Starting /dee2/code/volunteer_pipeline.sh SRR1799527 current disk space = 3087639019520 free memory = 1488425468 SRR1799527 SRAfilesize 36d040434e7aeb2def1928d6b0f71362 SRR1799527.sra SRR1799527.sra file validated SRR1799527 is paired end SRR1799527 is conventional basespace SRR1799527 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR1799527_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.933 34.0 33.0 34.0 31.0 34.0 2 33.196 34.0 34.0 34.0 31.0 34.0 3 33.38125 34.0 34.0 34.0 31.0 34.0 4 36.67 37.0 37.0 37.0 35.0 37.0 5 36.60475 37.0 37.0 37.0 35.0 37.0 6 36.613 37.0 37.0 37.0 35.0 37.0 7 36.49575 37.0 37.0 37.0 35.0 37.0 8 36.629 37.0 37.0 37.0 35.0 37.0 9 38.50025 39.0 39.0 39.0 37.0 39.0 10-14 38.792449999999995 39.4 39.2 39.4 37.2 39.4 15-19 40.066649999999996 41.0 40.0 41.0 38.0 41.0 20-24 40.04905 41.0 40.0 41.0 38.0 41.0 25-29 39.96235 41.0 40.0 41.0 38.0 41.0 30-34 39.8141 41.0 40.0 41.0 38.0 41.0 35-39 39.6744 41.0 40.0 41.0 37.6 41.0 40-44 39.5794 41.0 40.0 41.0 37.0 41.0 45-49 39.70709999999999 41.0 40.0 41.0 37.2 41.0 50-54 39.5132 41.0 39.8 41.0 36.6 41.0 55-59 39.197 40.8 38.8 41.0 35.4 41.0 60-64 38.73774999999999 40.0 37.6 41.0 35.0 41.0 65-69 37.926550000000006 39.0 36.4 41.0 34.6 41.0 70-74 36.9294 37.2 35.0 39.4 34.0 41.0 75-79 35.46385 35.8 34.6 37.4 32.6 39.2 80-84 35.10885 35.0 35.0 36.6 33.2 37.8 85-89 34.5355 35.0 35.0 35.6 33.0 36.6 90-94 34.223299999999995 35.0 35.0 35.0 33.0 36.0 95-99 34.02405 35.0 34.8 35.0 32.8 35.4 100-104 33.90375 35.0 34.0 35.0 32.0 35.0 105-109 33.823249999999994 35.0 34.0 35.0 32.0 35.0 110-114 33.71470000000001 35.0 34.0 35.0 32.0 35.0 115-119 33.57125 35.0 34.0 35.0 31.6 35.0 120-124 33.4055 35.0 34.0 35.0 31.2 35.0 125-129 33.300200000000004 35.0 34.0 35.0 30.8 35.0 130-134 33.070499999999996 35.0 34.0 35.0 30.2 35.0 135-139 32.7379 35.0 33.2 35.0 29.4 35.0 140-144 32.4621 34.6 33.0 35.0 28.6 35.0 145-149 31.982800000000005 34.0 33.0 35.0 28.2 35.0 150 28.60575 32.0 27.0 34.0 19.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 0.0 9 1.0 10 0.0 11 2.0 12 2.0 13 4.0 14 0.0 15 2.0 16 4.0 17 3.0 18 5.0 19 1.0 20 5.0 21 4.0 22 1.0 23 4.0 24 15.0 25 11.0 26 13.0 27 18.0 28 17.0 29 25.0 30 34.0 31 46.0 32 55.0 33 116.0 34 140.0 35 353.0 36 1145.0 37 1941.0 38 32.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.52618264609158 11.18138122944599 7.513281052365292 40.77915507209714 2 22.5 14.6 34.8 28.1 3 20.025000000000002 16.55 26.224999999999998 37.2 4 23.775 24.15 22.175 29.9 5 25.575 28.799999999999997 24.575 21.05 6 20.8 34.300000000000004 24.375 20.525 7 14.224999999999998 28.225 39.1 18.45 8 17.1 26.1 31.924999999999997 24.875 9 17.275 24.6 34.375 23.75 10-14 19.759999999999998 30.115 27.345000000000002 22.78 15-19 19.56 28.744999999999997 27.915 23.78 20-24 20.395 29.275000000000002 27.439999999999998 22.89 25-29 19.025 29.39 27.815 23.77 30-34 20.225 29.15 27.42 23.205000000000002 35-39 19.675 28.845 27.595 23.885 40-44 19.759999999999998 29.28 27.525 23.435 45-49 19.515 28.749999999999996 27.794999999999998 23.94 50-54 19.875 29.085 27.375 23.665 55-59 19.935 29.409999999999997 27.150000000000002 23.505000000000003 60-64 19.77 29.275000000000002 26.889999999999997 24.065 65-69 19.85 28.860000000000003 27.755000000000003 23.535 70-74 20.41 28.470000000000002 27.82 23.3 75-79 19.794999999999998 29.575000000000003 27.01 23.62 80-84 20.560000000000002 28.165000000000003 28.139999999999997 23.135 85-89 20.0 28.65 27.495000000000005 23.855 90-94 19.657948692303844 28.84432664899735 27.24908736310447 24.24863729559434 95-99 20.033004950742612 28.294244136620495 27.874181127169074 23.798569785467823 100-104 20.511025551277566 28.781439071953596 27.49137456872844 23.2161608080404 105-109 20.281014050702534 28.846442322116104 27.366368318415923 23.50617530876544 110-114 21.217121712171217 28.562856285628563 27.27272727272727 22.947294729472947 115-119 20.635 28.444999999999997 27.339999999999996 23.580000000000002 120-124 21.485000000000003 27.83 27.169999999999998 23.515 125-129 20.605 28.199999999999996 27.295 23.9 130-134 21.25 28.005000000000003 27.22 23.525 135-139 21.25318797819673 28.114217132569884 27.119067860179026 23.513527029054355 140-144 22.0 28.77 25.874999999999996 23.355 145-149 21.705 29.42 25.740000000000002 23.135 150 23.125 27.450000000000003 27.474999999999998 21.95 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.5 21 0.5 22 0.5 23 0.5 24 1.5 25 2.5 26 3.0 27 8.5 28 12.5 29 17.0 30 22.0 31 27.5 32 41.5 33 49.0 34 56.5 35 71.0 36 96.5 37 125.0 38 143.0 39 166.5 40 201.0 41 214.5 42 218.5 43 236.0 44 258.5 45 261.5 46 256.0 47 244.5 48 227.5 49 203.0 50 165.5 51 138.5 52 117.0 53 108.0 54 83.0 55 56.0 56 42.5 57 29.5 58 25.0 59 20.5 60 15.0 61 10.5 62 5.0 63 3.0 64 3.0 65 2.5 66 2.0 67 1.0 68 0.0 69 0.5 70 1.0 71 1.0 72 0.5 73 0.5 74 0.5 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.175 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.015 95-99 0.015 100-104 0.005 105-109 0.005 110-114 0.01 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.015 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72424166457759 99.45 2 0.2757583354224116 0.5499999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.037500000000000006 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1375 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.25 0.0 0.0 0.0 0.0 92-93 0.4 0.0 0.0 0.0 0.0 94-95 0.4125 0.0 0.0 0.0 0.0 96-97 0.5 0.0 0.0 0.0 0.0 98-99 0.5625 0.0 0.0 0.0 0.0 100-101 0.575 0.0 0.0 0.0 0.0 102-103 0.85 0.0 0.0 0.0 0.0 104-105 0.975 0.0 0.0 0.0 0.0 106-107 1.125 0.0 0.0 0.0 0.0 108-109 1.5625 0.0 0.0 0.0 0.0 110-111 2.3875 0.0 0.0 0.0 0.0 112-113 2.6125 0.0 0.0 0.0 0.0 114-115 2.9625000000000004 0.0 0.0 0.0 0.0 116-117 3.7 0.0 0.0 0.0 0.0 118-119 3.8 0.0 0.0 0.0 0.0 120-121 4.4625 0.0 0.0 0.0 0.0 122-123 4.9625 0.0 0.0 0.0 0.0 124-125 5.125 0.0 0.0 0.0 0.0 126-127 5.75 0.0 0.0 0.0 0.0 128-129 5.9375 0.0 0.0 0.0 0.0 130-131 6.4625 0.0 0.0 0.0 0.0 132-133 6.775 0.0 0.0 0.0 0.0 134-135 8.3375 0.0 0.0 0.0 0.0 136-137 9.5875 0.0 0.0 0.0 0.0 138 10.85 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATCATAT 10 0.0069772652 143.975 6 CATACCT 10 0.0069772652 143.975 9 TCATATC 10 0.0069772652 143.975 7 >>END_MODULE SRR1799527 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR1799527_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.74675 34.0 31.0 34.0 31.0 34.0 2 32.855 34.0 33.0 34.0 31.0 34.0 3 32.99125 34.0 33.0 34.0 31.0 34.0 4 36.306 37.0 37.0 37.0 35.0 37.0 5 36.30775 37.0 37.0 37.0 35.0 37.0 6 36.373 37.0 37.0 37.0 35.0 37.0 7 36.3775 37.0 37.0 37.0 35.0 37.0 8 36.285 37.0 37.0 37.0 35.0 37.0 9 38.16225 39.0 39.0 39.0 37.0 39.0 10-14 38.50005 39.4 39.2 39.4 37.2 39.4 15-19 39.74679999999999 41.0 40.0 41.0 38.0 41.0 20-24 39.66115 41.0 40.0 41.0 38.0 41.0 25-29 39.51595 41.0 40.0 41.0 37.8 41.0 30-34 39.530950000000004 41.0 40.0 41.0 38.0 41.0 35-39 39.38135 41.0 40.0 41.0 37.2 41.0 40-44 39.28165 41.0 40.0 41.0 37.0 41.0 45-49 39.1883 41.0 39.2 41.0 36.4 41.0 50-54 38.2341 39.6 38.0 40.4 34.6 40.6 55-59 38.59705 40.0 38.2 41.0 35.0 41.0 60-64 38.0108 39.6 37.2 41.0 34.4 41.0 65-69 37.4562 38.8 36.0 40.8 34.2 41.0 70-74 36.4483 37.0 35.0 39.2 34.0 41.0 75-79 35.414849999999994 35.8 35.0 37.4 33.4 39.2 80-84 34.6126 35.0 35.0 36.2 33.0 37.4 85-89 34.0518 35.0 35.0 35.4 32.8 36.4 90-94 33.725699999999996 35.0 34.8 35.0 32.0 36.0 95-99 33.466300000000004 35.0 34.0 35.0 31.4 35.2 100-104 33.39035 35.0 34.0 35.0 31.0 35.0 105-109 33.275850000000005 35.0 34.0 35.0 31.2 35.0 110-114 33.1469 35.0 34.0 35.0 30.8 35.0 115-119 32.945299999999996 35.0 34.0 35.0 30.2 35.0 120-124 32.698550000000004 35.0 34.0 35.0 29.4 35.0 125-129 32.543549999999996 35.0 33.6 35.0 29.0 35.0 130-134 32.332350000000005 35.0 33.0 35.0 29.0 35.0 135-139 32.097 35.0 33.0 35.0 27.8 35.0 140-144 31.742649999999998 34.2 32.8 35.0 26.2 35.0 145-149 31.155399999999997 34.0 32.0 35.0 25.0 35.0 150 28.399 32.0 27.0 34.0 17.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 23.0 3 2.0 4 4.0 5 2.0 6 1.0 7 0.0 8 1.0 9 2.0 10 6.0 11 3.0 12 4.0 13 3.0 14 3.0 15 3.0 16 3.0 17 5.0 18 5.0 19 7.0 20 6.0 21 5.0 22 3.0 23 13.0 24 3.0 25 13.0 26 12.0 27 26.0 28 24.0 29 31.0 30 38.0 31 43.0 32 59.0 33 100.0 34 173.0 35 386.0 36 1289.0 37 1676.0 38 23.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.324999999999996 19.125 12.65 29.9 2 26.650000000000002 25.575 32.324999999999996 15.45 3 20.775 27.425 31.724999999999998 20.075000000000003 4 24.05 32.675 24.375 18.9 5 25.724999999999998 35.35 22.725 16.2 6 18.7 40.550000000000004 23.025000000000002 17.724999999999998 7 21.4 21.75 38.1 18.75 8 21.45 24.675 31.175000000000004 22.7 9 23.65 23.75 30.85 21.75 10-14 23.375 29.17 26.685 20.77 15-19 23.72 27.29 28.22 20.77 20-24 23.22 28.225 27.83 20.724999999999998 25-29 23.44 28.605000000000004 27.500000000000004 20.455000000000002 30-34 23.412341234123414 28.027802780278027 28.01780178017802 20.54205420542054 35-39 23.72 28.04 27.615000000000002 20.625 40-44 24.044999999999998 27.589999999999996 28.499999999999996 19.865 45-49 23.3485022753413 27.78916837525629 27.664149622443368 21.198179726959044 50-54 23.096154807740387 28.286414320716034 27.85139256962848 20.766038301915096 55-59 23.377337733773377 27.93279327932793 28.36283628362836 20.327032703270326 60-64 23.330000000000002 28.26 27.79 20.62 65-69 23.111155557777888 27.936396819840994 28.07640382019101 20.876043802190107 70-74 23.482348234823483 27.17271727172717 28.28282828282828 21.062106210621064 75-79 22.86 28.455000000000002 28.555000000000003 20.13 80-84 23.235 27.68 28.599999999999998 20.485 85-89 22.97114855742787 29.13145657282864 27.731386569328464 20.16600830041502 90-94 23.93 27.565 28.63 19.875 95-99 23.625 27.139999999999997 28.335 20.9 100-104 23.315 27.650000000000002 28.46 20.575 105-109 23.835 27.975 27.894999999999996 20.294999999999998 110-114 23.79 27.785 28.515 19.91 115-119 24.165 27.965 27.839999999999996 20.03 120-124 24.66246624662466 27.627762776277624 27.627762776277624 20.08200820082008 125-129 24.17120856042802 27.43637181859093 28.116405820291014 20.276013800690034 130-134 24.911245562278115 27.92639631981599 27.366368318415923 19.795989799489973 135-139 25.115 28.025 27.54 19.32 140-144 25.73757375737574 28.467846784678468 26.527652765276528 19.266926692669266 145-149 26.272881864559366 28.6035810743223 26.22786836050815 18.895668700610184 150 28.507126781695426 27.45686421605401 24.431107776944234 19.604901225306325 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.5 21 0.5 22 0.5 23 1.0 24 1.0 25 2.0 26 4.5 27 6.5 28 9.5 29 14.0 30 17.5 31 19.5 32 36.0 33 52.0 34 56.5 35 65.5 36 87.0 37 110.0 38 128.5 39 160.5 40 191.5 41 220.5 42 258.5 43 270.0 44 250.5 45 264.5 46 278.0 47 253.5 48 242.0 49 215.5 50 168.5 51 139.0 52 117.0 53 103.5 54 77.5 55 45.0 56 31.5 57 22.0 58 17.5 59 14.0 60 8.5 61 8.0 62 6.5 63 4.0 64 3.5 65 3.0 66 3.5 67 3.0 68 1.5 69 1.0 70 0.5 71 0.5 72 1.0 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.01 35-39 0.0 40-44 0.0 45-49 0.015 50-54 0.005 55-59 0.01 60-64 0.0 65-69 0.005 70-74 0.01 75-79 0.0 80-84 0.0 85-89 0.005 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.01 125-129 0.005 130-134 0.005 135-139 0.0 140-144 0.01 145-149 0.03 150 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64877069744105 99.3 2 0.35122930255895635 0.7000000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.037500000000000006 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1375 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.25 0.0 0.0 0.0 0.0 92-93 0.4125 0.0 0.0 0.0 0.0 94-95 0.4375 0.0 0.0 0.0 0.0 96-97 0.525 0.0 0.0 0.0 0.0 98-99 0.5874999999999999 0.0 0.0 0.0 0.0 100-101 0.6 0.0 0.0 0.0 0.0 102-103 0.875 0.0 0.0 0.0 0.0 104-105 1.025 0.0 0.0 0.0 0.0 106-107 1.175 0.0 0.0 0.0 0.0 108-109 1.65 0.0 0.0 0.0 0.0 110-111 2.4875 0.0 0.0 0.0 0.0 112-113 2.7125 0.0 0.0 0.0 0.0 114-115 3.0625 0.0 0.0 0.0 0.0 116-117 3.7875 0.0 0.0 0.0 0.0 118-119 3.875 0.0 0.0 0.0 0.0 120-121 4.5625 0.0 0.0 0.0 0.0 122-123 5.0625 0.0 0.0 0.0 0.0 124-125 5.237500000000001 0.0 0.0 0.0 0.0 126-127 5.85 0.0 0.0 0.0 0.0 128-129 6.025 0.0 0.0 0.0 0.0 130-131 6.55 0.0 0.0 0.0 0.0 132-133 6.875 0.0 0.0 0.0 0.0 134-135 8.45 0.0 0.0 0.0 0.0 136-137 9.7125 0.0 0.0 0.0 0.0 138 11.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGATCTC 35 0.0036813593 20.571428 140-144 >>END_MODULE Read 1100460 spots for SRR1799527.sra Written 1100460 spots for SRR1799527.sra Read 1100460 spots for SRR1799527.sra Written 1100460 spots for SRR1799527.sra Read 1100460 spots for SRR1799527.sra Written 1100460 spots for SRR1799527.sra Read 1100460 spots for SRR1799527.sra Written 1100460 spots for SRR1799527.sra Read 1100460 spots for SRR1799527.sra Written 1100460 spots for SRR1799527.sra Read 1100460 spots for SRR1799527.sra Written 1100460 spots for SRR1799527.sra Read 1100460 spots for SRR1799527.sra Written 1100460 spots for SRR1799527.sra Read 1100460 spots for SRR1799527.sra Written 1100460 spots for SRR1799527.sra Read 1100460 spots for SRR1799527.sra Written 1100460 spots for SRR1799527.sra Read 1100460 spots for SRR1799527.sra Written 1100460 spots for SRR1799527.sra Read 1100460 spots for SRR1799527.sra Written 1100460 spots for SRR1799527.sra Read 1100461 spots for SRR1799527.sra Written 1100461 spots for SRR1799527.sra Read 1100460 spots for SRR1799527.sra Written 1100460 spots for SRR1799527.sra Read 1100460 spots for SRR1799527.sra Written 1100460 spots for SRR1799527.sra Read 1100460 spots for SRR1799527.sra Written 1100460 spots for SRR1799527.sra Read 1100460 spots for SRR1799527.sra Written 1100460 spots for SRR1799527.sra Read 1100460 spots for SRR1799527.sra Written 1100460 spots for SRR1799527.sra Read 1100460 spots for SRR1799527.sra Written 1100460 spots for SRR1799527.sra Read 1100460 spots for SRR1799527.sra Written 1100460 spots for SRR1799527.sra Read 1100460 spots for SRR1799527.sra Written 1100460 spots for SRR1799527.sra SRR ids: ['SRR1799527.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_dj6126yh SRR1799527.sra spots: 22009201 blocks: [[1, 1100460], [1100461, 2200920], [2200921, 3301380], [3301381, 4401840], [4401841, 5502300], [5502301, 6602760], [6602761, 7703220], [7703221, 8803680], [8803681, 9904140], [9904141, 11004600], [11004601, 12105060], [12105061, 13205520], [13205521, 14305980], [14305981, 15406440], [15406441, 16506900], [16506901, 17607360], [17607361, 18707820], [18707821, 19808280], [19808281, 20908740], [20908741, 22009201]] SRR1799527 file size 7393508 SRR1799527 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR1799527 SRR1799527_1.fastq SRR1799527_2.fastq Input file: SRR1799527_1.fastq Paired file: SRR1799527_2.fastq trimmed: SRR1799527-trimmed-pair1.fastq, SRR1799527-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 20:38:14 2025 >> started Thu Feb 13 20:38:41 2025 >> done (27.454s) 22009201 read pairs processed; of these: 56264 ( 0.26%) short read pairs filtered out after trimming by size control 118186 ( 0.54%) empty read pairs filtered out after trimming by size control 21834751 (99.21%) read pairs available; of these: 7840779 (35.91%) trimmed read pairs available after processing 13993972 (64.09%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 5 0.00% 20 3 0.00% 21 8 0.00% 22 15 0.00% 23 16 0.00% 24 27 0.00% 25 49 0.00% 26 43 0.00% 27 53 0.00% 28 87 0.00% 29 93 0.00% 30 101 0.00% 31 113 0.00% 32 167 0.00% 33 204 0.00% 34 202 0.00% 35 261 0.00% 36 253 0.00% 37 303 0.00% 38 347 0.00% 39 386 0.00% 40 403 0.00% 41 444 0.00% 42 483 0.00% 43 549 0.00% 44 567 0.00% 45 616 0.00% 46 695 0.00% 47 790 0.00% 48 905 0.00% 49 951 0.00% 50 996 0.00% 51 1030 0.00% 52 1113 0.01% 53 1190 0.01% 54 1250 0.01% 55 1340 0.01% 56 1524 0.01% 57 1645 0.01% 58 2278 0.01% 59 2128 0.01% 60 2363 0.01% 61 2329 0.01% 62 2527 0.01% 63 2715 0.01% 64 3247 0.01% 65 3601 0.02% 66 3963 0.02% 67 4584 0.02% 68 4929 0.02% 69 4706 0.02% 70 5327 0.02% 71 5901 0.03% 72 6513 0.03% 73 6826 0.03% 74 7061 0.03% 75 6633 0.03% 76 6101 0.03% 77 5615 0.03% 78 5265 0.02% 79 5242 0.02% 80 4594 0.02% 81 4858 0.02% 82 5267 0.02% 83 5672 0.03% 84 10132 0.05% 85 10456 0.05% 86 11464 0.05% 87 12467 0.06% 88 13257 0.06% 89 14181 0.06% 90 23585 0.11% 91 27290 0.12% 92 17518 0.08% 93 17489 0.08% 94 18685 0.09% 95 31916 0.15% 96 30398 0.14% 97 22974 0.11% 98 19606 0.09% 99 19900 0.09% 100 19492 0.09% 101 42066 0.19% 102 50781 0.23% 103 25477 0.12% 104 26775 0.12% 105 58208 0.27% 106 44991 0.21% 107 45877 0.21% 108 99668 0.46% 109 121722 0.56% 110 42513 0.19% 111 52112 0.24% 112 27742 0.13% 113 29124 0.13% 114 82289 0.38% 115 170607 0.78% 116 50412 0.23% 117 38663 0.18% 118 26683 0.12% 119 72961 0.33% 120 158920 0.73% 121 75787 0.35% 122 29876 0.14% 123 29466 0.13% 124 68892 0.32% 125 101324 0.46% 126 65784 0.30% 127 32567 0.15% 128 30579 0.14% 129 124584 0.57% 130 80204 0.37% 131 45677 0.21% 132 85035 0.39% 133 205025 0.94% 134 191861 0.88% 135 131923 0.60% 136 203588 0.93% 137 222998 1.02% 138 210775 0.97% 139 229020 1.05% 140 223907 1.03% 141 238090 1.09% 142 248179 1.14% 143 263421 1.21% 144 279868 1.28% 145 298992 1.37% 146 337584 1.55% 147 409407 1.88% 148 541596 2.48% 149 1106896 5.07% 150 13993972 64.09% 21834751 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=7.77 fanout-score-rank=11 prefix-density=0.23 prefix-fanout=4.9 sequence=GGTGCTGGAGCTGGAGC criterion=fanout-score sequence-density=0.09 sequence-density-rank=21 fanout-score=218.09 fanout-score-rank=1 prefix-density=0.79 prefix-fanout=26.0 sequence=TCATCATCATCA criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=18.02 fanout-score-rank=5 prefix-density=0.35 prefix-fanout=9.3 sequence=AGGTTCTTGAAGACAGCTGCATACGGACATTTTGGAAGGGATGACCCAGACTTCACCTGGGAAGTCGTCAAGCCCCTCAAATGGGAGAAGCCTCAAGCTTAAGAGTGATTTATCCTATCCCTTTTGCGCAATGCTTATTTTACTGGTACTTATGAATAATTCGGTTTGTCTTGCTGGTGGTCTATAATCGTTAGCTATCCTCAATGGTCTAATCTCATACATTAAGATACCCTATTCATTTTAAGTTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=44 fanout-score=246.60 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=16.2 sequence=AGAAAGAGATCGTAGTTTAATTAGAAGATATACACAATAATGGCCACCAACGGAGAGGAACAGCAAAGTCAGGCAGGAAGGCACCAGGAAGTTGGCCACAAGAGCCTTTTGCAAAGTGACGCTCTTTACCAGTATATTCTCGAGACTAGTGTGTATCCAAGAGAGCCTGAATGCATGAAGGAGCTCAGGGAGGTGACTGCCAAGCATCCTTGGAACATCATGACCACATCTGCTGATGAAGGGCAATTCTTGAATATGCTTTTGAAGCTTGTCAATGCCAAGAACACCATGGAGATCGGTGTTTACACTGGCTATTCTCTCTTGGCCACTGCCCTGGCTATCCCTGAGGATGGCAAGATCTTGGCTATGGACATCAACAGAGAAAACTATGAATTGGGTCTCCCAGTAATTCAGAAAGCTGGTGTTGCGCACAAGATTGATTTCAAGGAAGGCCCTGCTCTACCAGTTCTTGATCAAATGATTGAAGATGGGAAGTGCCATGGAAGTTTTG SRR1799527 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 20:40:02 Started mapping on | Feb 13 20:40:03 Finished on | Feb 13 20:42:53 Mapping speed, Million of reads per hour | 462.38 Number of input reads | 21834751 Average input read length | 275 UNIQUE READS: Uniquely mapped reads number | 17189079 Uniquely mapped reads % | 78.72% Average mapped length | 271.61 Number of splices: Total | 13680520 Number of splices: Annotated (sjdb) | 13286437 Number of splices: GT/AG | 13386138 Number of splices: GC/AG | 164001 Number of splices: AT/AC | 13613 Number of splices: Non-canonical | 116768 Mismatch rate per base, % | 1.21% Deletion rate per base | 0.09% Deletion average length | 2.92 Insertion rate per base | 0.06% Insertion average length | 2.59 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 686425 % of reads mapped to multiple loci | 3.14% Number of reads mapped to too many loci | 50484 % of reads mapped to too many loci | 0.23% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 17.83% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 4029103 4029103 4029103 N_multimapping 686425 686425 686425 N_noFeature 533470 16949695 640051 N_ambiguous 422001 2762 287486 UnstrandedReadsAssigned:16233608 PositiveStrandReadsAssigned:236622 NegativeStrandReadsAssigned:16261542 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=145 echo kmer=141 SRR1799527 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR1799527-trimmed-pair1.fastq SRR1799527-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,834,751 reads, 18,681,897 reads pseudoaligned [quant] estimated average fragment length: 181.033 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,033 rounds 52401 SRR1799527.ke.tsv 34699 SRR1799527.se.tsv 87100 total ==> SRR1799527.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1837.97 796 27.2426 Potri.005G024800.1.v4.1 1035 854.967 540 39.7299 Potri.004G059700.1.v4.1 961 780.967 27 2.17472 Potri.007G009000.2.v4.1 1416 1235.97 0 0 Potri.003G141000.2.v4.1 2943 2762.97 314.224 7.15379 Potri.016G087400.1.v4.1 270 106.811 1858 1094.21 Potri.015G069301.1.v4.1 564 384.573 0 0 Potri.010G195200.1.v4.1 1773 1592.97 13 0.513345 Potri.012G127500.1.v4.1 977 796.967 4779 377.198 ==> SRR1799527.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1319 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 380 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 7 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR1799527 completed mapping pipeline successfully