Starting /dee2/code/volunteer_pipeline.sh SRR1799530 current disk space = 3087555702784 free memory = 1454249760 SRR1799530 SRAfilesize b4ecd0e3282b7f7b32417ea24542253a SRR1799530.sra SRR1799530.sra file validated SRR1799530 is paired end SRR1799530 is conventional basespace SRR1799530 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR1799530_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.046 34.0 33.0 34.0 31.0 34.0 2 32.70825 34.0 34.0 34.0 31.0 34.0 3 33.3075 34.0 34.0 34.0 31.0 34.0 4 36.62625 37.0 37.0 37.0 35.0 37.0 5 36.6055 37.0 37.0 37.0 35.0 37.0 6 36.6675 37.0 37.0 37.0 35.0 37.0 7 36.659 37.0 37.0 37.0 35.0 37.0 8 36.66875 37.0 37.0 37.0 35.0 37.0 9 38.635 39.0 39.0 39.0 38.0 39.0 10-14 38.91355 39.4 39.2 39.4 38.2 39.4 15-19 40.3009 41.0 40.0 41.0 39.0 41.0 20-24 40.237049999999996 41.0 40.0 41.0 39.0 41.0 25-29 40.17355 41.0 40.0 41.0 38.2 41.0 30-34 40.0697 41.0 40.0 41.0 38.0 41.0 35-39 39.95765 41.0 40.0 41.0 38.0 41.0 40-44 39.8204 41.0 40.0 41.0 38.0 41.0 45-49 39.66105 41.0 40.0 41.0 37.0 41.0 50-54 39.42325 41.0 39.2 41.0 36.4 41.0 55-59 39.145849999999996 40.0 39.0 41.0 35.4 41.0 60-64 38.9514 40.0 38.0 41.0 35.0 41.0 65-69 38.3104 39.2 36.6 41.0 35.0 41.0 70-74 37.27625 37.6 35.4 39.6 34.8 41.0 75-79 35.87089999999999 36.2 34.8 37.4 33.4 39.4 80-84 35.3578 35.2 35.0 36.6 34.0 38.0 85-89 34.764450000000004 35.0 35.0 35.8 34.0 36.6 90-94 34.430899999999994 35.0 35.0 35.0 33.4 36.0 95-99 34.2487 35.0 35.0 35.0 33.0 35.4 100-104 34.1941 35.0 35.0 35.0 33.0 35.0 105-109 34.107749999999996 35.0 35.0 35.0 33.0 35.0 110-114 33.9681 35.0 35.0 35.0 33.0 35.0 115-119 33.896100000000004 35.0 34.8 35.0 32.8 35.0 120-124 33.70269999999999 35.0 34.0 35.0 32.0 35.0 125-129 33.5576 35.0 34.0 35.0 31.8 35.0 130-134 33.3765 35.0 34.0 35.0 31.0 35.0 135-139 33.16995000000001 35.0 34.0 35.0 30.8 35.0 140-144 32.87349999999999 35.0 34.0 35.0 30.2 35.0 145-149 32.415200000000006 35.0 33.8 35.0 29.4 35.0 150 26.6935 33.0 23.0 35.0 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 2.0 12 4.0 13 0.0 14 2.0 15 4.0 16 1.0 17 1.0 18 3.0 19 6.0 20 2.0 21 4.0 22 1.0 23 8.0 24 9.0 25 10.0 26 13.0 27 12.0 28 14.0 29 25.0 30 22.0 31 28.0 32 50.0 33 69.0 34 146.0 35 287.0 36 1079.0 37 2147.0 38 50.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.61653151974889 10.959979074025634 6.905571540674862 40.517917865550615 2 21.866399799849887 14.660995746810107 34.82611958969227 28.646484863647736 3 19.650000000000002 18.625 24.775 36.95 4 23.280820205051263 26.431607901975497 22.1055263815954 28.182045511377847 5 23.625 31.874999999999996 23.875 20.625 6 19.425 34.625 25.474999999999998 20.474999999999998 7 13.325000000000001 26.474999999999998 41.225 18.975 8 15.925 26.325 33.4 24.349999999999998 9 17.599999999999998 23.974999999999998 34.5 23.925 10-14 19.28 29.89 27.32 23.51 15-19 19.72 28.865000000000002 27.76 23.655 20-24 19.28 29.020000000000003 27.775 23.925 25-29 19.75 28.96 27.82 23.47 30-34 19.825 29.360000000000003 27.87 22.945 35-39 20.04 28.744999999999997 27.38 23.835 40-44 19.97 29.215000000000003 27.250000000000004 23.565 45-49 20.044999999999998 28.84 27.485 23.630000000000003 50-54 20.16 28.994999999999997 27.6 23.244999999999997 55-59 19.615 28.98 27.279999999999998 24.125 60-64 20.06 28.67 27.694999999999997 23.575 65-69 20.105 28.455000000000002 28.405 23.035 70-74 20.48 28.884999999999998 27.52 23.115 75-79 20.22 29.195 27.165 23.419999999999998 80-84 20.105 28.715000000000003 27.245 23.935000000000002 85-89 20.035 28.735 27.43 23.799999999999997 90-94 20.575 28.305000000000003 27.42 23.7 95-99 20.71 28.415000000000003 27.715 23.16 100-104 20.73 28.33 27.075 23.865 105-109 20.979999999999997 28.685 26.695 23.64 110-114 20.865000000000002 28.754999999999995 27.265 23.115 115-119 21.345 29.425 26.195 23.035 120-124 21.275 29.17 25.89 23.665 125-129 21.36 29.020000000000003 25.735000000000003 23.885 130-134 21.065 29.15 26.25 23.535 135-139 21.32 29.294999999999998 25.03 24.355 140-144 21.790000000000003 29.054999999999996 25.080000000000002 24.075 145-149 21.065 29.575000000000003 24.45 24.91 150 17.43486973947896 29.759519038076153 26.252505010020037 26.553106212424847 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 2.0 21 1.5 22 0.5 23 1.0 24 1.5 25 1.5 26 5.5 27 12.5 28 12.5 29 15.5 30 20.5 31 25.0 32 34.5 33 43.0 34 55.0 35 76.5 36 93.0 37 110.5 38 142.5 39 172.5 40 182.0 41 207.5 42 229.5 43 239.5 44 270.0 45 271.5 46 266.0 47 262.5 48 233.5 49 206.5 50 175.0 51 138.5 52 119.5 53 95.5 54 71.0 55 53.5 56 40.0 57 33.5 58 24.5 59 14.0 60 7.0 61 5.0 62 6.5 63 5.5 64 3.0 65 2.0 66 1.0 67 1.0 68 1.5 69 1.5 70 1.0 71 1.0 72 1.0 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.425 2 0.075 3 0.0 4 0.025 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.2 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.875 #Duplication Level Percentage of deduplicated Percentage of total 1 99.87484355444305 99.75 2 0.1251564455569462 0.25 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.175 0.0 0.0 0.0 0.0 76-77 0.2 0.0 0.0 0.0 0.0 78-79 0.2625 0.0 0.0 0.0 0.0 80-81 0.36250000000000004 0.0 0.0 0.0 0.0 82-83 0.4375 0.0 0.0 0.0 0.0 84-85 0.575 0.0 0.0 0.0 0.0 86-87 0.6625000000000001 0.0 0.0 0.0 0.0 88-89 0.75 0.0 0.0 0.0 0.0 90-91 0.8 0.0 0.0 0.0 0.0 92-93 0.9375 0.0 0.0 0.0 0.0 94-95 1.0 0.0 0.0 0.0 0.0 96-97 1.1875 0.0 0.0 0.0 0.0 98-99 1.3875000000000002 0.0 0.0 0.0 0.0 100-101 1.6375000000000002 0.0 0.0 0.0 0.0 102-103 2.1625 0.0 0.0 0.0 0.0 104-105 2.875 0.0 0.0 0.0 0.0 106-107 3.4875 0.0 0.0 0.0 0.0 108-109 4.15 0.0 0.0 0.0 0.0 110-111 5.0125 0.0 0.0 0.0 0.0 112-113 6.0 0.0 0.0 0.0 0.0 114-115 6.95 0.0 0.0 0.0 0.0 116-117 8.025 0.0 0.0 0.0 0.0 118-119 9.125 0.0 0.0 0.0 0.0 120-121 10.0125 0.0 0.0 0.0 0.0 122-123 11.075 0.0 0.0 0.0 0.0 124-125 12.1625 0.0 0.0 0.0 0.0 126-127 13.4375 0.0 0.0 0.0 0.0 128-129 14.524999999999999 0.0 0.0 0.0 0.0 130-131 16.0375 0.0 0.0 0.0 0.0 132-133 17.5875 0.0 0.0 0.0 0.0 134-135 19.137500000000003 0.0 0.0 0.0 0.0 136-137 20.55 0.0 0.0 0.0 0.0 138 21.6 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CGGATCT 30 4.402666E-5 28.789999 140-144 ACGGATC 30 4.402666E-5 28.789999 140-144 ACATACG 35 1.2572136E-4 24.677143 135-139 GGATCTC 30 0.0015062337 23.991667 140-144 CATACGG 30 0.0015062337 23.991667 135-139 CACATAC 50 0.0013962165 17.274 135-139 CAGTCAC 60 0.0047141393 14.3949995 130-134 CCAGTCA 60 0.0047141393 14.3949995 130-134 GAACTCC 65 0.008013751 13.287692 125-129 >>END_MODULE SRR1799530 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR1799530_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.0245 34.0 33.0 34.0 31.0 34.0 2 33.14175 34.0 34.0 34.0 31.0 34.0 3 33.17825 34.0 34.0 34.0 31.0 34.0 4 36.46275 37.0 37.0 37.0 35.0 37.0 5 36.4665 37.0 37.0 37.0 35.0 37.0 6 36.46875 37.0 37.0 37.0 35.0 37.0 7 36.4715 37.0 37.0 37.0 35.0 37.0 8 36.43475 37.0 37.0 37.0 35.0 37.0 9 38.257 39.0 39.0 39.0 37.0 39.0 10-14 38.6484 39.4 39.2 39.4 37.2 39.4 15-19 39.93675 41.0 40.0 41.0 38.2 41.0 20-24 39.8985 41.0 40.0 41.0 38.2 41.0 25-29 39.80915 41.0 40.0 41.0 38.0 41.0 30-34 39.66940000000001 41.0 40.0 41.0 38.0 41.0 35-39 39.50285 41.0 40.0 41.0 38.0 41.0 40-44 39.38295 41.0 40.0 41.0 37.2 41.0 45-49 39.058800000000005 41.0 39.2 41.0 36.4 41.0 50-54 38.32165 39.6 38.2 40.6 34.8 41.0 55-59 38.433550000000004 40.0 38.0 41.0 34.6 41.0 60-64 38.357000000000006 40.0 37.4 41.0 35.0 41.0 65-69 37.7467 39.0 36.4 41.0 35.0 41.0 70-74 36.729150000000004 37.2 35.2 39.4 34.0 41.0 75-79 35.66095 36.2 35.0 37.8 34.0 39.2 80-84 34.80815 35.0 35.0 36.4 33.4 37.6 85-89 34.16225 35.0 35.0 35.6 33.0 36.4 90-94 33.854499999999994 35.0 35.0 35.0 33.0 36.0 95-99 33.73055000000001 35.0 35.0 35.0 32.6 35.6 100-104 33.4675 35.0 34.4 35.0 31.4 35.0 105-109 33.3712 35.0 34.0 35.0 31.4 35.0 110-114 33.33935 35.0 34.0 35.0 31.4 35.0 115-119 33.124249999999996 35.0 34.0 35.0 31.0 35.0 120-124 32.9591 35.0 34.0 35.0 30.2 35.0 125-129 32.581849999999996 35.0 34.0 35.0 29.2 35.0 130-134 32.6237 35.0 34.0 35.0 29.2 35.0 135-139 32.3989 35.0 33.4 35.0 29.0 35.0 140-144 31.89065 35.0 33.0 35.0 26.6 35.0 145-149 31.4404 35.0 33.0 35.0 25.0 35.0 150 29.028 34.0 29.0 35.0 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 20.0 3 2.0 4 2.0 5 1.0 6 2.0 7 0.0 8 3.0 9 5.0 10 3.0 11 2.0 12 6.0 13 5.0 14 5.0 15 2.0 16 4.0 17 3.0 18 3.0 19 4.0 20 9.0 21 8.0 22 11.0 23 3.0 24 5.0 25 7.0 26 14.0 27 12.0 28 14.0 29 31.0 30 35.0 31 43.0 32 52.0 33 83.0 34 160.0 35 343.0 36 1177.0 37 1884.0 38 37.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.816813048933504 19.29736511919699 12.647427854454204 30.238393977415306 2 24.893670252689517 26.56992744558419 33.274956217162874 15.261446084563424 3 20.095095095095093 27.87787787787788 31.03103103103103 20.995995995995994 4 23.755938984746187 33.58339584896224 23.705926481620406 18.95473868467117 5 25.21891418563923 35.551663747810856 22.66700025018764 16.56242181636227 6 19.55 38.625 23.974999999999998 17.849999999999998 7 19.900000000000002 21.7 38.35 20.05 8 23.025000000000002 24.525 29.875 22.575 9 22.900000000000002 23.724999999999998 30.2 23.175 10-14 23.419999999999998 29.14 26.465 20.974999999999998 15-19 23.880000000000003 27.750000000000004 28.585 19.785 20-24 23.405 27.965 27.925 20.705000000000002 25-29 22.665 27.72 28.560000000000002 21.055 30-34 22.73 28.22 28.585 20.465 35-39 23.54 27.985 27.74 20.735 40-44 23.474999999999998 28.17 27.74 20.615 45-49 23.25 27.67 28.555000000000003 20.525 50-54 23.34 28.46 27.97 20.23 55-59 23.155 27.85 28.549999999999997 20.445 60-64 23.62 27.765 28.24 20.375 65-69 23.585 27.76 28.68 19.975 70-74 23.705000000000002 27.474999999999998 28.205000000000002 20.615 75-79 24.005000000000003 27.52 28.349999999999998 20.125 80-84 23.65 27.73 28.720000000000002 19.900000000000002 85-89 23.485 27.529999999999998 28.16 20.825 90-94 23.515 27.57 28.854999999999997 20.06 95-99 23.52 27.965 28.67 19.845 100-104 24.085 27.91 28.15 19.855 105-109 24.175 27.900000000000002 28.244999999999997 19.68 110-114 24.855 27.884999999999998 27.515 19.744999999999997 115-119 24.685000000000002 28.389999999999997 26.735 20.19 120-124 25.64 27.36 27.24 19.759999999999998 125-129 26.853526220614825 27.139843279083784 26.667671287924456 19.33895921237693 130-134 26.924999999999997 28.18 26.424999999999997 18.47 135-139 27.195000000000004 28.16 26.205000000000002 18.44 140-144 27.720440881763526 28.847695390781563 25.52104208416834 17.910821643286575 145-149 28.125 28.165000000000003 25.624999999999996 18.085 150 27.24948875255624 28.732106339468306 25.74130879345603 18.277096114519427 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 2.0 26 4.5 27 9.5 28 11.0 29 12.0 30 18.5 31 24.5 32 28.5 33 35.5 34 55.0 35 68.5 36 86.5 37 120.0 38 148.0 39 177.0 40 212.0 41 251.5 42 259.5 43 250.5 44 260.0 45 272.0 46 270.5 47 240.0 48 219.0 49 193.0 50 160.5 51 126.5 52 104.0 53 100.5 54 69.0 55 47.5 56 37.5 57 32.5 58 30.5 59 16.5 60 9.5 61 6.5 62 5.0 63 8.5 64 5.5 65 2.0 66 1.5 67 0.5 68 1.5 69 1.0 70 0.0 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.375 2 0.075 3 0.1 4 0.025 5 0.075 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.45999999999999996 130-134 0.0 135-139 0.0 140-144 0.2 145-149 0.0 150 2.1999999999999997 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69909729187563 99.4 2 0.3009027081243731 0.6 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.175 0.0 0.0 0.0 0.0 76-77 0.2 0.0 0.0 0.0 0.0 78-79 0.2625 0.0 0.0 0.0 0.0 80-81 0.36250000000000004 0.0 0.0 0.0 0.0 82-83 0.4375 0.0 0.0 0.0 0.0 84-85 0.575 0.0 0.0 0.0 0.0 86-87 0.6625000000000001 0.0 0.0 0.0 0.0 88-89 0.75 0.0 0.0 0.0 0.0 90-91 0.8 0.0 0.0 0.0 0.0 92-93 0.9375 0.0 0.0 0.0 0.0 94-95 1.025 0.0 0.0 0.0 0.0 96-97 1.2125 0.0 0.0 0.0 0.0 98-99 1.4125 0.0 0.0 0.0 0.0 100-101 1.6625 0.0 0.0 0.0 0.0 102-103 2.175 0.0 0.0 0.0 0.0 104-105 2.875 0.0 0.0 0.0 0.0 106-107 3.4875 0.0 0.0 0.0 0.0 108-109 4.15 0.0 0.0 0.0 0.0 110-111 5.025 0.0 0.0 0.0 0.0 112-113 6.025 0.0 0.0 0.0 0.0 114-115 6.975 0.0 0.0 0.0 0.0 116-117 8.05 0.0 0.0 0.0 0.0 118-119 9.149999999999999 0.0 0.0 0.0 0.0 120-121 10.0 0.0 0.0 0.0 0.0 122-123 11.125 0.0 0.0 0.0 0.0 124-125 12.25 0.0 0.0 0.0 0.0 126-127 13.55 0.0 0.0 0.0 0.0 128-129 14.6125 0.0 0.0 0.0 0.0 130-131 16.0875 0.0 0.0 0.0 0.0 132-133 17.65 0.0 0.0 0.0 0.0 134-135 19.137500000000003 0.0 0.0 0.0 0.0 136-137 20.525 0.0 0.0 0.0 0.0 138 21.55 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATGCAAC 10 0.0070063258 143.775 2 TCTCGGT 20 0.0057438146 29.192894 140-144 TAGATCT 30 0.0014514716 24.14358 135-139 GTAGATC 35 0.0035553272 20.694494 135-139 >>END_MODULE Read 1353393 spots for SRR1799530.sra Written 1353393 spots for SRR1799530.sra Read 1353393 spots for SRR1799530.sra Written 1353393 spots for SRR1799530.sra Read 1353393 spots for SRR1799530.sra Written 1353393 spots for SRR1799530.sra Read 1353393 spots for SRR1799530.sra Written 1353393 spots for SRR1799530.sra Read 1353393 spots for SRR1799530.sra Written 1353393 spots for SRR1799530.sra Read 1353393 spots for SRR1799530.sra Written 1353393 spots for SRR1799530.sra Read 1353393 spots for SRR1799530.sra Written 1353393 spots for SRR1799530.sra Read 1353393 spots for SRR1799530.sra Written 1353393 spots for SRR1799530.sra Read 1353393 spots for SRR1799530.sra Written 1353393 spots for SRR1799530.sra Read 1353393 spots for SRR1799530.sra Written 1353393 spots for SRR1799530.sra Read 1353393 spots for SRR1799530.sra Written 1353393 spots for SRR1799530.sra Read 1353393 spots for SRR1799530.sra Written 1353393 spots for SRR1799530.sra Read 1353393 spots for SRR1799530.sra Written 1353393 spots for SRR1799530.sra Read 1353393 spots for SRR1799530.sra Written 1353393 spots for SRR1799530.sra Read 1353393 spots for SRR1799530.sra Written 1353393 spots for SRR1799530.sra Read 1353393 spots for SRR1799530.sra Written 1353393 spots for SRR1799530.sra Read 1353393 spots for SRR1799530.sra Written 1353393 spots for SRR1799530.sra Read 1353393 spots for SRR1799530.sra Written 1353393 spots for SRR1799530.sra Read 1353393 spots for SRR1799530.sra Written 1353393 spots for SRR1799530.sra Read 1353393 spots for SRR1799530.sra Written 1353393 spots for SRR1799530.sra SRR ids: ['SRR1799530.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_g8xzy9kl SRR1799530.sra spots: 27067860 blocks: [[1, 1353393], [1353394, 2706786], [2706787, 4060179], [4060180, 5413572], [5413573, 6766965], [6766966, 8120358], [8120359, 9473751], [9473752, 10827144], [10827145, 12180537], [12180538, 13533930], [13533931, 14887323], [14887324, 16240716], [16240717, 17594109], [17594110, 18947502], [18947503, 20300895], [20300896, 21654288], [21654289, 23007681], [23007682, 24361074], [24361075, 25714467], [25714468, 27067860]] SRR1799530 file size 9097842 SRR1799530 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR1799530 SRR1799530_1.fastq SRR1799530_2.fastq Input file: SRR1799530_1.fastq Paired file: SRR1799530_2.fastq trimmed: SRR1799530-trimmed-pair1.fastq, SRR1799530-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 20:39:13 2025 >> started Thu Feb 13 20:39:46 2025 >> done (32.517s) 27067860 read pairs processed; of these: 76392 ( 0.28%) short read pairs filtered out after trimming by size control 131707 ( 0.49%) empty read pairs filtered out after trimming by size control 26859761 (99.23%) read pairs available; of these: 12938834 (48.17%) trimmed read pairs available after processing 13920927 (51.83%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 3 0.00% 20 7 0.00% 21 10 0.00% 22 19 0.00% 23 25 0.00% 24 41 0.00% 25 43 0.00% 26 61 0.00% 27 64 0.00% 28 110 0.00% 29 147 0.00% 30 175 0.00% 31 181 0.00% 32 241 0.00% 33 245 0.00% 34 313 0.00% 35 384 0.00% 36 391 0.00% 37 403 0.00% 38 552 0.00% 39 526 0.00% 40 592 0.00% 41 654 0.00% 42 708 0.00% 43 726 0.00% 44 815 0.00% 45 840 0.00% 46 935 0.00% 47 971 0.00% 48 1012 0.00% 49 1094 0.00% 50 1187 0.00% 51 1240 0.00% 52 1427 0.01% 53 1479 0.01% 54 1600 0.01% 55 1643 0.01% 56 1793 0.01% 57 2029 0.01% 58 2260 0.01% 59 2417 0.01% 60 2755 0.01% 61 2974 0.01% 62 3138 0.01% 63 3474 0.01% 64 3901 0.01% 65 4171 0.02% 66 4560 0.02% 67 5074 0.02% 68 5589 0.02% 69 6301 0.02% 70 6773 0.03% 71 7547 0.03% 72 8391 0.03% 73 9522 0.04% 74 10664 0.04% 75 11853 0.04% 76 13105 0.05% 77 14289 0.05% 78 15373 0.06% 79 17552 0.07% 80 18889 0.07% 81 20672 0.08% 82 22115 0.08% 83 22645 0.08% 84 26236 0.10% 85 23769 0.09% 86 24560 0.09% 87 23130 0.09% 88 26339 0.10% 89 24967 0.09% 90 31705 0.12% 91 33964 0.13% 92 32308 0.12% 93 35354 0.13% 94 42869 0.16% 95 44215 0.16% 96 51386 0.19% 97 55092 0.21% 98 43379 0.16% 99 50025 0.19% 100 63748 0.24% 101 71297 0.27% 102 110858 0.41% 103 104378 0.39% 104 116873 0.44% 105 99080 0.37% 106 127776 0.48% 107 112647 0.42% 108 146546 0.55% 109 147904 0.55% 110 148883 0.55% 111 152938 0.57% 112 136644 0.51% 113 165676 0.62% 114 151717 0.56% 115 182783 0.68% 116 164799 0.61% 117 179690 0.67% 118 157187 0.59% 119 166405 0.62% 120 150064 0.56% 121 184277 0.69% 122 163463 0.61% 123 169329 0.63% 124 182105 0.68% 125 169984 0.63% 126 194066 0.72% 127 187850 0.70% 128 200878 0.75% 129 203962 0.76% 130 205639 0.77% 131 207515 0.77% 132 202471 0.75% 133 220095 0.82% 134 217671 0.81% 135 218755 0.81% 136 227106 0.85% 137 228164 0.85% 138 230688 0.86% 139 234671 0.87% 140 236057 0.88% 141 242100 0.90% 142 248572 0.93% 143 257108 0.96% 144 274188 1.02% 145 308173 1.15% 146 360457 1.34% 147 450219 1.68% 148 608241 2.26% 149 2407144 8.96% 150 13920927 51.83% 26859761 reads passed initial QC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=15.96 fanout-score-rank=10 prefix-density=0.30 prefix-fanout=7.4 sequence=CAACCTCAACAGTGGCCATTGGAACTAGAAGGAAAATAA criterion=fanout-score sequence-density=0.08 sequence-density-rank=18 fanout-score=342.00 fanout-score-rank=1 prefix-density=0.94 prefix-fanout=30.4 sequence=CTTCTTCTTCCT criterion=sequence-density sequence-density=0.13 sequence-density-rank=1 fanout-score=3.87 fanout-score-rank=34 prefix-density=0.17 prefix-fanout=3.0 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.09 sequence-density-rank=11 fanout-score=288.15 fanout-score-rank=1 prefix-density=0.98 prefix-fanout=27.5 sequence=AAGAAGAAGAAG SRR1799530 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 20:40:24 Started mapping on | Feb 13 20:40:25 Finished on | Feb 13 20:42:36 Mapping speed, Million of reads per hour | 738.13 Number of input reads | 26859761 Average input read length | 280 UNIQUE READS: Uniquely mapped reads number | 25928217 Uniquely mapped reads % | 96.53% Average mapped length | 280.29 Number of splices: Total | 23201238 Number of splices: Annotated (sjdb) | 22807156 Number of splices: GT/AG | 22834873 Number of splices: GC/AG | 292482 Number of splices: AT/AC | 22161 Number of splices: Non-canonical | 51722 Mismatch rate per base, % | 0.31% Deletion rate per base | 0.03% Deletion average length | 2.82 Insertion rate per base | 0.02% Insertion average length | 2.35 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 514028 % of reads mapped to multiple loci | 1.91% Number of reads mapped to too many loci | 35301 % of reads mapped to too many loci | 0.13% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.38% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 438645 438645 438645 N_multimapping 514028 514028 514028 N_noFeature 816727 25649006 980193 N_ambiguous 211702 1974 94516 UnstrandedReadsAssigned:24899788 PositiveStrandReadsAssigned:277237 NegativeStrandReadsAssigned:24853508 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=132 echo kmer=127 SRR1799530 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR1799530-trimmed-pair1.fastq SRR1799530-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 26,859,761 reads, 24,758,870 reads pseudoaligned [quant] estimated average fragment length: 180.125 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,179 rounds 52401 SRR1799530.ke.tsv 34699 SRR1799530.se.tsv 87100 total ==> SRR1799530.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1838.87 496 12.3985 Potri.005G024800.1.v4.1 1035 855.875 50 2.68534 Potri.004G059700.1.v4.1 961 781.887 27 1.5873 Potri.007G009000.2.v4.1 1416 1236.87 0 0 Potri.003G141000.2.v4.1 2943 2763.87 549.353 9.13633 Potri.016G087400.1.v4.1 270 107.66 2684.57 1146.2 Potri.015G069301.1.v4.1 564 385.332 0 0 Potri.010G195200.1.v4.1 1773 1593.87 100 2.88393 Potri.012G127500.1.v4.1 977 797.881 13793 794.62 ==> SRR1799530.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1258 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 445 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 13 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR1799530 completed mapping pipeline successfully