Starting /dee2/code/volunteer_pipeline.sh SRR1799528 current disk space = 3087880941568 free memory = 1580194612 SRR1799528 SRAfilesize 5a4a63811a85ebae9cfff8748610f050 SRR1799528.sra SRR1799528.sra file validated SRR1799528 is paired end SRR1799528 is conventional basespace SRR1799528 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR1799528_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.384 34.0 34.0 34.0 33.0 34.0 2 33.57075 34.0 34.0 34.0 33.0 34.0 3 33.70925 34.0 34.0 34.0 33.0 34.0 4 36.85725 37.0 37.0 37.0 37.0 37.0 5 36.833 37.0 37.0 37.0 37.0 37.0 6 36.8355 37.0 37.0 37.0 37.0 37.0 7 36.85075 37.0 37.0 37.0 37.0 37.0 8 36.8325 37.0 37.0 37.0 37.0 37.0 9 38.807 39.0 39.0 39.0 39.0 39.0 10-14 39.1357 39.4 39.4 39.4 39.0 39.4 15-19 40.56585 41.0 41.0 41.0 40.0 41.0 20-24 40.52705 41.0 41.0 41.0 40.0 41.0 25-29 40.46084999999999 41.0 41.0 41.0 39.4 41.0 30-34 40.35665 41.0 40.0 41.0 39.0 41.0 35-39 40.220749999999995 41.0 40.0 41.0 38.6 41.0 40-44 40.2013 41.0 40.0 41.0 38.8 41.0 45-49 40.28105000000001 41.0 40.6 41.0 39.0 41.0 50-54 40.11705 41.0 40.0 41.0 38.4 41.0 55-59 39.82025 41.0 39.6 41.0 37.0 41.0 60-64 39.30505 40.8 38.8 41.0 35.4 41.0 65-69 38.52835 39.4 36.8 41.0 35.0 41.0 70-74 37.52910000000001 37.8 35.6 39.6 35.0 41.0 75-79 36.12165 36.0 34.8 37.6 34.0 39.4 80-84 35.6129 35.2 35.0 36.6 35.0 37.8 85-89 35.051849999999995 35.0 35.0 35.8 34.0 36.6 90-94 34.76780000000001 35.0 35.0 35.0 34.0 36.0 95-99 34.6057 35.0 35.0 35.0 34.0 35.8 100-104 34.5369 35.0 35.0 35.0 34.0 35.0 105-109 34.49255 35.0 35.0 35.0 34.0 35.0 110-114 34.38394999999999 35.0 35.0 35.0 33.8 35.0 115-119 34.311 35.0 35.0 35.0 33.4 35.0 120-124 34.18990000000001 35.0 34.6 35.0 32.8 35.0 125-129 34.0681 35.0 34.0 35.0 32.8 35.0 130-134 33.9548 35.0 34.0 35.0 32.4 35.0 135-139 33.8262 35.0 34.0 35.0 32.4 35.0 140-144 33.56355 35.0 34.0 35.0 31.6 35.0 145-149 33.07875 35.0 33.6 35.0 30.8 35.0 150 27.01425 33.0 24.0 35.0 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 1.0 10 0.0 11 2.0 12 0.0 13 1.0 14 1.0 15 1.0 16 1.0 17 1.0 18 2.0 19 0.0 20 0.0 21 4.0 22 2.0 23 3.0 24 1.0 25 2.0 26 6.0 27 5.0 28 5.0 29 15.0 30 9.0 31 10.0 32 19.0 33 51.0 34 75.0 35 211.0 36 1081.0 37 2433.0 38 57.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.15577889447236 9.849246231155778 6.984924623115578 42.01005025125628 2 23.400000000000002 14.399999999999999 34.425 27.775 3 19.325 16.1 24.5 40.075 4 24.075 23.974999999999998 22.650000000000002 29.299999999999997 5 23.35 29.775000000000002 23.65 23.225 6 19.15 36.425000000000004 22.650000000000002 21.775 7 14.524999999999999 28.775000000000002 39.425 17.275 8 16.925 26.724999999999998 32.675 23.674999999999997 9 17.424999999999997 23.549999999999997 34.9 24.125 10-14 19.575 30.745 27.445000000000004 22.235 15-19 19.445 29.425 27.355 23.775 20-24 19.75 29.189999999999998 27.0 24.060000000000002 25-29 19.295 29.865000000000002 27.310000000000002 23.53 30-34 19.99 29.765000000000004 26.540000000000003 23.705000000000002 35-39 19.27 29.349999999999998 27.034999999999997 24.345 40-44 19.715 29.725 27.439999999999998 23.119999999999997 45-49 20.075000000000003 28.975 26.99 23.96 50-54 20.47 28.884999999999998 27.27 23.375 55-59 19.93 28.88 26.919999999999998 24.27 60-64 20.064999999999998 28.875 26.765 24.295 65-69 19.564999999999998 28.945 27.48 24.01 70-74 20.24 29.425 27.025 23.31 75-79 20.426021301065052 29.22146107305365 26.776338816940846 23.576178808940448 80-84 20.294999999999998 28.585 27.584999999999997 23.535 85-89 20.544999999999998 28.665000000000003 27.04 23.75 90-94 20.156046814044213 28.11343403020906 27.45823747124137 24.27228168450535 95-99 20.40520260130065 29.174587293646827 26.813406703351678 23.60680340170085 100-104 20.05001250312578 29.147286821705425 27.516879219804952 23.28582145536384 105-109 20.979195839167833 28.680736147229446 26.630326065213044 23.709741948389677 110-114 21.06869465152349 28.908790713964077 25.991894731575528 24.03061990293691 115-119 21.399629833425042 28.4828172677705 26.646991146015708 23.470561752788754 120-124 20.785 28.605000000000004 26.424999999999997 24.185000000000002 125-129 20.495 28.315 26.685 24.505 130-134 20.392039203920394 28.61286128612861 26.447644764476447 24.547454745474546 135-139 20.76830732292917 29.481792717086837 25.85534213685474 23.89455782312925 140-144 21.98219821982198 28.782878287828783 24.962496249624962 24.272427242724273 145-149 22.439999999999998 29.345 24.785 23.43 150 16.408204102051023 31.86593296648324 24.437218609304654 27.288644322161083 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 1.0 24 2.0 25 1.5 26 3.5 27 7.0 28 10.0 29 15.0 30 18.5 31 25.0 32 37.5 33 48.0 34 60.5 35 73.0 36 77.5 37 93.0 38 126.0 39 167.0 40 214.5 41 225.5 42 240.0 43 251.5 44 242.5 45 266.5 46 275.5 47 258.5 48 230.0 49 196.5 50 166.5 51 138.5 52 117.0 53 92.5 54 69.5 55 57.5 56 51.5 57 38.5 58 23.5 59 21.0 60 17.5 61 11.5 62 5.5 63 2.0 64 3.5 65 3.5 66 4.0 67 4.0 68 1.5 69 0.0 70 0.5 71 0.5 72 1.0 73 1.0 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.005 80-84 0.0 85-89 0.0 90-94 0.03 95-99 0.05 100-104 0.025 105-109 0.02 110-114 0.065 115-119 0.045 120-124 0.0 125-129 0.0 130-134 0.01 135-139 0.04 140-144 0.01 145-149 0.0 150 0.05 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79959919839679 99.6 2 0.2004008016032064 0.4 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.225 0.0 0.0 0.0 0.0 78-79 0.3375 0.0 0.0 0.0 0.0 80-81 0.35 0.0 0.0 0.0 0.0 82-83 0.4 0.0 0.0 0.0 0.0 84-85 0.4125 0.0 0.0 0.0 0.0 86-87 0.425 0.0 0.0 0.0 0.0 88-89 0.425 0.0 0.0 0.0 0.0 90-91 0.4625 0.0 0.0 0.0 0.0 92-93 0.5625 0.0 0.0 0.0 0.0 94-95 0.8 0.0 0.0 0.0 0.0 96-97 0.9375 0.0 0.0 0.0 0.0 98-99 1.1875 0.0 0.0 0.0 0.0 100-101 1.65 0.0 0.0 0.0 0.0 102-103 1.975 0.0 0.0 0.0 0.0 104-105 2.3625 0.0 0.0 0.0 0.0 106-107 3.2874999999999996 0.0 0.0 0.0 0.0 108-109 4.0375 0.0 0.0 0.0 0.0 110-111 4.875 0.0 0.0 0.0 0.0 112-113 5.775 0.0 0.0 0.0 0.0 114-115 6.362500000000001 0.0 0.0 0.0 0.0 116-117 7.487500000000001 0.0 0.0 0.0 0.0 118-119 7.862500000000001 0.0 0.0 0.0 0.0 120-121 8.1375 0.0 0.0 0.0 0.0 122-123 8.4125 0.0 0.0 0.0 0.0 124-125 8.925 0.0 0.0 0.0 0.0 126-127 9.4625 0.0 0.0 0.0 0.0 128-129 10.1875 0.0 0.0 0.0 0.0 130-131 11.0125 0.0 0.0 0.0 0.0 132-133 11.875 0.0 0.0 0.0 0.0 134-135 13.5 0.0 0.0 0.0 0.0 136-137 15.425 0.0 0.0 0.0 0.0 138 16.875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCATTAC 10 0.0069754543 143.9875 8 GAAGAGC 85 2.1381963E-4 13.551765 140-144 GATCGGA 100 8.426646E-4 11.519 135-139 AAGAGCA 95 0.0076671215 10.609606 140-144 >>END_MODULE SRR1799528 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR1799528_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.409 34.0 34.0 34.0 33.0 34.0 2 33.4555 34.0 34.0 34.0 33.0 34.0 3 33.52025 34.0 34.0 34.0 33.0 34.0 4 36.61075 37.0 37.0 37.0 37.0 37.0 5 36.59675 37.0 37.0 37.0 37.0 37.0 6 36.618 37.0 37.0 37.0 37.0 37.0 7 36.57925 37.0 37.0 37.0 37.0 37.0 8 36.56375 37.0 37.0 37.0 37.0 37.0 9 38.50875 39.0 39.0 39.0 39.0 39.0 10-14 38.884449999999994 39.4 39.4 39.4 39.2 39.4 15-19 40.312149999999995 41.0 41.0 41.0 40.0 41.0 20-24 40.248200000000004 41.0 41.0 41.0 39.4 41.0 25-29 40.19405 41.0 41.0 41.0 39.0 41.0 30-34 40.09525 41.0 40.4 41.0 39.0 41.0 35-39 40.023700000000005 41.0 40.0 41.0 39.0 41.0 40-44 39.90195 41.0 40.0 41.0 38.4 41.0 45-49 39.8438 41.0 40.0 41.0 38.2 41.0 50-54 39.0479 40.2 39.0 40.6 36.8 41.0 55-59 39.30565 41.0 39.0 41.0 36.4 41.0 60-64 38.7425 40.2 37.8 41.0 35.0 41.0 65-69 38.17495 39.2 36.6 41.0 35.0 41.0 70-74 37.14815 37.4 35.4 39.6 35.0 41.0 75-79 36.09955 36.2 35.0 37.8 35.0 39.6 80-84 35.2512 35.0 35.0 36.4 34.4 37.8 85-89 34.7208 35.0 35.0 35.6 34.0 36.6 90-94 34.46 35.0 35.0 35.0 34.0 36.0 95-99 34.35504999999999 35.0 35.0 35.0 34.0 35.8 100-104 34.239050000000006 35.0 35.0 35.0 34.0 35.0 105-109 34.1851 35.0 35.0 35.0 34.0 35.0 110-114 34.11295 35.0 35.0 35.0 33.4 35.0 115-119 34.02695 35.0 35.0 35.0 33.0 35.0 120-124 33.873000000000005 35.0 34.8 35.0 32.8 35.0 125-129 33.75745 35.0 34.0 35.0 32.6 35.0 130-134 33.56395 35.0 34.0 35.0 31.8 35.0 135-139 33.36435 35.0 34.0 35.0 31.4 35.0 140-144 33.134249999999994 35.0 34.0 35.0 31.0 35.0 145-149 32.773700000000005 35.0 33.8 35.0 30.6 35.0 150 29.379 32.0 29.0 34.0 20.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 27.0 3 0.0 4 0.0 5 1.0 6 0.0 7 0.0 8 1.0 9 1.0 10 1.0 11 2.0 12 0.0 13 2.0 14 0.0 15 1.0 16 1.0 17 0.0 18 2.0 19 2.0 20 4.0 21 3.0 22 7.0 23 6.0 24 3.0 25 2.0 26 4.0 27 6.0 28 5.0 29 10.0 30 13.0 31 16.0 32 29.0 33 34.0 34 75.0 35 239.0 36 1095.0 37 2342.0 38 66.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.775000000000006 19.3 12.3 31.624999999999996 2 24.825 26.075 33.425 15.675 3 21.375 26.6 31.25 20.775 4 24.2 31.874999999999996 24.4 19.525000000000002 5 24.975 35.325 23.25 16.45 6 21.625 38.525 22.375 17.474999999999998 7 20.325 23.150000000000002 37.175000000000004 19.35 8 22.25 24.15 30.5 23.1 9 23.411705852926463 24.68734367183592 29.48974487243622 22.411205602801402 10-14 24.382438243824385 28.57285728572857 26.782678267826782 20.262026202620262 15-19 24.13 27.74 27.73 20.4 20-24 23.724999999999998 28.065 27.555000000000003 20.655 25-29 24.05 27.96 27.439999999999998 20.549999999999997 30-34 23.288150852798477 27.824738658530485 28.129845445906064 20.75726504276497 35-39 23.875 27.805000000000003 28.139999999999997 20.18 40-44 23.544999999999998 27.68 28.355000000000004 20.419999999999998 45-49 23.598259390786776 26.59430800780273 28.89511328965138 20.912319311759113 50-54 24.03980796159232 27.545509101820365 27.895579115823168 20.519103820764155 55-59 24.249849969994 27.630526105221044 28.245649129825967 19.873974794958993 60-64 23.937393739373938 27.807780778077806 28.377837783778375 19.876987698769877 65-69 23.544708941788357 27.81056211242248 28.230646129225846 20.41408281656331 70-74 23.54559551798309 27.472362563153418 28.88799959981992 20.09404231904357 75-79 23.411170558527928 27.236361818090906 28.85644282214111 20.49602480124006 80-84 23.885 26.790000000000003 28.884999999999998 20.44 85-89 23.82595648912228 28.02200550137534 27.956989247311824 20.19504876219055 90-94 23.74 27.565 29.134999999999998 19.56 95-99 24.154999999999998 27.415 28.849999999999998 19.580000000000002 100-104 24.36 27.639999999999997 28.265 19.735 105-109 23.96739673967397 27.102710271027103 28.677867786778677 20.25202520252025 110-114 24.825 27.55 27.865000000000002 19.759999999999998 115-119 25.435000000000002 27.29 27.665 19.61 120-124 25.34887210523683 27.399589856449758 27.35957585154804 19.89196218676537 125-129 25.566278313915696 26.916345817290864 28.511425571278565 19.005950297514875 130-134 26.178926839025852 28.264239635945394 26.929039355903384 18.62779416912537 135-139 25.88758875887589 29.1979197919792 26.41764176417642 18.496849684968495 140-144 27.323196959087724 28.473542062618783 26.242872861858558 17.96038811643493 145-149 27.92454718302812 27.364154908435907 25.813069148403883 18.898228760132092 150 30.08008008008008 24.724724724724727 25.650650650650654 19.544544544544546 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.5 9 1.0 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.5 20 0.5 21 0.0 22 0.0 23 0.0 24 0.5 25 2.0 26 2.0 27 1.5 28 5.0 29 8.0 30 17.0 31 26.0 32 26.5 33 36.5 34 54.0 35 68.0 36 88.0 37 116.5 38 134.0 39 153.5 40 187.5 41 219.0 42 240.5 43 248.5 44 276.5 45 301.0 46 285.5 47 253.0 48 233.5 49 206.0 50 161.5 51 150.5 52 133.5 53 91.5 54 62.5 55 48.0 56 37.0 57 27.0 58 25.0 59 22.0 60 10.0 61 7.0 62 8.5 63 5.5 64 4.5 65 3.0 66 2.5 67 3.0 68 1.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.05 10-14 0.01 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.034999999999999996 35-39 0.0 40-44 0.0 45-49 0.034999999999999996 50-54 0.02 55-59 0.02 60-64 0.01 65-69 0.02 70-74 0.045 75-79 0.005 80-84 0.0 85-89 0.025 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.01 110-114 0.0 115-119 0.0 120-124 0.034999999999999996 125-129 0.005 130-134 0.015 135-139 0.01 140-144 0.03 145-149 0.06999999999999999 150 0.1 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69909729187563 99.4 2 0.3009027081243731 0.6 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.225 0.0 0.0 0.0 0.0 78-79 0.3375 0.0 0.0 0.0 0.0 80-81 0.35 0.0 0.0 0.0 0.0 82-83 0.4 0.0 0.0 0.0 0.0 84-85 0.4125 0.0 0.0 0.0 0.0 86-87 0.425 0.0 0.0 0.0 0.0 88-89 0.425 0.0 0.0 0.0 0.0 90-91 0.4625 0.0 0.0 0.0 0.0 92-93 0.5625 0.0 0.0 0.0 0.0 94-95 0.8 0.0 0.0 0.0 0.0 96-97 0.9375 0.0 0.0 0.0 0.0 98-99 1.1875 0.0 0.0 0.0 0.0 100-101 1.65 0.0 0.0 0.0 0.0 102-103 1.975 0.0 0.0 0.0 0.0 104-105 2.3375000000000004 0.0 0.0 0.0 0.0 106-107 3.2625 0.0 0.0 0.0 0.0 108-109 4.0125 0.0 0.0 0.0 0.0 110-111 4.8375 0.0 0.0 0.0 0.0 112-113 5.725 0.0 0.0 0.0 0.0 114-115 6.3125 0.0 0.0 0.0 0.0 116-117 7.4625 0.0 0.0 0.0 0.0 118-119 7.8375 0.0 0.0 0.0 0.0 120-121 8.125 0.0 0.0 0.0 0.0 122-123 8.399999999999999 0.0 0.0 0.0 0.0 124-125 8.9 0.0 0.0 0.0 0.0 126-127 9.4375 0.0 0.0 0.0 0.0 128-129 10.162500000000001 0.0 0.0 0.0 0.0 130-131 10.95 0.0 0.0 0.0 0.0 132-133 11.825 0.0 0.0 0.0 0.0 134-135 13.475000000000001 0.0 0.0 0.0 0.0 136-137 15.375 0.0 0.0 0.0 0.0 138 16.8 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTTGTTC 10 0.006973645 144.0 6 TGTTGTT 25 8.956223E-4 86.399994 5 CTGTTGT 25 8.956223E-4 86.399994 4 GAGCGTC 65 0.007995365 13.292308 140-144 AAGAGCG 80 0.0021206664 12.599999 140-144 GATCGGA 105 0.0012671922 10.971428 135-139 GAAGAGC 105 0.0012671922 10.971428 140-144 >>END_MODULE Read 876971 spots for SRR1799528.sra Written 876971 spots for SRR1799528.sra Read 876971 spots for SRR1799528.sra Written 876971 spots for SRR1799528.sra Read 876971 spots for SRR1799528.sra Written 876971 spots for SRR1799528.sra Read 876971 spots for SRR1799528.sra Written 876971 spots for SRR1799528.sra Read 876971 spots for SRR1799528.sra Written 876971 spots for SRR1799528.sra Read 876971 spots for SRR1799528.sra Written 876971 spots for SRR1799528.sra Read 876971 spots for SRR1799528.sra Written 876971 spots for SRR1799528.sra Read 876971 spots for SRR1799528.sra Written 876971 spots for SRR1799528.sra Read 876971 spots for SRR1799528.sra Written 876971 spots for SRR1799528.sra Read 876971 spots for SRR1799528.sra Written 876971 spots for SRR1799528.sra Read 876971 spots for SRR1799528.sra Written 876971 spots for SRR1799528.sra Read 876971 spots for SRR1799528.sra Written 876971 spots for SRR1799528.sra Read 876971 spots for SRR1799528.sra Written 876971 spots for SRR1799528.sra Read 876971 spots for SRR1799528.sra Written 876971 spots for SRR1799528.sra Read 876971 spots for SRR1799528.sra Written 876971 spots for SRR1799528.sra Read 876971 spots for SRR1799528.sra Written 876971 spots for SRR1799528.sra Read 876971 spots for SRR1799528.sra Written 876971 spots for SRR1799528.sra Read 876971 spots for SRR1799528.sra Written 876971 spots for SRR1799528.sra Read 876971 spots for SRR1799528.sra Written 876971 spots for SRR1799528.sra Read 876980 spots for SRR1799528.sra Written 876980 spots for SRR1799528.sra SRR ids: ['SRR1799528.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_6_lqe8ng SRR1799528.sra spots: 17539429 blocks: [[1, 876971], [876972, 1753942], [1753943, 2630913], [2630914, 3507884], [3507885, 4384855], [4384856, 5261826], [5261827, 6138797], [6138798, 7015768], [7015769, 7892739], [7892740, 8769710], [8769711, 9646681], [9646682, 10523652], [10523653, 11400623], [11400624, 12277594], [12277595, 13154565], [13154566, 14031536], [14031537, 14908507], [14908508, 15785478], [15785479, 16662449], [16662450, 17539429]] SRR1799528 file size 5887579 SRR1799528 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR1799528 SRR1799528_1.fastq SRR1799528_2.fastq Input file: SRR1799528_1.fastq Paired file: SRR1799528_2.fastq trimmed: SRR1799528-trimmed-pair1.fastq, SRR1799528-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 20:51:48 2025 >> started Thu Feb 13 20:52:07 2025 >> done (18.607s) 17539429 read pairs processed; of these: 37542 ( 0.21%) short read pairs filtered out after trimming by size control 97494 ( 0.56%) empty read pairs filtered out after trimming by size control 17404393 (99.23%) read pairs available; of these: 6449563 (37.06%) trimmed read pairs available after processing 10954830 (62.94%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 1 0.00% 20 2 0.00% 21 9 0.00% 22 7 0.00% 23 13 0.00% 24 18 0.00% 25 16 0.00% 26 25 0.00% 27 32 0.00% 28 36 0.00% 29 45 0.00% 30 56 0.00% 31 69 0.00% 32 78 0.00% 33 92 0.00% 34 116 0.00% 35 140 0.00% 36 144 0.00% 37 147 0.00% 38 190 0.00% 39 198 0.00% 40 209 0.00% 41 226 0.00% 42 249 0.00% 43 269 0.00% 44 316 0.00% 45 348 0.00% 46 410 0.00% 47 424 0.00% 48 408 0.00% 49 447 0.00% 50 495 0.00% 51 529 0.00% 52 611 0.00% 53 628 0.00% 54 692 0.00% 55 761 0.00% 56 810 0.00% 57 905 0.01% 58 961 0.01% 59 1113 0.01% 60 1191 0.01% 61 1279 0.01% 62 1394 0.01% 63 1604 0.01% 64 1756 0.01% 65 1950 0.01% 66 2200 0.01% 67 3245 0.02% 68 3530 0.02% 69 2895 0.02% 70 3197 0.02% 71 3700 0.02% 72 4267 0.02% 73 4744 0.03% 74 5330 0.03% 75 5901 0.03% 76 6350 0.04% 77 6043 0.03% 78 5523 0.03% 79 4911 0.03% 80 4417 0.03% 81 3959 0.02% 82 3393 0.02% 83 3599 0.02% 84 6436 0.04% 85 6582 0.04% 86 7602 0.04% 87 8970 0.05% 88 10141 0.06% 89 9570 0.05% 90 10466 0.06% 91 11098 0.06% 92 19384 0.11% 93 17037 0.10% 94 11424 0.07% 95 12631 0.07% 96 13897 0.08% 97 13397 0.08% 98 33299 0.19% 99 48435 0.28% 100 14251 0.08% 101 13076 0.08% 102 45019 0.26% 103 22842 0.13% 104 19347 0.11% 105 74222 0.43% 106 80850 0.46% 107 28159 0.16% 108 48896 0.28% 109 42998 0.25% 110 54780 0.31% 111 35799 0.21% 112 65391 0.38% 113 21134 0.12% 114 37241 0.21% 115 127357 0.73% 116 63751 0.37% 117 25874 0.15% 118 17149 0.10% 119 19105 0.11% 120 21985 0.13% 121 46943 0.27% 122 46655 0.27% 123 63238 0.36% 124 25033 0.14% 125 23008 0.13% 126 76534 0.44% 127 51394 0.30% 128 26910 0.15% 129 41585 0.24% 130 137025 0.79% 131 58382 0.34% 132 45960 0.26% 133 147575 0.85% 134 157652 0.91% 135 138196 0.79% 136 153136 0.88% 137 160306 0.92% 138 163006 0.94% 139 172820 0.99% 140 175662 1.01% 141 179111 1.03% 142 184702 1.06% 143 185299 1.06% 144 197089 1.13% 145 217644 1.25% 146 248477 1.43% 147 285504 1.64% 148 398283 2.29% 149 1424213 8.18% 150 10954830 62.94% 17404393 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=4.67 fanout-score-rank=32 prefix-density=0.25 prefix-fanout=3.3 sequence=CTCCACACTTGTA criterion=fanout-score sequence-density=0.06 sequence-density-rank=36 fanout-score=399.52 fanout-score-rank=1 prefix-density=0.75 prefix-fanout=31.4 sequence=TCTTCTTCTTCCT criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=3.32 fanout-score-rank=31 prefix-density=0.20 prefix-fanout=2.8 sequence=TGGCTCCTTGTGCATCAGCAGCACAGGATGAGAATTCTTCAGTTTCGAGCCAGTGCTGCGCTCGGGTGAAGAAAATTGGACAGAACCCAGCGTGCCTTTGTGCTGTTATGCTTTCCAAAACTGCTAAGAGCTCTGGAATCAAGCCAGAAATTGCAATGACCATTCCCAAACGATGCAACATTGCTGATCGTCCCGTGGGCTACAAGTGTGG criterion=fanout-score sequence-density=0.07 sequence-density-rank=20 fanout-score=366.07 fanout-score-rank=1 prefix-density=0.86 prefix-fanout=31.6 sequence=GAAGAAGAAGAA SRR1799528 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 20:52:54 Started mapping on | Feb 13 20:52:54 Finished on | Feb 13 20:55:58 Mapping speed, Million of reads per hour | 340.52 Number of input reads | 17404393 Average input read length | 288 UNIQUE READS: Uniquely mapped reads number | 16010428 Uniquely mapped reads % | 91.99% Average mapped length | 286.28 Number of splices: Total | 14052437 Number of splices: Annotated (sjdb) | 13709823 Number of splices: GT/AG | 13773697 Number of splices: GC/AG | 182141 Number of splices: AT/AC | 11495 Number of splices: Non-canonical | 85104 Mismatch rate per base, % | 1.17% Deletion rate per base | 0.11% Deletion average length | 3.02 Insertion rate per base | 0.07% Insertion average length | 2.66 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 636505 % of reads mapped to multiple loci | 3.66% Number of reads mapped to too many loci | 30642 % of reads mapped to too many loci | 0.18% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.11% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 775547 775547 775547 N_multimapping 636505 636505 636505 N_noFeature 431871 15817268 525402 N_ambiguous 187118 796 87170 UnstrandedReadsAssigned:15391439 PositiveStrandReadsAssigned:192364 NegativeStrandReadsAssigned:15397856 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=145 echo kmer=141 SRR1799528 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR1799528-trimmed-pair1.fastq SRR1799528-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,404,393 reads, 14,941,391 reads pseudoaligned [quant] estimated average fragment length: 187.966 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,129 rounds 52401 SRR1799528.ke.tsv 34699 SRR1799528.se.tsv 87100 total ==> SRR1799528.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1831.03 542 20.0847 Potri.005G024800.1.v4.1 1035 848.034 559 44.7262 Potri.004G059700.1.v4.1 961 774.034 15 1.31491 Potri.007G009000.2.v4.1 1416 1229.03 0 0 Potri.003G141000.2.v4.1 2943 2756.03 329.09 8.10202 Potri.016G087400.1.v4.1 270 98.4245 1410 972.029 Potri.015G069301.1.v4.1 564 377.431 0 0 Potri.010G195200.1.v4.1 1773 1586.03 17 0.727277 Potri.012G127500.1.v4.1 977 790.034 5313 456.307 ==> SRR1799528.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 563 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 221 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 4 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR1799528 completed mapping pipeline successfully