Starting /dee2/code/volunteer_pipeline.sh SRR1799526 current disk space = 3087742484480 free memory = 1533589524 SRR1799526 SRAfilesize 850aedce5c0c831bb1832a50de299fd7 SRR1799526.sra SRR1799526.sra file validated SRR1799526 is paired end SRR1799526 is conventional basespace SRR1799526 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR1799526_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.6085 34.0 34.0 34.0 31.0 34.0 2 33.0835 34.0 34.0 34.0 31.0 34.0 3 33.3925 34.0 34.0 34.0 31.0 34.0 4 36.66025 37.0 37.0 37.0 35.0 37.0 5 36.6535 37.0 37.0 37.0 35.0 37.0 6 36.71675 37.0 37.0 37.0 36.0 37.0 7 36.69425 37.0 37.0 37.0 35.0 37.0 8 36.68275 37.0 37.0 37.0 36.0 37.0 9 38.586 39.0 39.0 39.0 38.0 39.0 10-14 38.9341 39.4 39.4 39.4 38.2 39.4 15-19 40.24905 41.0 40.0 41.0 39.0 41.0 20-24 40.26585 41.0 40.0 41.0 39.0 41.0 25-29 40.09505 41.0 40.0 41.0 38.0 41.0 30-34 40.103300000000004 41.0 40.0 41.0 38.0 41.0 35-39 39.970749999999995 41.0 40.0 41.0 38.0 41.0 40-44 39.830099999999995 41.0 40.0 41.0 38.0 41.0 45-49 39.67195 41.0 40.0 41.0 37.2 41.0 50-54 39.4395 41.0 39.4 41.0 36.4 41.0 55-59 39.19505 40.6 39.0 41.0 35.8 41.0 60-64 38.91725 40.2 38.2 41.0 35.2 41.0 65-69 38.309900000000006 39.4 36.8 41.0 35.0 41.0 70-74 37.27425000000001 37.8 35.4 40.0 34.8 41.0 75-79 35.90345 36.2 34.8 38.2 33.4 39.4 80-84 35.2967 35.2 35.0 36.6 34.0 38.2 85-89 34.70305 35.0 35.0 35.8 33.8 36.6 90-94 34.232 35.0 35.0 35.0 33.0 36.0 95-99 34.02085 35.0 35.0 35.0 33.0 36.0 100-104 34.0018 35.0 35.0 35.0 33.0 35.0 105-109 33.87179999999999 35.0 35.0 35.0 32.4 35.0 110-114 33.7804 35.0 35.0 35.0 32.4 35.0 115-119 33.6267 35.0 34.2 35.0 32.0 35.0 120-124 33.57835 35.0 34.0 35.0 32.0 35.0 125-129 33.47115 35.0 34.0 35.0 31.4 35.0 130-134 33.22945 35.0 34.0 35.0 30.8 35.0 135-139 33.029 35.0 34.0 35.0 30.4 35.0 140-144 32.81159999999999 35.0 34.0 35.0 30.0 35.0 145-149 32.26975 35.0 33.6 35.0 29.0 35.0 150 26.8545 34.0 23.0 35.0 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 1.0 11 2.0 12 1.0 13 1.0 14 4.0 15 2.0 16 2.0 17 8.0 18 10.0 19 8.0 20 6.0 21 4.0 22 2.0 23 8.0 24 6.0 25 12.0 26 11.0 27 9.0 28 17.0 29 29.0 30 35.0 31 30.0 32 48.0 33 81.0 34 124.0 35 247.0 36 970.0 37 2242.0 38 79.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.210796915167094 13.958868894601542 7.146529562982005 36.68380462724936 2 23.330832708177045 14.353588397099276 32.6081520380095 29.707426856714182 3 19.425 16.150000000000002 26.025 38.4 4 23.25988983475213 23.585378067100653 22.158237356034054 30.996494742113168 5 23.0 29.975 25.174999999999997 21.85 6 19.725 33.675 23.75 22.85 7 14.124999999999998 30.049999999999997 38.675 17.150000000000002 8 16.0 28.675 31.974999999999998 23.35 9 16.075 26.875 33.35 23.7 10-14 18.415 32.029999999999994 27.325 22.23 15-19 19.495 29.945 27.47 23.09 20-24 18.92 30.2 27.6 23.28 25-29 18.865000000000002 30.380000000000003 27.500000000000004 23.255 30-34 18.935 30.049999999999997 27.839999999999996 23.175 35-39 19.525000000000002 29.665000000000003 27.485 23.325000000000003 40-44 18.970000000000002 30.165 27.345000000000002 23.52 45-49 19.3 29.509999999999998 27.49 23.7 50-54 18.855 29.544999999999998 27.355 24.245 55-59 19.38 30.28 26.924999999999997 23.415 60-64 19.325 29.79 27.05 23.835 65-69 19.470000000000002 29.255 27.715 23.56 70-74 18.91 29.299999999999997 27.525 24.265 75-79 19.725 29.325000000000003 27.195000000000004 23.755000000000003 80-84 19.7 29.195 27.465 23.64 85-89 19.57 29.635 27.35 23.445 90-94 19.72 29.830000000000002 27.589999999999996 22.86 95-99 20.044999999999998 29.875 26.97 23.11 100-104 20.16 29.115000000000002 26.845000000000002 23.880000000000003 105-109 20.665 29.15 27.265 22.919999999999998 110-114 19.8 30.035 26.72 23.445 115-119 20.525 29.955 25.85 23.669999999999998 120-124 20.544999999999998 29.62 25.785000000000004 24.05 125-129 21.085 29.445 25.395 24.075 130-134 20.985 29.080000000000002 25.39 24.545 135-139 20.645 29.205 25.39 24.759999999999998 140-144 20.724999999999998 29.549999999999997 25.355 24.37 145-149 20.05 30.12 24.990000000000002 24.84 150 16.440763052208833 30.547188755020084 25.451807228915662 27.56024096385542 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.5 19 1.0 20 0.5 21 0.0 22 0.0 23 1.5 24 3.0 25 5.5 26 10.0 27 15.0 28 19.0 29 17.5 30 20.0 31 28.5 32 42.5 33 60.0 34 72.5 35 89.5 36 108.0 37 115.5 38 142.0 39 192.0 40 211.0 41 223.5 42 246.0 43 262.5 44 264.0 45 259.0 46 261.5 47 245.5 48 210.0 49 179.5 50 153.5 51 125.5 52 104.0 53 90.0 54 67.5 55 39.0 56 28.0 57 21.5 58 16.5 59 13.0 60 9.0 61 6.5 62 6.0 63 4.5 64 3.0 65 3.0 66 1.5 67 0.5 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.75 2 0.025 3 0.0 4 0.15 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.4 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57318604067285 99.15 2 0.42681395932714034 0.8500000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.175 0.0 0.0 0.0 0.0 74-75 0.2875 0.0 0.0 0.0 0.0 76-77 0.425 0.0 0.0 0.0 0.0 78-79 0.55 0.0 0.0 0.0 0.0 80-81 0.6375 0.0 0.0 0.0 0.0 82-83 0.8625 0.0 0.0 0.0 0.0 84-85 1.0125 0.0 0.0 0.0 0.0 86-87 1.15 0.0 0.0 0.0 0.0 88-89 1.425 0.0 0.0 0.0 0.0 90-91 1.5 0.0 0.0 0.0 0.0 92-93 1.6875 0.0 0.0 0.0 0.0 94-95 1.8 0.0 0.0 0.0 0.0 96-97 2.075 0.0 0.0 0.0 0.0 98-99 2.4625 0.0 0.0 0.0 0.0 100-101 2.6125 0.0 0.0 0.0 0.0 102-103 3.1125 0.0 0.0 0.0 0.0 104-105 3.8 0.0 0.0 0.0 0.0 106-107 4.475 0.0 0.0 0.0 0.0 108-109 5.325 0.0 0.0 0.0 0.0 110-111 6.225 0.0 0.0 0.0 0.0 112-113 6.987500000000001 0.0 0.0 0.0 0.0 114-115 8.1875 0.0 0.0 0.0 0.0 116-117 9.2375 0.0 0.0 0.0 0.0 118-119 10.175 0.0 0.0 0.0 0.0 120-121 11.1875 0.0 0.0 0.0 0.0 122-123 12.425 0.0 0.0 0.0 0.0 124-125 13.5625 0.0 0.0 0.0 0.0 126-127 14.775 0.0 0.0 0.0 0.0 128-129 16.1375 0.0 0.0 0.0 0.0 130-131 17.5875 0.0 0.0 0.0 0.0 132-133 18.8125 0.0 0.0 0.0 0.0 134-135 20.049999999999997 0.0 0.0 0.0 0.0 136-137 21.3375 0.0 0.0 0.0 0.0 138 22.55 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AACAGTT 10 0.0069790767 143.96251 7 AAAAAAA 165 0.005727249 7.8524995 45-49 >>END_MODULE SRR1799526 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR1799526_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.82775 34.0 33.0 34.0 31.0 34.0 2 32.908 34.0 34.0 34.0 31.0 34.0 3 33.0005 34.0 34.0 34.0 31.0 34.0 4 36.20875 37.0 37.0 37.0 35.0 37.0 5 36.235 37.0 37.0 37.0 35.0 37.0 6 36.284 37.0 37.0 37.0 35.0 37.0 7 36.2225 37.0 37.0 37.0 35.0 37.0 8 36.16975 37.0 37.0 37.0 35.0 37.0 9 38.127 39.0 39.0 39.0 37.0 39.0 10-14 38.40195 39.4 39.2 39.4 37.2 39.4 15-19 39.66235 41.0 40.0 41.0 38.0 41.0 20-24 39.619150000000005 41.0 40.0 41.0 38.0 41.0 25-29 39.556400000000004 41.0 40.0 41.0 38.0 41.0 30-34 39.408249999999995 41.0 40.0 41.0 38.0 41.0 35-39 39.14084999999999 41.0 40.0 41.0 36.8 41.0 40-44 39.01199999999999 41.0 39.8 41.0 36.6 41.0 45-49 38.674800000000005 40.8 38.8 41.0 35.4 41.0 50-54 38.04355 39.6 38.0 40.6 34.4 40.8 55-59 38.09995 40.0 38.0 41.0 34.2 41.0 60-64 38.04774999999999 40.0 37.4 41.0 34.6 41.0 65-69 37.43275 39.0 36.4 41.0 34.0 41.0 70-74 36.49720000000001 37.2 35.0 39.4 34.0 41.0 75-79 35.388549999999995 36.2 35.0 38.0 33.0 39.6 80-84 34.46535 35.0 35.0 36.4 32.8 37.8 85-89 33.8039 35.0 35.0 35.6 32.0 36.4 90-94 33.509100000000004 35.0 35.0 35.0 31.8 36.0 95-99 33.25840000000001 35.0 34.8 35.0 31.0 35.4 100-104 33.18085000000001 35.0 34.4 35.0 31.0 35.0 105-109 33.05799999999999 35.0 34.0 35.0 30.8 35.0 110-114 32.80069999999999 35.0 34.0 35.0 29.6 35.0 115-119 32.656150000000004 35.0 34.0 35.0 29.6 35.0 120-124 32.5106 35.0 34.0 35.0 29.0 35.0 125-129 32.4057 35.0 34.0 35.0 29.0 35.0 130-134 32.01935 35.0 33.2 35.0 27.0 35.0 135-139 31.591950000000004 35.0 33.0 35.0 25.0 35.0 140-144 31.2067 35.0 32.6 35.0 24.2 35.0 145-149 30.753499999999995 35.0 32.0 35.0 21.4 35.0 150 28.59025 33.0 29.0 35.0 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 39.0 3 1.0 4 5.0 5 2.0 6 4.0 7 2.0 8 2.0 9 2.0 10 4.0 11 5.0 12 3.0 13 5.0 14 4.0 15 4.0 16 6.0 17 7.0 18 5.0 19 9.0 20 12.0 21 7.0 22 10.0 23 16.0 24 16.0 25 8.0 26 10.0 27 26.0 28 16.0 29 29.0 30 35.0 31 39.0 32 62.0 33 99.0 34 147.0 35 312.0 36 1131.0 37 1859.0 38 57.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.097744360902254 20.50125313283208 12.907268170426065 27.493734335839598 2 26.731682920730183 25.656414103525883 31.257814453613403 16.35408852213053 3 20.080020005001252 25.78144536134033 34.38359589897475 19.754938734683673 4 24.58114528632158 31.707926981745437 25.206301575393848 18.504626156539132 5 24.656164041010253 34.583645911477866 23.830957739434858 16.92923230807702 6 20.05 39.6 23.45 16.900000000000002 7 21.825 22.3 37.3 18.575 8 20.200000000000003 25.224999999999998 30.975 23.599999999999998 9 23.95 25.05 29.475 21.525 10-14 24.425 28.42 27.305 19.85 15-19 24.07 28.115000000000002 28.060000000000002 19.755 20-24 23.765 27.389999999999997 29.035 19.81 25-29 23.395 28.084999999999997 28.585 19.935 30-34 23.73 27.73 28.435 20.105 35-39 23.375 27.894999999999996 28.994999999999997 19.735 40-44 23.400000000000002 27.839999999999996 28.985 19.775000000000002 45-49 23.275000000000002 27.62 28.970000000000002 20.135 50-54 23.72 27.83 28.560000000000002 19.89 55-59 23.5 27.215 29.17 20.115 60-64 23.544999999999998 26.950000000000003 29.68 19.825 65-69 23.06 27.92 29.525000000000002 19.495 70-74 23.455000000000002 27.775 28.715000000000003 20.055 75-79 23.785 27.46 29.29 19.465 80-84 23.150000000000002 27.485 29.39 19.975 85-89 23.755000000000003 27.985 28.925 19.335 90-94 24.285 27.255000000000003 29.759999999999998 18.7 95-99 23.915 27.76 28.95 19.375 100-104 24.305 27.705000000000002 28.22 19.77 105-109 23.905 28.22 28.494999999999997 19.38 110-114 24.560000000000002 28.025 27.91 19.505 115-119 25.480000000000004 27.71 28.005000000000003 18.805 120-124 25.724999999999998 28.13 27.425 18.72 125-129 26.77 27.675 26.740000000000002 18.815 130-134 27.315 27.985 26.96 17.740000000000002 135-139 28.050000000000004 28.349999999999998 26.064999999999998 17.535 140-144 27.735 28.470000000000002 26.195 17.599999999999998 145-149 29.17 28.265 25.66 16.905 150 28.719112455874935 27.912254160363087 25.769036812909736 17.599596570852245 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.5 16 0.5 17 0.0 18 0.5 19 1.0 20 1.5 21 1.0 22 1.0 23 2.0 24 2.0 25 2.0 26 3.5 27 8.0 28 11.5 29 15.0 30 20.5 31 28.0 32 38.0 33 49.5 34 58.5 35 82.5 36 109.0 37 130.0 38 158.0 39 172.0 40 190.0 41 230.5 42 259.0 43 277.0 44 288.0 45 273.5 46 251.0 47 226.0 48 209.5 49 187.5 50 161.0 51 130.5 52 101.5 53 83.0 54 59.0 55 43.0 56 36.5 57 27.5 58 20.0 59 14.5 60 8.5 61 5.0 62 2.5 63 3.5 64 4.0 65 3.5 66 1.5 67 0.0 68 0.0 69 0.0 70 0.5 71 0.5 72 0.5 73 0.5 74 1.0 75 1.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.25 2 0.025 3 0.025 4 0.025 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.8500000000000001 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64877069744105 99.3 2 0.35122930255895635 0.7000000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.175 0.0 0.0 0.0 0.0 74-75 0.2875 0.0 0.0 0.0 0.0 76-77 0.425 0.0 0.0 0.0 0.0 78-79 0.55 0.0 0.0 0.0 0.0 80-81 0.6375 0.0 0.0 0.0 0.0 82-83 0.8625 0.0 0.0 0.0 0.0 84-85 1.0125 0.0 0.0 0.0 0.0 86-87 1.15 0.0 0.0 0.0 0.0 88-89 1.45 0.0 0.0 0.0 0.0 90-91 1.525 0.0 0.0 0.0 0.0 92-93 1.7125 0.0 0.0 0.0 0.0 94-95 1.825 0.0 0.0 0.0 0.0 96-97 2.0999999999999996 0.0 0.0 0.0 0.0 98-99 2.4875 0.0 0.0 0.0 0.0 100-101 2.6375 0.0 0.0 0.0 0.0 102-103 3.1500000000000004 0.0 0.0 0.0 0.0 104-105 3.85 0.0 0.0 0.0 0.0 106-107 4.5375 0.0 0.0 0.0 0.0 108-109 5.425 0.0 0.0 0.0 0.0 110-111 6.35 0.0 0.0 0.0 0.0 112-113 7.15 0.0 0.0 0.0 0.0 114-115 8.375 0.0 0.0 0.0 0.0 116-117 9.462499999999999 0.0 0.0 0.0 0.0 118-119 10.399999999999999 0.0 0.0 0.0 0.0 120-121 11.4 0.0 0.0 0.0 0.0 122-123 12.625 0.0 0.0 0.0 0.0 124-125 13.7625 0.0 0.0 0.0 0.0 126-127 14.975 0.0 0.0 0.0 0.0 128-129 16.3375 0.0 0.0 0.0 0.0 130-131 17.7875 0.0 0.0 0.0 0.0 132-133 19.025 0.0 0.0 0.0 0.0 134-135 20.2125 0.0 0.0 0.0 0.0 136-137 21.4375 0.0 0.0 0.0 0.0 138 22.65 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CATGCCG 10 0.006973645 144.0 3 >>END_MODULE Read 917487 spots for SRR1799526.sra Written 917487 spots for SRR1799526.sra Read 917487 spots for SRR1799526.sra Written 917487 spots for SRR1799526.sra Read 917487 spots for SRR1799526.sra Written 917487 spots for SRR1799526.sra Read 917487 spots for SRR1799526.sra Written 917487 spots for SRR1799526.sra Read 917487 spots for SRR1799526.sra Written 917487 spots for SRR1799526.sra Read 917487 spots for SRR1799526.sra Written 917487 spots for SRR1799526.sra Read 917487 spots for SRR1799526.sra Written 917487 spots for SRR1799526.sra Read 917487 spots for SRR1799526.sra Written 917487 spots for SRR1799526.sra Read 917487 spots for SRR1799526.sra Written 917487 spots for SRR1799526.sra Read 917487 spots for SRR1799526.sra Written 917487 spots for SRR1799526.sra Read 917487 spots for SRR1799526.sra Written 917487 spots for SRR1799526.sra Read 917487 spots for SRR1799526.sra Written 917487 spots for SRR1799526.sra Read 917487 spots for SRR1799526.sra Written 917487 spots for SRR1799526.sra Read 917487 spots for SRR1799526.sra Written 917487 spots for SRR1799526.sra Read 917487 spots for SRR1799526.sra Written 917487 spots for SRR1799526.sra Read 917487 spots for SRR1799526.sra Written 917487 spots for SRR1799526.sra Read 917487 spots for SRR1799526.sra Written 917487 spots for SRR1799526.sra Read 917496 spots for SRR1799526.sra Written 917496 spots for SRR1799526.sra Read 917487 spots for SRR1799526.sra Written 917487 spots for SRR1799526.sra Read 917487 spots for SRR1799526.sra Written 917487 spots for SRR1799526.sra SRR ids: ['SRR1799526.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_c7l5d0n5 SRR1799526.sra spots: 18349749 blocks: [[1, 917487], [917488, 1834974], [1834975, 2752461], [2752462, 3669948], [3669949, 4587435], [4587436, 5504922], [5504923, 6422409], [6422410, 7339896], [7339897, 8257383], [8257384, 9174870], [9174871, 10092357], [10092358, 11009844], [11009845, 11927331], [11927332, 12844818], [12844819, 13762305], [13762306, 14679792], [14679793, 15597279], [15597280, 16514766], [16514767, 17432253], [17432254, 18349749]] SRR1799526 file size 6160588 SRR1799526 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR1799526 SRR1799526_1.fastq SRR1799526_2.fastq Input file: SRR1799526_1.fastq Paired file: SRR1799526_2.fastq trimmed: SRR1799526-trimmed-pair1.fastq, SRR1799526-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 20:40:50 2025 >> started Thu Feb 13 20:41:11 2025 >> done (20.512s) 18349749 read pairs processed; of these: 58431 ( 0.32%) short read pairs filtered out after trimming by size control 171304 ( 0.93%) empty read pairs filtered out after trimming by size control 18120014 (98.75%) read pairs available; of these: 8671715 (47.86%) trimmed read pairs available after processing 9448299 (52.14%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 2 0.00% 20 7 0.00% 21 10 0.00% 22 8 0.00% 23 21 0.00% 24 28 0.00% 25 30 0.00% 26 38 0.00% 27 58 0.00% 28 64 0.00% 29 63 0.00% 30 83 0.00% 31 127 0.00% 32 158 0.00% 33 148 0.00% 34 191 0.00% 35 186 0.00% 36 259 0.00% 37 258 0.00% 38 306 0.00% 39 369 0.00% 40 361 0.00% 41 396 0.00% 42 459 0.00% 43 465 0.00% 44 552 0.00% 45 532 0.00% 46 592 0.00% 47 617 0.00% 48 725 0.00% 49 779 0.00% 50 824 0.00% 51 1026 0.01% 52 1088 0.01% 53 1121 0.01% 54 1228 0.01% 55 1352 0.01% 56 1439 0.01% 57 1636 0.01% 58 1752 0.01% 59 1999 0.01% 60 2166 0.01% 61 2490 0.01% 62 2674 0.01% 63 3058 0.02% 64 3468 0.02% 65 3761 0.02% 66 3982 0.02% 67 4283 0.02% 68 4835 0.03% 69 5448 0.03% 70 6269 0.03% 71 7191 0.04% 72 7985 0.04% 73 9239 0.05% 74 10480 0.06% 75 11848 0.07% 76 12937 0.07% 77 13720 0.08% 78 15188 0.08% 79 16635 0.09% 80 17416 0.10% 81 19746 0.11% 82 22029 0.12% 83 23137 0.13% 84 28788 0.16% 85 31229 0.17% 86 34538 0.19% 87 35130 0.19% 88 18904 0.10% 89 18531 0.10% 90 19506 0.11% 91 36144 0.20% 92 23352 0.13% 93 20168 0.11% 94 21774 0.12% 95 30409 0.17% 96 27521 0.15% 97 37576 0.21% 98 50894 0.28% 99 27324 0.15% 100 25411 0.14% 101 63194 0.35% 102 76844 0.42% 103 51617 0.28% 104 60833 0.34% 105 104217 0.58% 106 51023 0.28% 107 92646 0.51% 108 107172 0.59% 109 114893 0.63% 110 104538 0.58% 111 122800 0.68% 112 123215 0.68% 113 83365 0.46% 114 122381 0.68% 115 139675 0.77% 116 81299 0.45% 117 62488 0.34% 118 122272 0.67% 119 97840 0.54% 120 103093 0.57% 121 115852 0.64% 122 139497 0.77% 123 103046 0.57% 124 77362 0.43% 125 125897 0.69% 126 125363 0.69% 127 141615 0.78% 128 139950 0.77% 129 152096 0.84% 130 147791 0.82% 131 120574 0.67% 132 147923 0.82% 133 155860 0.86% 134 151600 0.84% 135 154756 0.85% 136 160472 0.89% 137 166461 0.92% 138 163764 0.90% 139 165591 0.91% 140 166608 0.92% 141 169470 0.94% 142 172523 0.95% 143 174193 0.96% 144 182455 1.01% 145 195178 1.08% 146 213812 1.18% 147 257420 1.42% 148 353592 1.95% 149 1507048 8.32% 150 9448299 52.14% 18120014 reads passed initial QC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=2.78 fanout-score-rank=35 prefix-density=0.21 prefix-fanout=2.6 sequence=CTCCACACTTGTA criterion=fanout-score sequence-density=0.09 sequence-density-rank=14 fanout-score=158.51 fanout-score-rank=1 prefix-density=0.52 prefix-fanout=26.0 sequence=CATCATCATCACC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=3.00 fanout-score-rank=30 prefix-density=0.19 prefix-fanout=2.6 sequence=TACAAGTGTGGAG criterion=fanout-score sequence-density=0.08 sequence-density-rank=21 fanout-score=50.37 fanout-score-rank=1 prefix-density=0.27 prefix-fanout=14.6 sequence=GAGAAGGCAATGAGAGATGC SRR1799526 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 20:41:55 Started mapping on | Feb 13 20:41:55 Finished on | Feb 13 20:44:15 Mapping speed, Million of reads per hour | 465.94 Number of input reads | 18120014 Average input read length | 279 UNIQUE READS: Uniquely mapped reads number | 17001133 Uniquely mapped reads % | 93.83% Average mapped length | 277.24 Number of splices: Total | 13225586 Number of splices: Annotated (sjdb) | 12853005 Number of splices: GT/AG | 12954729 Number of splices: GC/AG | 166381 Number of splices: AT/AC | 12050 Number of splices: Non-canonical | 92426 Mismatch rate per base, % | 1.17% Deletion rate per base | 0.11% Deletion average length | 2.92 Insertion rate per base | 0.08% Insertion average length | 2.59 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 644830 % of reads mapped to multiple loci | 3.56% Number of reads mapped to too many loci | 30598 % of reads mapped to too many loci | 0.17% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.39% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 499786 499786 499786 N_multimapping 644830 644830 644830 N_noFeature 541240 16726385 675250 N_ambiguous 231016 1107 89885 UnstrandedReadsAssigned:16228877 PositiveStrandReadsAssigned:273641 NegativeStrandReadsAssigned:16235998 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=131 echo kmer=127 SRR1799526 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR1799526-trimmed-pair1.fastq SRR1799526-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,120,014 reads, 15,886,540 reads pseudoaligned [quant] estimated average fragment length: 177.63 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,246 rounds 52401 SRR1799526.ke.tsv 34699 SRR1799526.se.tsv 87100 total ==> SRR1799526.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1841.37 345 13.2577 Potri.005G024800.1.v4.1 1035 858.37 207 17.0642 Potri.004G059700.1.v4.1 961 784.374 28 2.52596 Potri.007G009000.2.v4.1 1416 1239.37 0 0 Potri.003G141000.2.v4.1 2943 2766.37 243.05 6.21694 Potri.016G087400.1.v4.1 270 109.076 1602.48 1039.57 Potri.015G069301.1.v4.1 564 387.855 0 0 Potri.010G195200.1.v4.1 1773 1596.37 26 1.15247 Potri.012G127500.1.v4.1 977 800.37 3359 296.969 ==> SRR1799526.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1164 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 324 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 10 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR1799526 completed mapping pipeline successfully