Starting /dee2/code/volunteer_pipeline.sh SRR1799533 current disk space = 3087763390464 free memory = 1446632196 SRR1799533 SRAfilesize 087c08d6d44a068fee62b29cfd7633af SRR1799533.sra SRR1799533.sra file validated SRR1799533 is paired end SRR1799533 is conventional basespace SRR1799533 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR1799533_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.352 34.0 33.0 34.0 31.0 34.0 2 32.86325 34.0 34.0 34.0 31.0 34.0 3 33.29775 34.0 34.0 34.0 31.0 34.0 4 36.604 37.0 37.0 37.0 35.0 37.0 5 36.6005 37.0 37.0 37.0 35.0 37.0 6 36.61375 37.0 37.0 37.0 35.0 37.0 7 36.63875 37.0 37.0 37.0 35.0 37.0 8 36.653 37.0 37.0 37.0 35.0 37.0 9 38.549 39.0 39.0 39.0 38.0 39.0 10-14 38.8406 39.4 39.2 39.4 37.6 39.4 15-19 40.143100000000004 41.0 40.0 41.0 38.2 41.0 20-24 40.15955 41.0 40.0 41.0 38.4 41.0 25-29 40.05685 41.0 40.0 41.0 38.0 41.0 30-34 39.9268 41.0 40.0 41.0 38.0 41.0 35-39 39.813399999999994 41.0 40.0 41.0 38.0 41.0 40-44 39.6074 41.0 40.0 41.0 37.4 41.0 45-49 39.429199999999994 41.0 39.6 41.0 36.8 41.0 50-54 39.1152 40.2 39.0 41.0 35.8 41.0 55-59 38.79105 40.0 38.0 41.0 35.0 41.0 60-64 38.7211 40.0 37.6 41.0 35.0 41.0 65-69 38.09415 39.2 36.4 41.0 35.0 41.0 70-74 37.06365 37.6 35.2 39.4 34.0 41.0 75-79 35.744550000000004 36.2 34.8 37.4 33.4 39.4 80-84 35.137950000000004 35.2 35.0 36.6 33.6 37.8 85-89 34.56255 35.0 35.0 35.8 33.0 36.6 90-94 34.16674999999999 35.0 35.0 35.0 33.0 36.0 95-99 34.059650000000005 35.0 35.0 35.0 33.0 35.4 100-104 33.774249999999995 35.0 34.2 35.0 31.8 35.0 105-109 33.8001 35.0 34.4 35.0 31.8 35.0 110-114 33.66455 35.0 34.0 35.0 31.8 35.0 115-119 33.5978 35.0 34.0 35.0 31.8 35.0 120-124 33.468050000000005 35.0 34.0 35.0 31.0 35.0 125-129 33.237300000000005 35.0 34.0 35.0 31.0 35.0 130-134 33.0867 35.0 34.0 35.0 30.4 35.0 135-139 32.803700000000006 35.0 34.0 35.0 29.8 35.0 140-144 32.541549999999994 35.0 33.4 35.0 29.4 35.0 145-149 31.968300000000006 35.0 33.0 35.0 28.2 35.0 150 26.50575 33.0 23.0 35.0 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 1.0 10 2.0 11 0.0 12 1.0 13 2.0 14 5.0 15 1.0 16 1.0 17 5.0 18 6.0 19 4.0 20 7.0 21 8.0 22 6.0 23 4.0 24 6.0 25 12.0 26 20.0 27 11.0 28 25.0 29 25.0 30 35.0 31 45.0 32 53.0 33 88.0 34 152.0 35 336.0 36 1141.0 37 1958.0 38 39.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.33367768595041 11.389462809917356 7.515495867768596 41.76136363636363 2 21.07107107107107 15.315315315315313 35.53553553553554 28.07807807807808 3 20.525 16.45 26.150000000000002 36.875 4 23.234852278417627 25.087631447170754 21.98297446169254 29.694541812719077 5 23.175 31.924999999999997 24.025 20.875 6 20.175 35.875 22.55 21.4 7 13.55 27.625 40.550000000000004 18.275 8 16.125 27.750000000000004 33.15 22.975 9 17.724999999999998 27.1 32.324999999999996 22.85 10-14 19.255 30.78 26.840000000000003 23.125 15-19 19.705000000000002 28.895 27.355 24.044999999999998 20-24 19.68 29.409999999999997 27.38 23.53 25-29 19.985 29.349999999999998 27.24 23.425 30-34 19.72 28.985 27.435 23.86 35-39 19.535 28.935 27.51 24.02 40-44 19.75 29.255 27.544999999999998 23.45 45-49 19.63 29.03 27.334999999999997 24.005000000000003 50-54 20.11 28.884999999999998 27.105 23.9 55-59 20.165 29.049999999999997 27.279999999999998 23.505000000000003 60-64 20.424999999999997 28.845 27.13 23.599999999999998 65-69 20.064999999999998 29.080000000000002 27.589999999999996 23.265 70-74 20.04 29.075 27.58 23.305 75-79 20.285 28.945 27.445000000000004 23.325000000000003 80-84 20.474999999999998 28.599999999999998 26.745 24.18 85-89 20.26 28.96 27.365000000000002 23.415 90-94 20.5 28.37 27.279999999999998 23.849999999999998 95-99 19.955000000000002 29.14 27.1 23.805 100-104 20.615 28.355000000000004 27.22 23.810000000000002 105-109 20.895 28.405 26.724999999999998 23.974999999999998 110-114 20.72 29.049999999999997 26.384999999999998 23.845 115-119 21.365000000000002 28.865000000000002 25.7 24.07 120-124 21.759999999999998 29.15 25.855 23.235 125-129 21.77 28.815 25.779999999999998 23.635 130-134 21.709999999999997 29.18 25.215 23.895 135-139 21.335 29.275000000000002 24.755 24.635 140-144 21.275 29.95 24.63 24.145 145-149 20.4 29.195 25.1 25.305 150 16.997736987679154 29.670605984410358 26.301232084485793 27.03042494342469 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 0.5 21 0.0 22 1.5 23 2.0 24 1.5 25 1.5 26 4.5 27 9.0 28 12.0 29 11.5 30 15.0 31 32.0 32 41.0 33 45.0 34 57.5 35 74.0 36 91.5 37 106.5 38 132.5 39 175.5 40 195.5 41 202.5 42 235.0 43 257.5 44 263.5 45 268.5 46 267.0 47 251.5 48 233.5 49 197.5 50 156.0 51 144.5 52 122.0 53 93.0 54 74.0 55 59.5 56 42.5 57 26.0 58 23.0 59 18.5 60 10.5 61 7.5 62 6.0 63 4.0 64 5.0 65 5.0 66 2.5 67 3.0 68 4.0 69 2.0 70 0.5 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.2 2 0.1 3 0.0 4 0.15 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.575 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57318604067285 99.15 2 0.42681395932714034 0.8500000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.0875 0.0 0.0 0.0 0.0 74-75 0.16249999999999998 0.0 0.0 0.0 0.0 76-77 0.23750000000000002 0.0 0.0 0.0 0.0 78-79 0.2875 0.0 0.0 0.0 0.0 80-81 0.375 0.0 0.0 0.0 0.0 82-83 0.525 0.0 0.0 0.0 0.0 84-85 0.6 0.0 0.0 0.0 0.0 86-87 0.7250000000000001 0.0 0.0 0.0 0.0 88-89 0.85 0.0 0.0 0.0 0.0 90-91 0.875 0.0 0.0 0.0 0.0 92-93 1.0499999999999998 0.0 0.0 0.0 0.0 94-95 1.125 0.0 0.0 0.0 0.0 96-97 1.25 0.0 0.0 0.0 0.0 98-99 1.5625 0.0 0.0 0.0 0.0 100-101 1.7125 0.0 0.0 0.0 0.0 102-103 2.2750000000000004 0.0 0.0 0.0 0.0 104-105 3.1625 0.0 0.0 0.0 0.0 106-107 3.6625 0.0 0.0 0.0 0.0 108-109 4.475 0.0 0.0 0.0 0.0 110-111 5.45 0.0 0.0 0.0 0.0 112-113 6.3625 0.0 0.0 0.0 0.0 114-115 7.5875 0.0 0.0 0.0 0.0 116-117 8.725000000000001 0.0 0.0 0.0 0.0 118-119 9.725000000000001 0.0 0.0 0.0 0.0 120-121 10.675 0.0 0.0 0.0 0.0 122-123 11.975 0.0 0.0 0.0 0.0 124-125 12.8625 0.0 0.0 0.0 0.0 126-127 14.075 0.0 0.0 0.0 0.0 128-129 15.4625 0.0 0.0 0.0 0.0 130-131 17.05 0.0 0.0 0.0 0.0 132-133 18.525 0.0 0.0 0.0 0.0 134-135 19.924999999999997 0.0 0.0 0.0 0.0 136-137 21.575 0.0 0.0 0.0 0.0 138 22.7 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR1799533 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR1799533_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.57625 34.0 33.0 34.0 31.0 34.0 2 32.51775 34.0 33.0 34.0 31.0 34.0 3 32.78425 34.0 33.0 34.0 31.0 34.0 4 36.14275 37.0 37.0 37.0 35.0 37.0 5 36.148 37.0 37.0 37.0 35.0 37.0 6 36.1805 37.0 37.0 37.0 35.0 37.0 7 36.18175 37.0 37.0 37.0 35.0 37.0 8 36.142 37.0 37.0 37.0 35.0 37.0 9 37.9705 39.0 39.0 39.0 37.0 39.0 10-14 38.356399999999994 39.4 39.2 39.4 37.2 39.4 15-19 39.681999999999995 41.0 40.0 41.0 38.0 41.0 20-24 39.5681 41.0 40.0 41.0 38.0 41.0 25-29 39.4999 41.0 40.0 41.0 38.0 41.0 30-34 39.36945 41.0 40.0 41.0 37.8 41.0 35-39 39.178149999999995 41.0 40.0 41.0 36.6 41.0 40-44 38.920399999999994 41.0 39.4 41.0 36.0 41.0 45-49 38.6823 40.4 39.0 41.0 35.2 41.0 50-54 37.9012 39.6 38.0 40.6 34.0 40.8 55-59 38.0202 40.0 37.8 41.0 33.8 41.0 60-64 37.936899999999994 39.8 37.2 41.0 34.0 41.0 65-69 37.325050000000005 39.0 36.2 41.0 34.0 41.0 70-74 36.376000000000005 37.2 35.0 39.2 34.0 41.0 75-79 35.2475 35.8 35.0 37.6 33.0 39.2 80-84 34.3307 35.0 35.0 36.4 32.2 37.4 85-89 33.74 35.0 35.0 35.4 31.6 36.2 90-94 33.4891 35.0 34.0 35.0 31.2 36.0 95-99 33.2861 35.0 34.0 35.0 31.0 35.2 100-104 33.1363 35.0 34.0 35.0 30.6 35.0 105-109 33.03825 35.0 34.0 35.0 30.4 35.0 110-114 32.962599999999995 35.0 34.0 35.0 30.4 35.0 115-119 32.78829999999999 35.0 34.0 35.0 29.8 35.0 120-124 32.5862 35.0 33.8 35.0 29.2 35.0 125-129 32.3409 35.0 33.4 35.0 29.0 35.0 130-134 32.0318 35.0 33.0 35.0 27.0 35.0 135-139 31.714 35.0 33.0 35.0 25.2 35.0 140-144 31.29305 34.8 32.2 35.0 24.4 35.0 145-149 30.61365 34.0 32.0 35.0 21.0 35.0 150 28.3315 33.0 29.0 35.0 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 39.0 3 1.0 4 2.0 5 2.0 6 1.0 7 3.0 8 1.0 9 5.0 10 4.0 11 5.0 12 5.0 13 3.0 14 2.0 15 4.0 16 2.0 17 4.0 18 5.0 19 5.0 20 9.0 21 5.0 22 8.0 23 13.0 24 16.0 25 12.0 26 21.0 27 20.0 28 23.0 29 29.0 30 44.0 31 55.0 32 78.0 33 87.0 34 176.0 35 369.0 36 1266.0 37 1639.0 38 37.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.29281767955801 18.75941737820191 11.953792064289303 31.993972877950778 2 25.957446808510635 26.207759699624532 32.090112640801 15.74468085106383 3 19.764823617713283 27.89592194145609 31.873905429071804 20.465349011758818 4 23.742807105328996 32.34926194645985 24.59344508381286 19.314485864398296 5 25.56278139069535 35.34267133566784 23.836918459229615 15.257628814407203 6 20.200000000000003 38.025 24.125 17.65 7 20.225 19.7 39.95 20.125 8 21.3 24.85 29.125 24.725 9 24.474999999999998 24.224999999999998 28.95 22.35 10-14 24.05 28.544999999999998 26.974999999999998 20.43 15-19 23.695 27.705000000000002 27.915 20.685000000000002 20-24 23.48 28.035 28.035 20.45 25-29 23.665 27.560000000000002 28.165000000000003 20.61 30-34 23.895 26.99 28.565 20.549999999999997 35-39 23.375 27.68 27.87 21.075 40-44 24.03 27.389999999999997 28.065 20.515 45-49 23.445 27.605 28.410000000000004 20.54 50-54 23.645 27.450000000000003 28.28 20.625 55-59 23.565 27.68 28.310000000000002 20.445 60-64 24.075 27.605 28.01 20.31 65-69 23.200000000000003 27.675 28.765 20.36 70-74 23.785 27.445000000000004 27.96 20.810000000000002 75-79 23.875 27.765 28.249999999999996 20.11 80-84 24.67 27.105 28.095 20.13 85-89 24.285 27.779999999999998 27.855 20.080000000000002 90-94 23.96 27.36 28.475 20.205000000000002 95-99 23.945 27.305 28.860000000000003 19.89 100-104 24.59 27.48 28.044999999999998 19.885 105-109 24.515 27.565 28.625 19.295 110-114 24.995 28.139999999999997 26.919999999999998 19.945 115-119 25.314999999999998 27.865000000000002 27.04 19.78 120-124 25.69 27.565 27.515 19.23 125-129 26.419999999999998 27.775 26.77 19.035 130-134 27.355 28.215 25.900000000000002 18.529999999999998 135-139 27.415 28.29 26.31 17.985 140-144 27.74 28.110000000000003 26.040000000000003 18.11 145-149 28.799999999999997 27.625 25.430000000000003 18.145 150 27.94858870967742 28.125 25.378024193548388 18.548387096774192 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.5 23 1.0 24 1.5 25 2.5 26 2.5 27 4.5 28 7.5 29 6.5 30 12.0 31 16.5 32 25.5 33 36.0 34 47.5 35 68.5 36 85.5 37 115.5 38 127.5 39 148.5 40 194.5 41 222.0 42 250.5 43 266.0 44 277.0 45 279.5 46 281.0 47 269.5 48 231.5 49 201.0 50 164.5 51 145.0 52 119.5 53 87.0 54 72.0 55 52.0 56 41.5 57 38.5 58 27.5 59 17.5 60 13.0 61 6.5 62 5.5 63 5.5 64 2.0 65 2.5 66 3.0 67 3.0 68 2.5 69 1.0 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.5 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.44999999999999996 2 0.125 3 0.075 4 0.075 5 0.05 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.8 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64868255959848 99.275 2 0.32622333751568383 0.65 3 0.02509410288582183 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.0875 0.0 0.0 0.0 0.0 74-75 0.16249999999999998 0.0 0.0 0.0 0.0 76-77 0.23750000000000002 0.0 0.0 0.0 0.0 78-79 0.2875 0.0 0.0 0.0 0.0 80-81 0.375 0.0 0.0 0.0 0.0 82-83 0.525 0.0 0.0 0.0 0.0 84-85 0.6 0.0 0.0 0.0 0.0 86-87 0.7 0.0 0.0 0.0 0.0 88-89 0.825 0.0 0.0 0.0 0.0 90-91 0.85 0.0 0.0 0.0 0.0 92-93 1.025 0.0 0.0 0.0 0.0 94-95 1.0875 0.0 0.0 0.0 0.0 96-97 1.2 0.0 0.0 0.0 0.0 98-99 1.5125 0.0 0.0 0.0 0.0 100-101 1.6625 0.0 0.0 0.0 0.0 102-103 2.2 0.0 0.0 0.0 0.0 104-105 3.075 0.0 0.0 0.0 0.0 106-107 3.55 0.0 0.0 0.0 0.0 108-109 4.375 0.0 0.0 0.0 0.0 110-111 5.3625 0.0 0.0 0.0 0.0 112-113 6.3125 0.0 0.0 0.0 0.0 114-115 7.5125 0.0 0.0 0.0 0.0 116-117 8.649999999999999 0.0 0.0 0.0 0.0 118-119 9.675 0.0 0.0 0.0 0.0 120-121 10.5875 0.0 0.0 0.0 0.0 122-123 11.825 0.0 0.0 0.0 0.0 124-125 12.725 0.0 0.0 0.0 0.0 126-127 13.95 0.0 0.0 0.0 0.0 128-129 15.3375 0.0 0.0 0.0 0.0 130-131 16.9 0.0 0.0 0.0 0.0 132-133 18.3625 0.0 0.0 0.0 0.0 134-135 19.8125 0.0 0.0 0.0 0.0 136-137 21.4875 0.0 0.0 0.0 0.0 138 22.625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATTGTTC 10 0.006973645 144.0 6 GTGGATC 10 0.006973645 144.0 2 >>END_MODULE Read 1508340 spots for SRR1799533.sra Written 1508340 spots for SRR1799533.sra Read 1508340 spots for SRR1799533.sra Written 1508340 spots for SRR1799533.sra Read 1508340 spots for SRR1799533.sra Written 1508340 spots for SRR1799533.sra Read 1508340 spots for SRR1799533.sra Written 1508340 spots for SRR1799533.sra Read 1508340 spots for SRR1799533.sra Written 1508340 spots for SRR1799533.sra Read 1508340 spots for SRR1799533.sra Written 1508340 spots for SRR1799533.sra Read 1508340 spots for SRR1799533.sra Written 1508340 spots for SRR1799533.sra Read 1508340 spots for SRR1799533.sra Written 1508340 spots for SRR1799533.sra Read 1508340 spots for SRR1799533.sra Written 1508340 spots for SRR1799533.sra Read 1508340 spots for SRR1799533.sra Written 1508340 spots for SRR1799533.sra Read 1508340 spots for SRR1799533.sra Written 1508340 spots for SRR1799533.sra Read 1508340 spots for SRR1799533.sra Written 1508340 spots for SRR1799533.sra Read 1508340 spots for SRR1799533.sra Written 1508340 spots for SRR1799533.sra Read 1508340 spots for SRR1799533.sra Written 1508340 spots for SRR1799533.sra Read 1508340 spots for SRR1799533.sra Written 1508340 spots for SRR1799533.sra Read 1508340 spots for SRR1799533.sra Written 1508340 spots for SRR1799533.sra Read 1508344 spots for SRR1799533.sra Written 1508344 spots for SRR1799533.sra Read 1508340 spots for SRR1799533.sra Written 1508340 spots for SRR1799533.sra Read 1508340 spots for SRR1799533.sra Written 1508340 spots for SRR1799533.sra Read 1508340 spots for SRR1799533.sra Written 1508340 spots for SRR1799533.sra SRR ids: ['SRR1799533.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_6le5rtw1 SRR1799533.sra spots: 30166804 blocks: [[1, 1508340], [1508341, 3016680], [3016681, 4525020], [4525021, 6033360], [6033361, 7541700], [7541701, 9050040], [9050041, 10558380], [10558381, 12066720], [12066721, 13575060], [13575061, 15083400], [15083401, 16591740], [16591741, 18100080], [18100081, 19608420], [19608421, 21116760], [21116761, 22625100], [22625101, 24133440], [24133441, 25641780], [25641781, 27150120], [27150121, 28658460], [28658461, 30166804]] SRR1799533 file size 10141920 SRR1799533 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR1799533 SRR1799533_1.fastq SRR1799533_2.fastq Input file: SRR1799533_1.fastq Paired file: SRR1799533_2.fastq trimmed: SRR1799533-trimmed-pair1.fastq, SRR1799533-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 20:48:12 2025 >> started Thu Feb 13 20:48:46 2025 >> done (34.667s) 30166804 read pairs processed; of these: 81953 ( 0.27%) short read pairs filtered out after trimming by size control 173309 ( 0.57%) empty read pairs filtered out after trimming by size control 29911542 (99.15%) read pairs available; of these: 13756066 (45.99%) trimmed read pairs available after processing 16155476 (54.01%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 6 0.00% 20 5 0.00% 21 13 0.00% 22 24 0.00% 23 30 0.00% 24 37 0.00% 25 48 0.00% 26 66 0.00% 27 100 0.00% 28 110 0.00% 29 134 0.00% 30 175 0.00% 31 187 0.00% 32 207 0.00% 33 272 0.00% 34 321 0.00% 35 395 0.00% 36 401 0.00% 37 434 0.00% 38 516 0.00% 39 563 0.00% 40 615 0.00% 41 731 0.00% 42 765 0.00% 43 831 0.00% 44 863 0.00% 45 918 0.00% 46 1066 0.00% 47 1130 0.00% 48 1251 0.00% 49 1297 0.00% 50 1330 0.00% 51 1457 0.00% 52 1625 0.01% 53 1716 0.01% 54 1856 0.01% 55 2018 0.01% 56 2086 0.01% 57 2362 0.01% 58 2589 0.01% 59 2832 0.01% 60 3134 0.01% 61 3422 0.01% 62 3662 0.01% 63 4118 0.01% 64 4535 0.02% 65 4779 0.02% 66 5329 0.02% 67 5975 0.02% 68 6368 0.02% 69 7231 0.02% 70 7893 0.03% 71 9107 0.03% 72 10323 0.03% 73 11812 0.04% 74 12974 0.04% 75 14600 0.05% 76 15959 0.05% 77 17820 0.06% 78 19503 0.07% 79 21640 0.07% 80 23825 0.08% 81 26286 0.09% 82 28410 0.09% 83 29278 0.10% 84 36143 0.12% 85 34545 0.12% 86 34901 0.12% 87 24385 0.08% 88 24736 0.08% 89 25562 0.09% 90 34827 0.12% 91 49045 0.16% 92 33393 0.11% 93 33550 0.11% 94 42202 0.14% 95 44831 0.15% 96 53018 0.18% 97 82827 0.28% 98 45808 0.15% 99 42524 0.14% 100 56645 0.19% 101 99847 0.33% 102 115260 0.39% 103 122972 0.41% 104 128746 0.43% 105 87241 0.29% 106 90209 0.30% 107 137231 0.46% 108 158632 0.53% 109 184616 0.62% 110 175501 0.59% 111 134973 0.45% 112 131316 0.44% 113 117914 0.39% 114 157855 0.53% 115 212992 0.71% 116 143607 0.48% 117 165182 0.55% 118 139263 0.47% 119 150354 0.50% 120 192977 0.65% 121 213232 0.71% 122 148099 0.50% 123 126264 0.42% 124 155642 0.52% 125 199334 0.67% 126 219745 0.73% 127 234422 0.78% 128 234324 0.78% 129 237345 0.79% 130 214044 0.72% 131 214461 0.72% 132 249035 0.83% 133 254736 0.85% 134 257163 0.86% 135 258057 0.86% 136 263916 0.88% 137 266524 0.89% 138 270652 0.90% 139 275126 0.92% 140 277379 0.93% 141 283471 0.95% 142 291916 0.98% 143 300590 1.00% 144 321749 1.08% 145 352403 1.18% 146 391134 1.31% 147 471595 1.58% 148 638476 2.13% 149 2258234 7.55% 150 16155476 54.01% 29911542 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=41 prefix-density=0.15 prefix-fanout=2.0 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACAAACTG criterion=fanout-score sequence-density=0.08 sequence-density-rank=22 fanout-score=322.93 fanout-score-rank=1 prefix-density=0.93 prefix-fanout=28.2 sequence=CTTCTTCTTCCT criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=7.21 fanout-score-rank=23 prefix-density=0.23 prefix-fanout=4.6 sequence=CAGTTTGTTGACTGGTGCCCAACTGGGTTCAAGTGTGGCATCAACTACCAGCCACCAACTGTTGTTCCAGGAGGCGACCTTGCTAAGGTTCAGAGGGCTGTTTGCATGATTTCCAATTCCACAAGTGTTGCAGAAGTCTTCTCTCGCATTGACCACAAGTTTGATCTCATGTATGCCAAGCGTGCGTTTGTGCACTGGTATGTTGG criterion=fanout-score sequence-density=0.08 sequence-density-rank=23 fanout-score=273.12 fanout-score-rank=1 prefix-density=0.82 prefix-fanout=27.4 sequence=GAAGAAGAAGAAA SRR1799533 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 20:49:28 Started mapping on | Feb 13 20:49:28 Finished on | Feb 13 20:51:41 Mapping speed, Million of reads per hour | 809.64 Number of input reads | 29911542 Average input read length | 281 UNIQUE READS: Uniquely mapped reads number | 28906516 Uniquely mapped reads % | 96.64% Average mapped length | 280.86 Number of splices: Total | 25072965 Number of splices: Annotated (sjdb) | 24656312 Number of splices: GT/AG | 24688069 Number of splices: GC/AG | 303393 Number of splices: AT/AC | 22392 Number of splices: Non-canonical | 59111 Mismatch rate per base, % | 0.31% Deletion rate per base | 0.03% Deletion average length | 2.59 Insertion rate per base | 0.02% Insertion average length | 2.36 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 588362 % of reads mapped to multiple loci | 1.97% Number of reads mapped to too many loci | 53793 % of reads mapped to too many loci | 0.18% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.18% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 439285 439285 439285 N_multimapping 588362 588362 588362 N_noFeature 842536 28605928 1003703 N_ambiguous 245601 1410 105170 UnstrandedReadsAssigned:27818379 PositiveStrandReadsAssigned:299178 NegativeStrandReadsAssigned:27797643 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=133 echo kmer=129 SRR1799533 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR1799533-trimmed-pair1.fastq SRR1799533-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 29,911,542 reads, 27,679,588 reads pseudoaligned [quant] estimated average fragment length: 180.379 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,093 rounds 52401 SRR1799533.ke.tsv 34699 SRR1799533.se.tsv 87100 total ==> SRR1799533.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1838.62 644 14.0072 Potri.005G024800.1.v4.1 1035 855.621 63 2.94454 Potri.004G059700.1.v4.1 961 781.627 20 1.02327 Potri.007G009000.2.v4.1 1416 1236.62 0 0 Potri.003G141000.2.v4.1 2943 2763.62 480.195 6.9486 Potri.016G087400.1.v4.1 270 107.26 2397.05 893.713 Potri.015G069301.1.v4.1 564 385.197 0 0 Potri.010G195200.1.v4.1 1773 1593.62 69 1.7315 Potri.012G127500.1.v4.1 977 797.627 12056 604.452 ==> SRR1799533.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1718 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 438 Potri.001G212900.v4.1 3 Potri.001G182400.v4.1 10 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR1799533 completed mapping pipeline successfully