Starting /dee2/code/volunteer_pipeline.sh SRR1799532 current disk space = 3088222568448 free memory = 1580265200 SRR1799532 SRAfilesize fbe32558aabb133424ddf99f52a7d93a SRR1799532.sra SRR1799532.sra file validated SRR1799532 is paired end SRR1799532 is conventional basespace SRR1799532 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR1799532_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.129 34.0 33.0 34.0 31.0 34.0 2 33.3045 34.0 34.0 34.0 31.0 34.0 3 33.35475 34.0 34.0 34.0 31.0 34.0 4 36.6195 37.0 37.0 37.0 35.0 37.0 5 36.482 37.0 37.0 37.0 35.0 37.0 6 36.54825 37.0 37.0 37.0 35.0 37.0 7 36.55775 37.0 37.0 37.0 35.0 37.0 8 36.581 37.0 37.0 37.0 35.0 37.0 9 38.44675 39.0 39.0 39.0 37.0 39.0 10-14 38.755700000000004 39.4 39.2 39.4 37.2 39.4 15-19 40.063849999999995 41.0 40.0 41.0 38.0 41.0 20-24 39.976 41.0 40.0 41.0 38.0 41.0 25-29 39.827749999999995 41.0 40.0 41.0 38.0 41.0 30-34 39.66605 41.0 40.0 41.0 37.8 41.0 35-39 39.402649999999994 41.0 39.4 41.0 36.8 41.0 40-44 39.4724 40.8 39.8 41.0 37.0 41.0 45-49 39.60445 41.0 40.0 41.0 37.0 41.0 50-54 39.51715 41.0 39.6 41.0 36.8 41.0 55-59 39.22045000000001 41.0 39.0 41.0 35.4 41.0 60-64 38.66765 40.0 37.6 41.0 35.0 41.0 65-69 37.98945 39.2 36.4 41.0 34.6 41.0 70-74 36.9245 37.2 35.2 39.4 34.0 41.0 75-79 35.4659 36.0 34.6 37.4 32.6 39.4 80-84 35.05 35.0 35.0 36.6 33.2 37.8 85-89 34.4916 35.0 35.0 35.8 33.0 36.4 90-94 34.1079 35.0 35.0 35.0 32.8 36.0 95-99 33.9388 35.0 34.6 35.0 32.2 35.2 100-104 33.701299999999996 35.0 34.0 35.0 31.6 35.0 105-109 33.60705 35.0 34.0 35.0 31.4 35.0 110-114 33.56175 35.0 34.0 35.0 31.2 35.0 115-119 33.390649999999994 35.0 34.0 35.0 31.0 35.0 120-124 33.178650000000005 35.0 34.0 35.0 30.2 35.0 125-129 32.981 35.0 34.0 35.0 30.0 35.0 130-134 32.732949999999995 35.0 33.4 35.0 29.0 35.0 135-139 32.3755 35.0 33.0 35.0 28.6 35.0 140-144 31.688149999999997 34.2 32.6 35.0 26.2 35.0 145-149 30.7887 34.0 32.0 35.0 21.4 35.0 150 24.83925 31.0 18.0 34.0 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 3.0 8 1.0 9 3.0 10 0.0 11 1.0 12 1.0 13 3.0 14 2.0 15 0.0 16 3.0 17 4.0 18 3.0 19 4.0 20 6.0 21 6.0 22 6.0 23 4.0 24 3.0 25 14.0 26 15.0 27 27.0 28 23.0 29 39.0 30 31.0 31 79.0 32 91.0 33 110.0 34 160.0 35 340.0 36 1155.0 37 1842.0 38 20.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.47809762202753 11.514392991239049 6.683354192740926 39.32415519399249 2 22.125 13.700000000000001 35.35 28.825 3 18.2 18.425 24.975 38.4 4 23.525 26.375 21.125 28.975 5 24.065244667503137 30.765370138017566 23.764115432873275 21.40526976160602 6 19.650000000000002 35.775 23.849999999999998 20.724999999999998 7 14.725 28.499999999999996 39.900000000000006 16.875 8 16.6 27.500000000000004 32.074999999999996 23.825 9 16.275000000000002 26.075 32.925 24.725 10-14 19.38 30.555 27.355 22.71 15-19 19.255 29.365000000000002 27.839999999999996 23.54 20-24 19.07 29.299999999999997 27.485 24.145 25-29 19.655 29.325000000000003 27.634999999999998 23.385 30-34 19.875 29.265 27.089999999999996 23.77 35-39 19.96 29.415000000000003 27.02 23.605 40-44 19.564999999999998 29.244999999999997 27.445000000000004 23.745 45-49 20.22 29.59 27.12 23.07 50-54 19.509999999999998 29.13 27.57 23.79 55-59 20.445 28.985 27.27 23.3 60-64 19.759999999999998 29.455 27.334999999999997 23.45 65-69 20.025000000000002 28.785 27.095000000000002 24.095 70-74 20.59 29.435 26.979999999999997 22.994999999999997 75-79 20.2020202020202 28.437843784378437 27.45274527452745 23.907390739073907 80-84 19.830000000000002 28.744999999999997 27.315 24.11 85-89 19.685 28.915000000000003 27.345000000000002 24.055 90-94 20.23404680936187 28.755751150230047 26.990398079615925 24.019803960792157 95-99 20.259051810362074 28.610722144428884 27.335467093418686 23.794758951790357 100-104 21.009201840368075 28.700740148029606 26.895379075815164 23.39467893578716 105-109 20.854170834166833 28.905781156231246 26.615323064612923 23.624724944988998 110-114 21.144515031764293 29.198139162623182 25.966685008253716 23.690660797358813 115-119 21.135283820955237 29.27731932983246 25.756439109777446 23.830957739434858 120-124 20.830000000000002 29.599999999999998 25.53 24.04 125-129 21.33 28.52 25.485000000000003 24.665 130-134 21.013151972795917 28.944341651247683 25.28379256888533 24.75871380707106 135-139 21.777622167758715 28.554994247986798 24.8186865402891 24.848697043965387 140-144 21.28606430321516 28.761438071903594 24.71123556177809 25.241262063103154 145-149 21.255 28.65 23.615 26.479999999999997 150 17.05426356589147 29.15728932233058 24.756189047261813 29.03225806451613 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.5 23 1.5 24 0.5 25 3.5 26 5.0 27 8.0 28 13.5 29 15.5 30 21.0 31 29.0 32 40.0 33 52.0 34 59.0 35 68.5 36 90.5 37 119.5 38 136.5 39 151.5 40 179.0 41 200.5 42 223.0 43 255.5 44 286.5 45 282.5 46 260.0 47 258.0 48 229.5 49 191.5 50 166.0 51 151.0 52 130.5 53 97.5 54 76.5 55 52.5 56 37.0 57 27.0 58 21.5 59 19.0 60 11.0 61 6.5 62 5.0 63 4.0 64 3.0 65 3.0 66 2.5 67 1.0 68 0.0 69 1.5 70 1.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.125 2 0.0 3 0.0 4 0.0 5 0.375 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.01 80-84 0.0 85-89 0.0 90-94 0.02 95-99 0.02 100-104 0.02 105-109 0.02 110-114 0.045 115-119 0.025 120-124 0.0 125-129 0.0 130-134 0.015 135-139 0.034999999999999996 140-144 0.005 145-149 0.0 150 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.5227329816629 99.05000000000001 2 0.4772670183371013 0.95 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.2 0.0 0.0 0.0 0.0 76-77 0.2875 0.0 0.0 0.0 0.0 78-79 0.4 0.0 0.0 0.0 0.0 80-81 0.44999999999999996 0.0 0.0 0.0 0.0 82-83 0.5375000000000001 0.0 0.0 0.0 0.0 84-85 0.55 0.0 0.0 0.0 0.0 86-87 0.6 0.0 0.0 0.0 0.0 88-89 0.6875 0.0 0.0 0.0 0.0 90-91 0.925 0.0 0.0 0.0 0.0 92-93 1.2374999999999998 0.0 0.0 0.0 0.0 94-95 1.625 0.0 0.0 0.0 0.0 96-97 2.025 0.0 0.0 0.0 0.0 98-99 2.6624999999999996 0.0 0.0 0.0 0.0 100-101 3.2875 0.0 0.0 0.0 0.0 102-103 3.8625 0.0 0.0 0.0 0.0 104-105 4.6625 0.0 0.0 0.0 0.0 106-107 5.612500000000001 0.0 0.0 0.0 0.0 108-109 6.475 0.0 0.0 0.0 0.0 110-111 7.35 0.0 0.0 0.0 0.0 112-113 8.3625 0.0 0.0 0.0 0.0 114-115 9.399999999999999 0.0 0.0 0.0 0.0 116-117 10.5375 0.0 0.0 0.0 0.0 118-119 11.4 0.0 0.0 0.0 0.0 120-121 12.0875 0.0 0.0 0.0 0.0 122-123 13.0 0.0 0.0 0.0 0.0 124-125 14.3 0.0 0.0 0.0 0.0 126-127 15.5625 0.0 0.0 0.0 0.0 128-129 16.425 0.0 0.0 0.0 0.0 130-131 17.775 0.0 0.0 0.0 0.0 132-133 19.2625 0.0 0.0 0.0 0.0 134-135 20.6875 0.0 0.0 0.0 0.0 136-137 22.1625 0.0 0.0 0.0 0.0 138 23.225 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CATAGTC 10 0.006973645 144.0 3 >>END_MODULE SRR1799532 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR1799532_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.7115 34.0 33.0 34.0 31.0 34.0 2 32.72775 34.0 33.0 34.0 31.0 34.0 3 32.807 34.0 34.0 34.0 31.0 34.0 4 36.04075 37.0 37.0 37.0 35.0 37.0 5 36.0705 37.0 37.0 37.0 35.0 37.0 6 36.0565 37.0 37.0 37.0 35.0 37.0 7 36.05525 37.0 37.0 37.0 35.0 37.0 8 35.977 37.0 37.0 37.0 35.0 37.0 9 37.80775 39.0 39.0 39.0 37.0 39.0 10-14 38.13465 39.4 39.2 39.4 37.2 39.4 15-19 39.356950000000005 41.0 40.0 41.0 37.8 41.0 20-24 39.3337 41.0 40.0 41.0 38.0 41.0 25-29 39.20675 41.0 40.0 41.0 37.4 41.0 30-34 39.08675 41.0 40.0 41.0 37.0 41.0 35-39 38.90725 41.0 40.0 41.0 36.2 41.0 40-44 38.83215 40.8 39.2 41.0 36.2 41.0 45-49 38.7753 41.0 39.2 41.0 35.8 41.0 50-54 37.819449999999996 39.8 38.0 40.4 34.4 40.6 55-59 38.14705 40.0 38.0 41.0 34.6 41.0 60-64 37.6248 39.6 36.8 41.0 34.0 41.0 65-69 37.1591 39.0 36.0 40.8 34.0 41.0 70-74 36.1237 37.0 35.0 39.2 33.2 41.0 75-79 35.0553 35.8 35.0 37.6 32.6 39.2 80-84 34.25355 35.0 35.0 36.2 32.0 37.6 85-89 33.65725 35.0 35.0 35.4 32.0 36.4 90-94 33.334450000000004 35.0 34.4 35.0 31.2 36.0 95-99 33.1219 35.0 34.0 35.0 30.8 35.2 100-104 33.04135 35.0 34.0 35.0 30.8 35.0 105-109 32.8798 35.0 34.0 35.0 30.0 35.0 110-114 32.7572 35.0 34.0 35.0 29.6 35.0 115-119 32.54295 35.0 34.0 35.0 29.0 35.0 120-124 32.35055 35.0 33.2 35.0 28.2 35.0 125-129 32.16935 35.0 33.0 35.0 27.0 35.0 130-134 31.7529 34.8 32.8 35.0 25.4 35.0 135-139 31.34665 34.0 32.0 35.0 24.8 35.0 140-144 30.776500000000006 34.0 31.6 35.0 23.0 35.0 145-149 29.925899999999995 34.0 31.0 35.0 12.0 35.0 150 25.89 30.0 23.0 34.0 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 52.0 3 6.0 4 4.0 5 3.0 6 0.0 7 2.0 8 1.0 9 8.0 10 3.0 11 3.0 12 5.0 13 5.0 14 2.0 15 3.0 16 4.0 17 4.0 18 5.0 19 2.0 20 9.0 21 8.0 22 4.0 23 13.0 24 14.0 25 10.0 26 15.0 27 23.0 28 17.0 29 37.0 30 47.0 31 48.0 32 68.0 33 107.0 34 219.0 35 409.0 36 1277.0 37 1531.0 38 32.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.225 19.6 12.475 28.7 2 25.474999999999998 25.624999999999996 33.050000000000004 15.85 3 19.35 27.175 33.125 20.349999999999998 4 24.4 33.35 23.400000000000002 18.85 5 25.8 36.25 21.275 16.675 6 19.650000000000002 39.85 23.3 17.2 7 21.175 22.075 39.074999999999996 17.675 8 22.0 24.65 30.775000000000002 22.575 9 23.10577644411103 22.85571392848212 30.882720680170046 23.15578894723681 10-14 23.602360236023603 28.802880288028803 26.67766776677668 20.91709170917092 15-19 23.895 27.68 28.18 20.244999999999997 20-24 23.015 27.925 27.865000000000002 21.195 25-29 23.89 28.084999999999997 28.16 19.865 30-34 23.858578786818022 27.86417962694404 28.219232884932737 20.058008701305198 35-39 23.244999999999997 28.265 28.065 20.424999999999997 40-44 23.556177808890443 28.16640832041602 27.85139256962848 20.426021301065052 45-49 24.0960240060015 27.686921730432605 28.047011752938232 20.170042510627656 50-54 23.20580145036259 27.696924231057764 28.727181795448864 20.370092523130783 55-59 23.7023702370237 27.607760776077605 28.007800780078007 20.68206820682068 60-64 23.738560784117617 27.13407011051658 28.379256888533277 20.748112216832524 65-69 23.18231823182318 28.217821782178216 28.86788678867887 19.731973197319732 70-74 23.790947736934235 27.421855463865967 28.287071767941985 20.500125031257816 75-79 23.226161308065404 27.43637181859093 28.581429071453574 20.756037801890095 80-84 24.13 27.439999999999998 28.749999999999996 19.68 85-89 23.74856228434265 27.089063359503925 29.139370905635847 20.023003450517578 90-94 23.695 27.150000000000002 28.925 20.23 95-99 24.315 27.205000000000002 28.694999999999997 19.785 100-104 23.755000000000003 28.115000000000002 28.249999999999996 19.88 105-109 24.72623631181559 27.721386069303467 27.876393819690986 19.675983799189957 110-114 24.785 27.205000000000002 28.305000000000003 19.705000000000002 115-119 25.575 27.779999999999998 27.395000000000003 19.25 120-124 26.6753350670134 27.640528105621126 27.170434086817362 18.513702740548112 125-129 26.292629262926294 27.582758275827583 26.817681768176815 19.306930693069308 130-134 26.757675767576757 28.257825782578255 26.957695769576954 18.026802680268027 135-139 28.222822282228222 27.3977397739774 26.33763376337634 18.04180418041804 140-144 28.15485419896964 27.81973690791777 26.07412594408043 17.95128294903216 145-149 28.672203321993194 27.376425855513308 25.470282169301584 18.481088653191915 150 28.97897897897898 27.97797797797798 24.574574574574577 18.46846846846847 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 1.0 7 0.5 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 1.5 14 1.5 15 0.0 16 0.5 17 0.5 18 1.0 19 1.0 20 0.0 21 1.0 22 2.0 23 1.5 24 2.0 25 5.0 26 5.0 27 6.0 28 9.0 29 12.5 30 19.5 31 24.0 32 29.5 33 37.0 34 45.5 35 66.0 36 94.0 37 111.0 38 119.0 39 155.0 40 198.5 41 221.5 42 245.0 43 262.5 44 267.0 45 275.5 46 271.5 47 246.0 48 235.5 49 219.0 50 191.0 51 164.0 52 124.5 53 88.0 54 60.0 55 42.0 56 33.5 57 26.5 58 17.5 59 14.0 60 12.5 61 8.0 62 6.0 63 3.0 64 2.5 65 2.0 66 2.0 67 2.5 68 1.5 69 0.5 70 0.0 71 0.5 72 1.5 73 1.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.025 10-14 0.01 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.015 35-39 0.0 40-44 0.005 45-49 0.025 50-54 0.025 55-59 0.01 60-64 0.015 65-69 0.01 70-74 0.025 75-79 0.005 80-84 0.0 85-89 0.015 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.005 110-114 0.0 115-119 0.0 120-124 0.02 125-129 0.01 130-134 0.01 135-139 0.01 140-144 0.034999999999999996 145-149 0.06 150 0.1 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74931060416145 99.47500000000001 2 0.22562045625470042 0.44999999999999996 3 0.0250689395838556 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.2 0.0 0.0 0.0 0.0 76-77 0.3 0.0 0.0 0.0 0.0 78-79 0.425 0.0 0.0 0.0 0.0 80-81 0.475 0.0 0.0 0.0 0.0 82-83 0.5625 0.0 0.0 0.0 0.0 84-85 0.575 0.0 0.0 0.0 0.0 86-87 0.625 0.0 0.0 0.0 0.0 88-89 0.7125 0.0 0.0 0.0 0.0 90-91 0.95 0.0 0.0 0.0 0.0 92-93 1.2374999999999998 0.0 0.0 0.0 0.0 94-95 1.625 0.0 0.0 0.0 0.0 96-97 2.025 0.0 0.0 0.0 0.0 98-99 2.65 0.0 0.0 0.0 0.0 100-101 3.2625 0.0 0.0 0.0 0.0 102-103 3.8625 0.0 0.0 0.0 0.0 104-105 4.6625 0.0 0.0 0.0 0.0 106-107 5.637499999999999 0.0 0.0 0.0 0.0 108-109 6.5375 0.0 0.0 0.0 0.0 110-111 7.425 0.0 0.0 0.0 0.0 112-113 8.45 0.0 0.0 0.0 0.0 114-115 9.5 0.0 0.0 0.0 0.0 116-117 10.725 0.0 0.0 0.0 0.0 118-119 11.6375 0.0 0.0 0.0 0.0 120-121 12.325 0.0 0.0 0.0 0.0 122-123 13.2625 0.0 0.0 0.0 0.0 124-125 14.575 0.0 0.0 0.0 0.0 126-127 15.8625 0.0 0.0 0.0 0.0 128-129 16.75 0.0 0.0 0.0 0.0 130-131 18.112499999999997 0.0 0.0 0.0 0.0 132-133 19.6125 0.0 0.0 0.0 0.0 134-135 21.049999999999997 0.0 0.0 0.0 0.0 136-137 22.5375 0.0 0.0 0.0 0.0 138 23.575 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAAAAA 195 3.3025186E-5 8.861539 140-144 >>END_MODULE Read 1448761 spots for SRR1799532.sra Written 1448761 spots for SRR1799532.sra Read 1448761 spots for SRR1799532.sra Written 1448761 spots for SRR1799532.sra Read 1448761 spots for SRR1799532.sra Written 1448761 spots for SRR1799532.sra Read 1448761 spots for SRR1799532.sra Written 1448761 spots for SRR1799532.sra Read 1448761 spots for SRR1799532.sra Written 1448761 spots for SRR1799532.sra Read 1448761 spots for SRR1799532.sra Written 1448761 spots for SRR1799532.sra Read 1448761 spots for SRR1799532.sra Written 1448761 spots for SRR1799532.sra Read 1448761 spots for SRR1799532.sra Written 1448761 spots for SRR1799532.sra Read 1448761 spots for SRR1799532.sra Written 1448761 spots for SRR1799532.sra Read 1448761 spots for SRR1799532.sra Written 1448761 spots for SRR1799532.sra Read 1448761 spots for SRR1799532.sra Written 1448761 spots for SRR1799532.sra Read 1448761 spots for SRR1799532.sra Written 1448761 spots for SRR1799532.sra Read 1448761 spots for SRR1799532.sra Written 1448761 spots for SRR1799532.sra Read 1448761 spots for SRR1799532.sra Written 1448761 spots for SRR1799532.sra Read 1448761 spots for SRR1799532.sra Written 1448761 spots for SRR1799532.sra Read 1448761 spots for SRR1799532.sra Written 1448761 spots for SRR1799532.sra Read 1448778 spots for SRR1799532.sra Written 1448778 spots for SRR1799532.sra Read 1448761 spots for SRR1799532.sra Written 1448761 spots for SRR1799532.sra Read 1448761 spots for SRR1799532.sra Written 1448761 spots for SRR1799532.sra Read 1448761 spots for SRR1799532.sra Written 1448761 spots for SRR1799532.sra SRR ids: ['SRR1799532.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ynb34336 SRR1799532.sra spots: 28975237 blocks: [[1, 1448761], [1448762, 2897522], [2897523, 4346283], [4346284, 5795044], [5795045, 7243805], [7243806, 8692566], [8692567, 10141327], [10141328, 11590088], [11590089, 13038849], [13038850, 14487610], [14487611, 15936371], [15936372, 17385132], [17385133, 18833893], [18833894, 20282654], [20282655, 21731415], [21731416, 23180176], [23180177, 24628937], [24628938, 26077698], [26077699, 27526459], [27526460, 28975237]] SRR1799532 file size 9740464 SRR1799532 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR1799532 SRR1799532_1.fastq SRR1799532_2.fastq Input file: SRR1799532_1.fastq Paired file: SRR1799532_2.fastq trimmed: SRR1799532-trimmed-pair1.fastq, SRR1799532-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 21:28:50 2025 >> started Thu Feb 13 21:29:22 2025 >> done (31.859s) 28975237 read pairs processed; of these: 101701 ( 0.35%) short read pairs filtered out after trimming by size control 374376 ( 1.29%) empty read pairs filtered out after trimming by size control 28499160 (98.36%) read pairs available; of these: 13423437 (47.10%) trimmed read pairs available after processing 15075723 (52.90%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 3 0.00% 20 8 0.00% 21 23 0.00% 22 12 0.00% 23 32 0.00% 24 37 0.00% 25 48 0.00% 26 57 0.00% 27 63 0.00% 28 83 0.00% 29 138 0.00% 30 169 0.00% 31 199 0.00% 32 266 0.00% 33 258 0.00% 34 283 0.00% 35 370 0.00% 36 410 0.00% 37 442 0.00% 38 503 0.00% 39 543 0.00% 40 633 0.00% 41 710 0.00% 42 787 0.00% 43 816 0.00% 44 922 0.00% 45 1040 0.00% 46 1099 0.00% 47 1148 0.00% 48 1370 0.00% 49 1300 0.00% 50 1516 0.01% 51 1640 0.01% 52 1775 0.01% 53 1828 0.01% 54 1890 0.01% 55 2082 0.01% 56 2231 0.01% 57 2516 0.01% 58 3554 0.01% 59 3045 0.01% 60 3281 0.01% 61 3516 0.01% 62 3751 0.01% 63 3973 0.01% 64 4468 0.02% 65 4953 0.02% 66 6645 0.02% 67 6421 0.02% 68 7202 0.03% 69 7372 0.03% 70 7618 0.03% 71 8651 0.03% 72 9760 0.03% 73 10773 0.04% 74 12192 0.04% 75 13800 0.05% 76 15255 0.05% 77 15726 0.06% 78 17265 0.06% 79 17311 0.06% 80 17386 0.06% 81 15475 0.05% 82 14279 0.05% 83 13577 0.05% 84 18972 0.07% 85 19814 0.07% 86 21936 0.08% 87 25353 0.09% 88 31924 0.11% 89 38993 0.14% 90 45983 0.16% 91 42593 0.15% 92 43767 0.15% 93 72488 0.25% 94 75868 0.27% 95 58623 0.21% 96 59018 0.21% 97 60182 0.21% 98 65001 0.23% 99 92763 0.33% 100 122661 0.43% 101 96164 0.34% 102 100942 0.35% 103 123912 0.43% 104 139686 0.49% 105 131351 0.46% 106 149555 0.52% 107 156340 0.55% 108 140390 0.49% 109 147720 0.52% 110 138943 0.49% 111 160871 0.56% 112 158434 0.56% 113 146404 0.51% 114 177527 0.62% 115 210394 0.74% 116 156131 0.55% 117 114630 0.40% 118 110071 0.39% 119 123864 0.43% 120 137695 0.48% 121 168148 0.59% 122 186391 0.65% 123 218254 0.77% 124 210847 0.74% 125 167150 0.59% 126 153777 0.54% 127 190406 0.67% 128 169054 0.59% 129 187817 0.66% 130 207168 0.73% 131 229920 0.81% 132 228571 0.80% 133 222341 0.78% 134 244450 0.86% 135 258375 0.91% 136 259981 0.91% 137 262665 0.92% 138 267016 0.94% 139 277347 0.97% 140 280364 0.98% 141 288580 1.01% 142 297389 1.04% 143 310042 1.09% 144 334244 1.17% 145 364129 1.28% 146 432969 1.52% 147 503220 1.77% 148 697423 2.45% 149 1811936 6.36% 150 15075723 52.90% 28499160 reads passed initial QC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=2.89 fanout-score-rank=29 prefix-density=0.19 prefix-fanout=2.5 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCA criterion=fanout-score sequence-density=0.02 sequence-density-rank=40 fanout-score=339.81 fanout-score-rank=1 prefix-density=0.29 prefix-fanout=19.4 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCCCTGGGAGATTTT criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=1.94 fanout-score-rank=42 prefix-density=0.20 prefix-fanout=1.9 sequence=TTCTCTCGCATTGACCACAAGTTTGATCTCATGTATGCCAAGCGTGCGTTTGTGCACTGGTATGTTGG criterion=fanout-score sequence-density=0.03 sequence-density-rank=42 fanout-score=99.44 fanout-score-rank=1 prefix-density=0.27 prefix-fanout=10.6 sequence=CACCACCACTGGTAACAAGGACATCATCATGGTTGATCACATGAGGAAGATGAAGAACAATGCCATTGTCTGCAACATCGGTCACTTCGATAATGAAATCGACATGCTTGGACTTGAGACCTTCCCTGGCGTGAAGCGCATCACCATCAAGCCCCAAACTGACAGGTGGGTCTTCCCTGACACCAACTCCGGCATCATTGTCCTGGCTGAGGGACGTCTCATGAACCTGGGATGTGCCACCGGTCACCCC SRR1799532 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 21:30:03 Started mapping on | Feb 13 21:30:03 Finished on | Feb 13 21:31:58 Mapping speed, Million of reads per hour | 892.15 Number of input reads | 28499160 Average input read length | 280 UNIQUE READS: Uniquely mapped reads number | 27716045 Uniquely mapped reads % | 97.25% Average mapped length | 279.65 Number of splices: Total | 22482430 Number of splices: Annotated (sjdb) | 22075428 Number of splices: GT/AG | 22126949 Number of splices: GC/AG | 268696 Number of splices: AT/AC | 21269 Number of splices: Non-canonical | 65516 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.60 Insertion rate per base | 0.02% Insertion average length | 2.25 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 533833 % of reads mapped to multiple loci | 1.87% Number of reads mapped to too many loci | 25782 % of reads mapped to too many loci | 0.09% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.76% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 277192 277192 277192 N_multimapping 533833 533833 533833 N_noFeature 844352 27301162 1047709 N_ambiguous 314414 1331 102014 UnstrandedReadsAssigned:26557279 PositiveStrandReadsAssigned:413552 NegativeStrandReadsAssigned:26566322 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=131 echo kmer=127 SRR1799532 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR1799532-trimmed-pair1.fastq SRR1799532-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 28,499,160 reads, 26,479,513 reads pseudoaligned [quant] estimated average fragment length: 177.247 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,247 rounds 52401 SRR1799532.ke.tsv 34699 SRR1799532.se.tsv 87100 total ==> SRR1799532.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1841.75 526 11.9168 Potri.005G024800.1.v4.1 1035 858.753 85 4.13006 Potri.004G059700.1.v4.1 961 784.753 33 1.75464 Potri.007G009000.2.v4.1 1416 1239.75 0 0 Potri.003G141000.2.v4.1 2943 2766.75 372.109 5.61184 Potri.016G087400.1.v4.1 270 109.039 2935 1123.14 Potri.015G069301.1.v4.1 564 388.235 0 0 Potri.010G195200.1.v4.1 1773 1596.75 83 2.16893 Potri.012G127500.1.v4.1 977 800.753 9811 511.235 ==> SRR1799532.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 3447 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 581 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 8 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR1799532 completed mapping pipeline successfully