18046029, 19434184], [19434185, 20822340], [20822341, 22210496], [22210497, 23598652], [23598653, 24986808], [24986809, 26374964], [26374965, 27763124]] SRR17234930 file size 8748346 SRR17234930 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR17234930 SRR17234930_1.fastq SRR17234930_2.fastq Input file: SRR17234930_1.fastq Paired file: SRR17234930_2.fastq trimmed: SRR17234930-trimmed-pair1.fastq, SRR17234930-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 04:57:52 2025 >> started Wed Feb 12 04:58:35 2025 >> done (42.902s) 27763124 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 0 ( 0.00%) empty read pairs filtered out after trimming by size control 27763124 (100.00%) read pairs available; of these: 85848 ( 0.31%) trimmed read pairs available after processing 27677276 (99.69%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 89 255 0.00% 90 328 0.00% 91 347 0.00% 92 12881 0.05% 93 14500 0.05% 94 16353 0.06% 95 18440 0.07% 96 20199 0.07% 97 22317 0.08% 98 23964 0.09% 99 25889 0.09% 100 29008 0.10% 101 31341 0.11% 102 34462 0.12% 103 37840 0.14% 104 41712 0.15% 105 44471 0.16% 106 47634 0.17% 107 50715 0.18% 108 54772 0.20% 109 58141 0.21% 110 61673 0.22% 111 64848 0.23% 112 71196 0.26% 113 75692 0.27% 114 79764 0.29% 115 84666 0.30% 116 89086 0.32% 117 93022 0.34% 118 98372 0.35% 119 101760 0.37% 120 103580 0.37% 121 109775 0.40% 122 114485 0.41% 123 121915 0.44% 124 125584 0.45% 125 131142 0.47% 126 131600 0.47% 127 139620 0.50% 128 141156 0.51% 129 1632 0.01% 130 2353 0.01% 131 2189 0.01% 132 6862 0.02% 133 9390 0.03% 134 29471 0.11% 135 0 0.00% 136 372 0.00% 137 919 0.00% 138 3932 0.01% 139 6251 0.02% 140 23331 0.08% 141 25151917 90.59% 27763124 reads passed initial QC criterion=sequence-density sequence-density=1.08 sequence-density-rank=1 fanout-score=2.05 fanout-score-rank=16 prefix-density=1.11 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.02 sequence-density-rank=23 fanout-score=72.16 fanout-score-rank=1 prefix-density=0.76 prefix-fanout=1.8 sequence=TGAATGGTGCACATTACGGGTCCATGGCACAAAATCAGAGGATAACAATATCCATTCAAGACTATGCAACAATATAATTTGATTATCCTTAGAAAGTGCTTCTCCTTACACACCCACAAGCCTAGAAAAGGAATTAGAATTTGTAAGTGCAGCTTCCATCATCACTCCTTGCAGTTGGATCAAAGTTTGCTGCATTTGGATCAGTACAGCCTTCAGCGACAGGCACCTTTACTTGCTGTGCCGCTTGGCC criterion=sequence-density sequence-density=0.91 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=24 prefix-density=0.90 prefix-fanout=2.0 sequence=TACCTTCTTCGC criterion=fanout-score sequence-density=0.03 sequence-density-rank=24 fanout-score=105.09 fanout-score-rank=1 prefix-density=0.27 prefix-fanout=10.0 sequence=AGAGAGAGAGACAGAGAGAATGGCCACCACAGCAGCCCTCTCCAGCGCCATGGTCAGCACATCGTTTACTCGCCGGGTGCCAGTGACAAGCCTACGGGCACTTCCCAACGTGGGGGAGTCTCTTCTTGGCTTGAAAGCCAGTCGAGGAGGACGTGTTAAAGCAATGGCAG SRR17234930 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 04:59:14 Started mapping on | Feb 12 04:59:14 Finished on | Feb 12 05:01:02 Mapping speed, Million of reads per hour | 925.44 Number of input reads | 27763124 Average input read length | 277 UNIQUE READS: Uniquely mapped reads number | 22005179 Uniquely mapped reads % | 79.26% Average mapped length | 279.23 Number of splices: Total | 21141901 Number of splices: Annotated (sjdb) | 20848298 Number of splices: GT/AG | 20707847 Number of splices: GC/AG | 383873 Number of splices: AT/AC | 12255 Number of splices: Non-canonical | 37926 Mismatch rate per base, % | 0.20% Deletion rate per base | 0.02% Deletion average length | 1.95 Insertion rate per base | 0.01% Insertion average length | 2.11 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 549421 % of reads mapped to multiple loci | 1.98% Number of reads mapped to too many loci | 274862 % of reads mapped to too many loci | 0.99% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 17.64% % of reads unmapped: other | 0.13% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 5208524 5208524 5208524 N_multimapping 549421 549421 549421 N_noFeature 548402 21803995 591841 N_ambiguous 391203 1437 232721 UnstrandedReadsAssigned:21065574 PositiveStrandReadsAssigned:199747 NegativeStrandReadsAssigned:21180617 Dataset is classified negative stranded MeadianReadLen=141 20thPercentileLength=141 echo kmer=137 SRR17234930 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR17234930-trimmed-pair1.fastq SRR17234930-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 27,763,124 reads, 25,762,758 reads pseudoaligned [quant] estimated average fragment length: 183.688 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,125 rounds 52401 SRR17234930.ke.tsv 34699 SRR17234930.se.tsv 87100 total ==> SRR17234930.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1835.31 500 11.2741 Potri.005G024800.1.v4.1 1035 852.312 129 6.26343 Potri.004G059700.1.v4.1 961 778.312 36 1.91412 Potri.007G009000.2.v4.1 1416 1233.31 7 0.23488 Potri.003G141000.2.v4.1 2943 2760.31 968 14.5124 Potri.016G087400.1.v4.1 270 99.6329 859 356.789 Potri.015G069301.1.v4.1 564 381.384 0 0 Potri.010G195200.1.v4.1 1773 1590.31 7 0.182153 Potri.012G127500.1.v4.1 977 794.312 389 20.2666 ==> SRR17234930.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 279 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 282 Potri.001G212900.v4.1 65 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 201 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 5 SRR17234930 completed mapping pipeline successfully