Starting /dee2/code/volunteer_pipeline.sh SRR1799531 current disk space = 3087584141312 free memory = 1440697592 SRR1799531 SRAfilesize 61c92bf7115260e8861e24aa35aed76f SRR1799531.sra SRR1799531.sra file validated SRR1799531 is paired end SRR1799531 is conventional basespace SRR1799531 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR1799531_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.2965 34.0 33.0 34.0 31.0 34.0 2 32.90625 34.0 34.0 34.0 31.0 34.0 3 33.3825 34.0 34.0 34.0 31.0 34.0 4 36.62325 37.0 37.0 37.0 35.0 37.0 5 36.62725 37.0 37.0 37.0 35.0 37.0 6 36.699 37.0 37.0 37.0 35.0 37.0 7 36.68575 37.0 37.0 37.0 35.0 37.0 8 36.68925 37.0 37.0 37.0 35.0 37.0 9 38.592 39.0 39.0 39.0 38.0 39.0 10-14 38.9336 39.4 39.2 39.4 38.2 39.4 15-19 40.245349999999995 41.0 40.0 41.0 39.0 41.0 20-24 40.2367 41.0 40.0 41.0 39.0 41.0 25-29 40.15265000000001 41.0 40.0 41.0 38.4 41.0 30-34 40.016000000000005 41.0 40.0 41.0 38.0 41.0 35-39 39.8891 41.0 40.0 41.0 38.0 41.0 40-44 39.690749999999994 41.0 40.0 41.0 37.6 41.0 45-49 39.51985 41.0 40.0 41.0 37.0 41.0 50-54 39.230149999999995 41.0 39.0 41.0 36.2 41.0 55-59 39.00085 40.4 38.8 41.0 35.0 41.0 60-64 38.81385 40.2 38.0 41.0 35.0 41.0 65-69 38.15295 39.2 36.6 41.0 35.0 41.0 70-74 37.1202 37.6 35.4 39.6 34.6 41.0 75-79 35.83585 36.2 34.8 37.6 33.4 39.4 80-84 35.21885 35.2 35.0 36.6 34.0 37.8 85-89 34.569649999999996 35.0 35.0 35.8 33.4 36.6 90-94 34.279199999999996 35.0 35.0 35.0 33.0 36.0 95-99 34.1178 35.0 35.0 35.0 33.0 35.4 100-104 34.03775 35.0 35.0 35.0 33.0 35.0 105-109 33.8673 35.0 35.0 35.0 32.6 35.0 110-114 33.747400000000006 35.0 35.0 35.0 32.2 35.0 115-119 33.629200000000004 35.0 34.0 35.0 32.0 35.0 120-124 33.4869 35.0 34.0 35.0 31.6 35.0 125-129 33.27645 35.0 34.0 35.0 31.0 35.0 130-134 32.981399999999994 35.0 34.0 35.0 30.2 35.0 135-139 32.827099999999994 35.0 34.0 35.0 30.0 35.0 140-144 32.53565 35.0 33.6 35.0 29.2 35.0 145-149 31.22505 35.0 32.4 35.0 23.0 35.0 150 25.45175 32.0 19.0 35.0 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 4 1.0 5 0.0 6 2.0 7 2.0 8 1.0 9 2.0 10 2.0 11 2.0 12 2.0 13 4.0 14 1.0 15 2.0 16 2.0 17 0.0 18 5.0 19 6.0 20 5.0 21 8.0 22 7.0 23 8.0 24 5.0 25 11.0 26 15.0 27 9.0 28 24.0 29 17.0 30 36.0 31 43.0 32 53.0 33 79.0 34 153.0 35 309.0 36 1020.0 37 2117.0 38 47.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.37191798598494 10.121982870490527 8.331170516480665 42.17492862704386 2 21.146146146146148 14.564564564564563 35.53553553553554 28.753753753753752 3 19.900000000000002 15.825 25.624999999999996 38.65 4 23.059589384076116 26.41462193289935 21.30696044066099 29.218828242363543 5 23.200000000000003 31.7 23.875 21.224999999999998 6 18.675 34.975 24.775 21.575 7 14.000000000000002 27.525 40.325 18.15 8 17.549999999999997 25.900000000000002 30.85 25.7 9 17.375 24.55 34.55 23.525 10-14 19.580000000000002 30.464999999999996 27.08 22.875 15-19 19.545 28.79 27.83 23.835 20-24 20.415 29.56 27.065 22.96 25-29 19.5 29.75 27.77 22.98 30-34 19.744999999999997 29.220000000000002 27.229999999999997 23.805 35-39 19.7 29.354999999999997 27.37 23.575 40-44 19.685 30.11 27.05 23.155 45-49 20.01 28.655 28.000000000000004 23.335 50-54 19.605 29.160000000000004 27.415 23.82 55-59 20.06 28.904999999999998 27.615000000000002 23.419999999999998 60-64 19.915 28.89 27.29 23.905 65-69 19.79 28.975 27.625 23.61 70-74 20.16 28.799999999999997 26.974999999999998 24.065 75-79 19.875 28.65 27.900000000000002 23.575 80-84 19.78 29.785 27.175 23.26 85-89 20.465 28.610000000000003 27.54 23.385 90-94 20.995 29.24 26.805 22.96 95-99 20.76 29.115000000000002 27.02 23.105 100-104 20.47 28.95 27.115000000000002 23.465 105-109 20.735 28.349999999999998 26.99 23.925 110-114 20.905 28.98 26.555 23.56 115-119 21.435000000000002 28.62 26.105 23.84 120-124 21.15 28.720000000000002 25.7 24.43 125-129 21.6 28.794999999999998 25.61 23.995 130-134 21.535 28.139999999999997 25.759999999999998 24.565 135-139 21.795 27.944999999999997 25.44 24.82 140-144 21.715 28.49 25.06 24.735 145-149 21.0 28.065 25.629999999999995 25.305 150 17.252636865896534 28.854846810647917 26.519337016574585 27.373179306880964 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.5 18 1.0 19 0.0 20 0.0 21 0.5 22 2.0 23 1.5 24 1.5 25 3.5 26 6.5 27 7.5 28 8.0 29 14.5 30 19.5 31 25.5 32 35.5 33 48.0 34 65.5 35 78.0 36 88.0 37 108.0 38 134.0 39 157.0 40 181.5 41 216.5 42 243.5 43 260.5 44 272.5 45 287.0 46 271.0 47 245.5 48 232.5 49 205.5 50 173.0 51 135.5 52 115.5 53 95.5 54 72.5 55 52.5 56 36.5 57 27.0 58 19.5 59 14.5 60 8.5 61 6.0 62 5.0 63 4.0 64 3.0 65 3.0 66 3.0 67 1.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.675 2 0.1 3 0.0 4 0.15 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.44999999999999996 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69909729187563 99.4 2 0.3009027081243731 0.6 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.2 0.0 0.0 0.0 0.0 78-79 0.32499999999999996 0.0 0.0 0.0 0.0 80-81 0.475 0.0 0.0 0.0 0.0 82-83 0.6125 0.0 0.0 0.0 0.0 84-85 0.8 0.0 0.0 0.0 0.0 86-87 0.925 0.0 0.0 0.0 0.0 88-89 1.1 0.0 0.0 0.0 0.0 90-91 1.2875 0.0 0.0 0.0 0.0 92-93 1.5125 0.0 0.0 0.0 0.0 94-95 1.7125 0.0 0.0 0.0 0.0 96-97 2.175 0.0 0.0 0.0 0.0 98-99 2.5875000000000004 0.0 0.0 0.0 0.0 100-101 2.9375 0.0 0.0 0.0 0.0 102-103 3.625 0.0 0.0 0.0 0.0 104-105 4.3625 0.0 0.0 0.0 0.0 106-107 5.3125 0.0 0.0 0.0 0.0 108-109 6.1625 0.0 0.0 0.0 0.0 110-111 7.1 0.0 0.0 0.0 0.0 112-113 8.0875 0.0 0.0 0.0 0.0 114-115 9.0125 0.0 0.0 0.0 0.0 116-117 10.2 0.0 0.0 0.0 0.0 118-119 11.3625 0.0 0.0 0.0 0.0 120-121 12.587499999999999 0.0 0.0 0.0 0.0 122-123 13.65 0.0 0.0 0.0 0.0 124-125 15.1875 0.0 0.0 0.0 0.0 126-127 16.2875 0.0 0.0 0.0 0.0 128-129 17.5 0.0 0.0 0.0 0.0 130-131 18.775 0.0 0.0 0.0 0.0 132-133 20.125 0.0 0.0 0.0 0.0 134-135 21.4625 0.0 0.0 0.0 0.0 136-137 22.4875 0.0 0.0 0.0 0.0 138 23.475 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAACTCC 65 0.00800915 13.288845 135-139 >>END_MODULE SRR1799531 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR1799531_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.97775 34.0 33.0 34.0 31.0 34.0 2 33.07975 34.0 34.0 34.0 31.0 34.0 3 33.13025 34.0 34.0 34.0 31.0 34.0 4 36.36425 37.0 37.0 37.0 35.0 37.0 5 36.44125 37.0 37.0 37.0 35.0 37.0 6 36.4775 37.0 37.0 37.0 35.0 37.0 7 36.468 37.0 37.0 37.0 35.0 37.0 8 36.4855 37.0 37.0 37.0 35.0 37.0 9 38.33225 39.0 39.0 39.0 37.0 39.0 10-14 38.68085 39.4 39.2 39.4 37.8 39.4 15-19 40.0065 41.0 40.0 41.0 38.4 41.0 20-24 39.99015000000001 41.0 40.0 41.0 38.6 41.0 25-29 39.885450000000006 41.0 40.0 41.0 38.0 41.0 30-34 39.72385 41.0 40.0 41.0 38.0 41.0 35-39 39.5918 41.0 40.0 41.0 38.0 41.0 40-44 39.455200000000005 41.0 40.0 41.0 37.2 41.0 45-49 39.15965 41.0 39.4 41.0 36.6 41.0 50-54 38.263549999999995 39.6 38.0 40.6 35.0 40.8 55-59 38.428900000000006 40.0 38.0 41.0 34.6 41.0 60-64 38.358000000000004 40.0 37.6 41.0 35.0 41.0 65-69 37.64575000000001 39.0 36.4 41.0 34.8 41.0 70-74 36.6452 37.2 35.2 39.4 34.0 41.0 75-79 35.52605 36.0 35.0 37.8 33.8 39.2 80-84 34.65105 35.0 35.0 36.4 33.0 37.6 85-89 34.0724 35.0 35.0 35.4 32.6 36.4 90-94 33.7223 35.0 35.0 35.0 32.0 36.0 95-99 33.51975 35.0 34.8 35.0 31.8 35.2 100-104 33.28575 35.0 34.0 35.0 31.2 35.0 105-109 33.16715000000001 35.0 34.0 35.0 31.0 35.0 110-114 33.0261 35.0 34.0 35.0 30.6 35.0 115-119 32.820499999999996 35.0 34.0 35.0 29.8 35.0 120-124 32.626549999999995 35.0 34.0 35.0 29.4 35.0 125-129 32.332550000000005 35.0 33.2 35.0 28.6 35.0 130-134 32.06395 35.0 33.0 35.0 27.0 35.0 135-139 31.65815 35.0 33.0 35.0 25.2 35.0 140-144 31.050750000000004 34.6 32.2 35.0 23.2 35.0 145-149 30.149099999999997 34.0 31.4 35.0 12.0 35.0 150 27.418 33.0 25.0 35.0 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 16.0 3 3.0 4 1.0 5 2.0 6 1.0 7 7.0 8 2.0 9 3.0 10 4.0 11 5.0 12 5.0 13 4.0 14 4.0 15 1.0 16 7.0 17 4.0 18 6.0 19 6.0 20 6.0 21 7.0 22 12.0 23 12.0 24 6.0 25 10.0 26 17.0 27 24.0 28 26.0 29 24.0 30 40.0 31 44.0 32 69.0 33 100.0 34 154.0 35 376.0 36 1197.0 37 1754.0 38 41.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.4634697464223 18.15214662314838 13.155912628671857 30.228471001757466 2 24.86865148861646 26.444833625218916 31.923942957217914 16.76257192894671 3 19.989992494370778 28.521391043282463 31.723792844633476 19.764823617713283 4 24.862431215607803 32.016008004002 23.71185592796398 19.409704852426213 5 24.73736868434217 35.4927463731866 23.461730865432717 16.30815407703852 6 19.950000000000003 39.125 22.625 18.3 7 19.325 21.175 39.074999999999996 20.424999999999997 8 21.85 24.15 30.825000000000003 23.175 9 22.025 24.7 30.225 23.05 10-14 23.647364736473648 29.117911791179118 26.542654265426542 20.692069206920692 15-19 23.41 27.800000000000004 27.935 20.855 20-24 23.474999999999998 27.425 28.435 20.665 25-29 23.435 28.044999999999998 27.650000000000002 20.87 30-34 23.24 28.439999999999998 27.685 20.635 35-39 23.165 28.405 27.915 20.515 40-44 22.82 27.785 28.4 20.995 45-49 23.48 27.35 28.389999999999997 20.78 50-54 23.115 28.384999999999998 28.02 20.48 55-59 23.215 27.534999999999997 28.725 20.525 60-64 23.32 27.66 28.345 20.674999999999997 65-69 23.595 27.155 28.845 20.405 70-74 23.325000000000003 28.105000000000004 28.349999999999998 20.22 75-79 23.465 27.375 28.82 20.34 80-84 23.605 27.515 28.249999999999996 20.630000000000003 85-89 23.39 27.365000000000002 28.62 20.625 90-94 23.935000000000002 27.560000000000002 28.565 19.939999999999998 95-99 23.94 27.85 28.449999999999996 19.759999999999998 100-104 24.33 27.994999999999997 27.534999999999997 20.14 105-109 24.169999999999998 27.815 27.944999999999997 20.07 110-114 24.685000000000002 27.675 28.055000000000003 19.585 115-119 25.496274813740687 27.861393069653484 27.35136756837842 19.29096454822741 120-124 25.91 27.474999999999998 26.939999999999998 19.675 125-129 26.935 28.144999999999996 26.305 18.615000000000002 130-134 27.060000000000002 28.044999999999998 26.44 18.455 135-139 28.21 28.065 25.669999999999998 18.055 140-144 27.700000000000003 28.310000000000002 25.855 18.135 145-149 28.7 28.21 25.09 18.0 150 29.247910863509752 28.48822486705495 24.841732084071914 17.422132185363385 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.5 21 1.5 22 1.5 23 1.0 24 1.0 25 1.0 26 2.5 27 4.0 28 4.5 29 10.0 30 17.0 31 24.5 32 33.5 33 43.0 34 55.0 35 69.5 36 92.0 37 110.5 38 130.0 39 153.0 40 189.5 41 222.5 42 253.0 43 280.5 44 285.5 45 288.5 46 263.0 47 246.0 48 241.5 49 204.0 50 161.0 51 136.0 52 112.0 53 89.5 54 75.0 55 56.0 56 40.5 57 24.0 58 18.0 59 18.0 60 10.0 61 7.0 62 5.0 63 3.5 64 4.5 65 3.0 66 1.0 67 1.5 68 1.0 69 0.0 70 0.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.42500000000000004 2 0.075 3 0.075 4 0.05 5 0.05 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.01 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.005 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 1.275 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77449260836883 99.55000000000001 2 0.22550739163117012 0.44999999999999996 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.2 0.0 0.0 0.0 0.0 78-79 0.32499999999999996 0.0 0.0 0.0 0.0 80-81 0.48750000000000004 0.0 0.0 0.0 0.0 82-83 0.6375 0.0 0.0 0.0 0.0 84-85 0.825 0.0 0.0 0.0 0.0 86-87 0.95 0.0 0.0 0.0 0.0 88-89 1.125 0.0 0.0 0.0 0.0 90-91 1.3125 0.0 0.0 0.0 0.0 92-93 1.5499999999999998 0.0 0.0 0.0 0.0 94-95 1.775 0.0 0.0 0.0 0.0 96-97 2.25 0.0 0.0 0.0 0.0 98-99 2.6624999999999996 0.0 0.0 0.0 0.0 100-101 3.0125 0.0 0.0 0.0 0.0 102-103 3.6875 0.0 0.0 0.0 0.0 104-105 4.425 0.0 0.0 0.0 0.0 106-107 5.3625 0.0 0.0 0.0 0.0 108-109 6.1625 0.0 0.0 0.0 0.0 110-111 7.1 0.0 0.0 0.0 0.0 112-113 8.0875 0.0 0.0 0.0 0.0 114-115 9.0125 0.0 0.0 0.0 0.0 116-117 10.1625 0.0 0.0 0.0 0.0 118-119 11.3 0.0 0.0 0.0 0.0 120-121 12.537500000000001 0.0 0.0 0.0 0.0 122-123 13.625 0.0 0.0 0.0 0.0 124-125 15.175 0.0 0.0 0.0 0.0 126-127 16.2625 0.0 0.0 0.0 0.0 128-129 17.5125 0.0 0.0 0.0 0.0 130-131 18.8125 0.0 0.0 0.0 0.0 132-133 20.1875 0.0 0.0 0.0 0.0 134-135 21.637500000000003 0.0 0.0 0.0 0.0 136-137 22.675 0.0 0.0 0.0 0.0 138 23.675 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATTTCCG 10 0.0069772652 143.975 5 >>END_MODULE Read 1252448 spots for SRR1799531.sra Written 1252448 spots for SRR1799531.sra Read 1252448 spots for SRR1799531.sra Written 1252448 spots for SRR1799531.sra Read 1252448 spots for SRR1799531.sra Written 1252448 spots for SRR1799531.sra Read 1252448 spots for SRR1799531.sra Written 1252448 spots for SRR1799531.sra Read 1252448 spots for SRR1799531.sra Written 1252448 spots for SRR1799531.sra Read 1252448 spots for SRR1799531.sra Written 1252448 spots for SRR1799531.sra Read 1252448 spots for SRR1799531.sra Written 1252448 spots for SRR1799531.sra Read 1252466 spots for SRR1799531.sra Written 1252466 spots for SRR1799531.sra Read 1252448 spots for SRR1799531.sra Written 1252448 spots for SRR1799531.sra Read 1252448 spots for SRR1799531.sra Written 1252448 spots for SRR1799531.sra Read 1252448 spots for SRR1799531.sra Written 1252448 spots for SRR1799531.sra Read 1252448 spots for SRR1799531.sra Written 1252448 spots for SRR1799531.sra Read 1252448 spots for SRR1799531.sra Written 1252448 spots for SRR1799531.sra Read 1252448 spots for SRR1799531.sra Written 1252448 spots for SRR1799531.sra Read 1252448 spots for SRR1799531.sra Written 1252448 spots for SRR1799531.sra Read 1252448 spots for SRR1799531.sra Written 1252448 spots for SRR1799531.sra Read 1252448 spots for SRR1799531.sra Written 1252448 spots for SRR1799531.sra Read 1252448 spots for SRR1799531.sra Written 1252448 spots for SRR1799531.sra Read 1252448 spots for SRR1799531.sra Written 1252448 spots for SRR1799531.sra Read 1252448 spots for SRR1799531.sra Written 1252448 spots for SRR1799531.sra SRR ids: ['SRR1799531.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_i6e83dw9 SRR1799531.sra spots: 25048978 blocks: [[1, 1252448], [1252449, 2504896], [2504897, 3757344], [3757345, 5009792], [5009793, 6262240], [6262241, 7514688], [7514689, 8767136], [8767137, 10019584], [10019585, 11272032], [11272033, 12524480], [12524481, 13776928], [13776929, 15029376], [15029377, 16281824], [16281825, 17534272], [17534273, 18786720], [18786721, 20039168], [20039169, 21291616], [21291617, 22544064], [22544065, 23796512], [23796513, 25048978]] SRR1799531 file size 8417652 SRR1799531 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR1799531 SRR1799531_1.fastq SRR1799531_2.fastq Input file: SRR1799531_1.fastq Paired file: SRR1799531_2.fastq trimmed: SRR1799531-trimmed-pair1.fastq, SRR1799531-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 20:33:23 2025 >> started Thu Feb 13 20:33:51 2025 >> done (28.125s) 25048978 read pairs processed; of these: 49840 ( 0.20%) short read pairs filtered out after trimming by size control 103985 ( 0.42%) empty read pairs filtered out after trimming by size control 24895153 (99.39%) read pairs available; of these: 11402137 (45.80%) trimmed read pairs available after processing 13493016 (54.20%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 6 0.00% 20 3 0.00% 21 7 0.00% 22 12 0.00% 23 19 0.00% 24 23 0.00% 25 33 0.00% 26 42 0.00% 27 51 0.00% 28 62 0.00% 29 96 0.00% 30 100 0.00% 31 121 0.00% 32 162 0.00% 33 175 0.00% 34 203 0.00% 35 252 0.00% 36 269 0.00% 37 288 0.00% 38 323 0.00% 39 368 0.00% 40 433 0.00% 41 478 0.00% 42 525 0.00% 43 558 0.00% 44 597 0.00% 45 650 0.00% 46 689 0.00% 47 699 0.00% 48 845 0.00% 49 930 0.00% 50 958 0.00% 51 1035 0.00% 52 1205 0.00% 53 1258 0.01% 54 1348 0.01% 55 1506 0.01% 56 1734 0.01% 57 1853 0.01% 58 1985 0.01% 59 2306 0.01% 60 2466 0.01% 61 2693 0.01% 62 2972 0.01% 63 3350 0.01% 64 3918 0.02% 65 4208 0.02% 66 4603 0.02% 67 5164 0.02% 68 5580 0.02% 69 6227 0.03% 70 6986 0.03% 71 7827 0.03% 72 8815 0.04% 73 10099 0.04% 74 11199 0.04% 75 12571 0.05% 76 13754 0.06% 77 15161 0.06% 78 16601 0.07% 79 18142 0.07% 80 19476 0.08% 81 20220 0.08% 82 19937 0.08% 83 20049 0.08% 84 23359 0.09% 85 21912 0.09% 86 22852 0.09% 87 25359 0.10% 88 29733 0.12% 89 32138 0.13% 90 39264 0.16% 91 57169 0.23% 92 38281 0.15% 93 37189 0.15% 94 50613 0.20% 95 57826 0.23% 96 52368 0.21% 97 59463 0.24% 98 49904 0.20% 99 51581 0.21% 100 62084 0.25% 101 82368 0.33% 102 110773 0.44% 103 77406 0.31% 104 85586 0.34% 105 130080 0.52% 106 101149 0.41% 107 115125 0.46% 108 117695 0.47% 109 143415 0.58% 110 109731 0.44% 111 118789 0.48% 112 133425 0.54% 113 132476 0.53% 114 145091 0.58% 115 179998 0.72% 116 128183 0.51% 117 102888 0.41% 118 142640 0.57% 119 133410 0.54% 120 105329 0.42% 121 114487 0.46% 122 146245 0.59% 123 133445 0.54% 124 156364 0.63% 125 172885 0.69% 126 171844 0.69% 127 139080 0.56% 128 140106 0.56% 129 159160 0.64% 130 155849 0.63% 131 159361 0.64% 132 177717 0.71% 133 211484 0.85% 134 202378 0.81% 135 183290 0.74% 136 215889 0.87% 137 217851 0.88% 138 216025 0.87% 139 224748 0.90% 140 224427 0.90% 141 233778 0.94% 142 239386 0.96% 143 247933 1.00% 144 265540 1.07% 145 286234 1.15% 146 317980 1.28% 147 384251 1.54% 148 527451 2.12% 149 2004071 8.05% 150 13493016 54.20% 24895153 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=13.83 fanout-score-rank=7 prefix-density=0.30 prefix-fanout=6.9 sequence=GGTGCTGGTGCTGGAGTAGGAGGTTTAGGTGTAAAGATATCAAGAGGAAGAAGCACCTTGTCAACCTGATAAACAGCTAACTGGCTATCAGTGTAGATAGTGCCGGATACGCTTGTATTTGTAAGCCCTGTAGTTATATTCACAGAGTTTCCTGTGGTGGTTAC criterion=fanout-score sequence-density=0.02 sequence-density-rank=41 fanout-score=239.91 fanout-score-rank=1 prefix-density=0.28 prefix-fanout=18.1 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCCCTGGGAGATTTTGTCCCAGTAACTGGGATCAGCCTTGCACTTCTCAAAGAAGTCAA criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=3.11 fanout-score-rank=27 prefix-density=0.17 prefix-fanout=2.7 sequence=GTTGACTTCTTTGAGAAGTGCAAGGCTGATCCCAGTTACTGGGACAAAATCTCCCAGGGAGGCCTGCAGCGAATCCAAGAGAAGTATACCTGGAAAATTTACTCTCAAAGGCTCCTGACTCTCACAGGAGTTTATGGCTTCTGGAAGCATGTTTCCAACCTTGATCATCGTGAGAGCCGTCGCTATCTGGAAATGTTCTATGCACTCAAATATCGCAAATTGGCTGATTCTGTTCCTTTGACTATCGAGTAAATGGAGCTGGAGAAATCAAGGAAACATGGGTTGGTTTGAGTCGGGTTCCGGGTCCAGAATAATGGTGTCATTTCACGATAGTGATTGGACAAGAAAGGCTTTGATCTTCT criterion=fanout-score sequence-density=0.09 sequence-density-rank=22 fanout-score=57.97 fanout-score-rank=1 prefix-density=0.38 prefix-fanout=13.4 sequence=TCAAGGAAGCTTTCAG SRR1799531 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 20:34:31 Started mapping on | Feb 13 20:34:32 Finished on | Feb 13 20:36:09 Mapping speed, Million of reads per hour | 923.94 Number of input reads | 24895153 Average input read length | 281 UNIQUE READS: Uniquely mapped reads number | 24230440 Uniquely mapped reads % | 97.33% Average mapped length | 280.72 Number of splices: Total | 19973842 Number of splices: Annotated (sjdb) | 19613276 Number of splices: GT/AG | 19674188 Number of splices: GC/AG | 231508 Number of splices: AT/AC | 16717 Number of splices: Non-canonical | 51429 Mismatch rate per base, % | 0.29% Deletion rate per base | 0.03% Deletion average length | 2.49 Insertion rate per base | 0.02% Insertion average length | 2.22 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 478608 % of reads mapped to multiple loci | 1.92% Number of reads mapped to too many loci | 31636 % of reads mapped to too many loci | 0.13% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.60% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 202869 202869 202869 N_multimapping 478608 478608 478608 N_noFeature 740746 23911402 923337 N_ambiguous 235066 1799 97266 UnstrandedReadsAssigned:23254628 PositiveStrandReadsAssigned:317239 NegativeStrandReadsAssigned:23209837 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=129 echo kmer=125 SRR1799531 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR1799531-trimmed-pair1.fastq SRR1799531-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 24,895,153 reads, 23,187,356 reads pseudoaligned [quant] estimated average fragment length: 177.238 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,102 rounds 52401 SRR1799531.ke.tsv 34699 SRR1799531.se.tsv 87100 total ==> SRR1799531.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1841.76 434 11.9075 Potri.005G024800.1.v4.1 1035 858.762 71 4.17782 Potri.004G059700.1.v4.1 961 784.768 23 1.48098 Potri.007G009000.2.v4.1 1416 1239.76 0 0 Potri.003G141000.2.v4.1 2943 2766.76 416.035 7.5984 Potri.016G087400.1.v4.1 270 110.504 2195 1003.74 Potri.015G069301.1.v4.1 564 388.352 0 0 Potri.010G195200.1.v4.1 1773 1596.76 123 3.8925 Potri.012G127500.1.v4.1 977 800.768 5072 320.064 ==> SRR1799531.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 3032 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 413 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 19 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR1799531 completed mapping pipeline successfully