Starting /dee2/code/volunteer_pipeline.sh SRR1799534 current disk space = 3088259006464 free memory = 1496571668 SRR1799534 SRAfilesize 1657b4a04b779d51973e24b38cbdff6b SRR1799534.sra SRR1799534.sra file validated SRR1799534 is paired end SRR1799534 is conventional basespace SRR1799534 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR1799534_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.16775 34.0 33.0 34.0 31.0 34.0 2 33.29675 34.0 34.0 34.0 31.0 34.0 3 33.3285 34.0 34.0 34.0 31.0 34.0 4 36.68 37.0 37.0 37.0 35.0 37.0 5 36.599 37.0 37.0 37.0 35.0 37.0 6 36.613 37.0 37.0 37.0 35.0 37.0 7 36.545 37.0 37.0 37.0 35.0 37.0 8 36.59 37.0 37.0 37.0 35.0 37.0 9 38.439 39.0 39.0 39.0 37.0 39.0 10-14 38.7383 39.4 39.2 39.4 37.2 39.4 15-19 40.08335 41.0 40.0 41.0 38.0 41.0 20-24 40.06255 41.0 40.0 41.0 38.0 41.0 25-29 39.914 41.0 40.0 41.0 38.0 41.0 30-34 39.74865 41.0 40.0 41.0 37.6 41.0 35-39 39.5077 41.0 39.6 41.0 36.8 41.0 40-44 39.36675 41.0 39.4 41.0 36.4 41.0 45-49 39.0125 40.2 39.0 41.0 35.2 41.0 50-54 39.161899999999996 40.4 39.0 41.0 35.8 41.0 55-59 38.941500000000005 40.6 38.6 41.0 35.2 41.0 60-64 38.47455 40.0 37.2 41.0 34.8 41.0 65-69 37.586149999999996 38.8 36.2 40.6 33.8 41.0 70-74 36.5938 37.2 35.0 39.4 33.2 41.0 75-79 35.26445 35.6 34.4 37.4 32.2 39.2 80-84 34.904250000000005 35.0 35.0 36.4 33.0 37.8 85-89 34.1982 35.0 34.4 35.6 31.8 36.4 90-94 33.729949999999995 35.0 34.0 35.0 31.2 36.0 95-99 33.68385 35.0 34.0 35.0 31.8 35.0 100-104 33.4319 35.0 34.0 35.0 30.8 35.0 105-109 33.234849999999994 35.0 34.0 35.0 30.2 35.0 110-114 33.1529 35.0 34.0 35.0 30.2 35.0 115-119 33.00085 35.0 33.8 35.0 29.8 35.0 120-124 32.3473 34.4 32.6 35.0 27.6 35.0 125-129 32.08715 34.0 32.2 35.0 27.0 35.0 130-134 31.67085 34.0 32.0 35.0 25.0 35.0 135-139 31.29035 34.0 31.8 35.0 25.0 35.0 140-144 30.8219 34.0 31.0 35.0 24.0 35.0 145-149 29.597500000000004 34.0 30.0 35.0 12.6 35.0 150 22.743 29.0 15.0 34.0 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 2.0 9 4.0 10 2.0 11 1.0 12 3.0 13 4.0 14 2.0 15 1.0 16 2.0 17 6.0 18 5.0 19 3.0 20 3.0 21 7.0 22 10.0 23 4.0 24 23.0 25 13.0 26 18.0 27 25.0 28 32.0 29 37.0 30 60.0 31 64.0 32 101.0 33 143.0 34 217.0 35 487.0 36 1325.0 37 1387.0 38 8.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.10085298544907 11.013547415955847 6.899147014550929 38.98645258404416 2 22.175 13.975000000000001 36.0 27.85 3 20.575 17.299999999999997 26.150000000000002 35.975 4 23.75 25.25 22.875 28.125 5 23.549999999999997 30.45 24.2 21.8 6 19.1 35.4 24.925 20.575 7 15.0 28.000000000000004 39.6 17.4 8 17.575 25.650000000000002 31.7 25.074999999999996 9 16.175 23.925 35.949999999999996 23.95 10-14 19.35 30.464999999999996 27.305 22.88 15-19 19.605 28.9 27.565 23.93 20-24 19.68 29.09 27.650000000000002 23.580000000000002 25-29 19.919999999999998 29.354999999999997 26.919999999999998 23.805 30-34 19.805 29.520000000000003 27.005000000000003 23.669999999999998 35-39 19.67 29.285 27.435 23.61 40-44 20.05 28.775000000000002 27.500000000000004 23.674999999999997 45-49 20.265 28.349999999999998 27.865000000000002 23.52 50-54 20.025000000000002 29.345 27.310000000000002 23.32 55-59 19.725 28.799999999999997 27.315 24.16 60-64 20.195 28.435 27.6 23.77 65-69 20.055 28.37 27.98 23.595 70-74 19.895 29.365000000000002 27.389999999999997 23.35 75-79 19.905 28.9 27.36 23.835 80-84 20.11 28.7 27.389999999999997 23.799999999999997 85-89 20.22 29.26 27.435 23.085 90-94 20.875 28.255000000000003 27.275 23.595 95-99 19.975 28.95 27.515 23.56 100-104 20.135 28.52 27.55 23.794999999999998 105-109 20.69 28.110000000000003 27.76 23.44 110-114 21.01 29.465000000000003 26.445 23.080000000000002 115-119 20.765 29.415000000000003 26.790000000000003 23.03 120-124 20.765 29.494999999999997 26.235000000000003 23.505000000000003 125-129 20.315 28.88 26.540000000000003 24.265 130-134 20.505000000000003 28.544999999999998 26.775 24.175 135-139 20.925 29.225 26.119999999999997 23.73 140-144 21.765 28.7 25.629999999999995 23.905 145-149 22.400000000000002 29.054999999999996 25.005 23.54 150 13.5 34.575 24.474999999999998 27.450000000000003 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 1.0 23 0.5 24 1.5 25 2.5 26 4.0 27 7.0 28 11.5 29 13.0 30 18.5 31 29.5 32 35.5 33 45.5 34 65.5 35 73.5 36 80.5 37 104.0 38 132.5 39 173.5 40 199.5 41 219.5 42 236.5 43 244.5 44 255.0 45 260.0 46 255.0 47 246.5 48 239.5 49 217.5 50 189.0 51 155.0 52 122.0 53 89.5 54 72.0 55 56.0 56 36.5 57 29.0 58 22.5 59 18.5 60 12.5 61 6.0 62 2.0 63 2.5 64 2.5 65 2.5 66 2.5 67 2.0 68 1.0 69 0.0 70 0.5 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.35000000000000003 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54785229841748 99.075 2 0.42702838482793265 0.8500000000000001 3 0.025119316754584273 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0125 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.125 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.16249999999999998 0.0 0.0 0.0 0.0 72-73 0.2 0.0 0.0 0.0 0.0 74-75 0.225 0.0 0.0 0.0 0.0 76-77 0.25 0.0 0.0 0.0 0.0 78-79 0.375 0.0 0.0 0.0 0.0 80-81 0.44999999999999996 0.0 0.0 0.0 0.0 82-83 0.4875 0.0 0.0 0.0 0.0 84-85 0.5 0.0 0.0 0.0 0.0 86-87 0.5 0.0 0.0 0.0 0.0 88-89 0.5 0.0 0.0 0.0 0.0 90-91 0.5125 0.0 0.0 0.0 0.0 92-93 0.5375000000000001 0.0 0.0 0.0 0.0 94-95 0.6 0.0 0.0 0.0 0.0 96-97 0.8125 0.0 0.0 0.0 0.0 98-99 0.8875 0.0 0.0 0.0 0.0 100-101 0.975 0.0 0.0 0.0 0.0 102-103 1.2125 0.0 0.0 0.0 0.0 104-105 1.4625 0.0 0.0 0.0 0.0 106-107 2.25 0.0 0.0 0.0 0.0 108-109 3.0 0.0 0.0 0.0 0.0 110-111 3.8625 0.0 0.0 0.0 0.0 112-113 4.7125 0.0 0.0 0.0 0.0 114-115 5.0125 0.0 0.0 0.0 0.0 116-117 5.7625 0.0 0.0 0.0 0.0 118-119 5.9375 0.0 0.0 0.0 0.0 120-121 6.050000000000001 0.0 0.0 0.0 0.0 122-123 6.15 0.0 0.0 0.0 0.0 124-125 6.3125 0.0 0.0 0.0 0.0 126-127 6.7625 0.0 0.0 0.0 0.0 128-129 7.1375 0.0 0.0 0.0 0.0 130-131 7.4875 0.0 0.0 0.0 0.0 132-133 7.725 0.0 0.0 0.0 0.0 134-135 9.1 0.0 0.0 0.0 0.0 136-137 10.5125 0.0 0.0 0.0 0.0 138 11.65 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR1799534 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR1799534_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.49975 34.0 31.0 34.0 31.0 34.0 2 32.703 34.0 33.0 34.0 31.0 34.0 3 32.7045 34.0 33.0 34.0 31.0 34.0 4 36.0045 37.0 37.0 37.0 35.0 37.0 5 35.932 37.0 37.0 37.0 35.0 37.0 6 35.91875 37.0 37.0 37.0 35.0 37.0 7 35.91925 37.0 37.0 37.0 35.0 37.0 8 35.93775 37.0 37.0 37.0 35.0 37.0 9 37.837 39.0 39.0 39.0 37.0 39.0 10-14 38.147299999999994 39.4 39.2 39.4 37.2 39.4 15-19 39.3109 41.0 40.0 41.0 37.6 41.0 20-24 39.255750000000006 41.0 40.0 41.0 37.2 41.0 25-29 39.162549999999996 41.0 40.0 41.0 37.0 41.0 30-34 38.9919 41.0 40.0 41.0 36.8 41.0 35-39 38.600100000000005 40.6 39.2 41.0 35.2 41.0 40-44 38.6926 40.4 39.0 41.0 35.4 41.0 45-49 38.63865 40.8 39.0 41.0 35.2 41.0 50-54 37.5684 39.4 37.6 40.4 33.6 40.6 55-59 38.0336 40.0 38.0 41.0 34.2 41.0 60-64 37.49185 39.6 36.6 41.0 33.6 41.0 65-69 36.5488 38.2 35.4 40.4 32.4 41.0 70-74 35.9627 37.0 35.0 39.0 32.8 40.8 75-79 35.00675 35.8 35.0 37.6 32.6 39.2 80-84 34.102999999999994 35.0 35.0 36.2 32.0 37.4 85-89 33.4791 35.0 34.0 35.4 31.0 36.4 90-94 33.1113 35.0 34.0 35.0 30.4 36.0 95-99 32.72395 35.0 34.0 35.0 29.2 35.0 100-104 32.545449999999995 35.0 34.0 35.0 28.6 35.0 105-109 32.547349999999994 35.0 34.0 35.0 29.0 35.0 110-114 32.3378 35.0 33.8 35.0 28.6 35.0 115-119 31.9287 35.0 33.0 35.0 26.2 35.0 120-124 31.80025 35.0 33.0 35.0 26.6 35.0 125-129 31.436100000000003 34.6 32.2 35.0 24.8 35.0 130-134 31.0599 34.0 31.8 35.0 23.4 35.0 135-139 30.164050000000003 34.0 30.6 35.0 18.2 35.0 140-144 30.1101 34.0 30.8 35.0 18.4 35.0 145-149 29.276400000000002 34.0 30.4 35.0 5.6 35.0 150 25.4275 30.0 23.0 34.0 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 60.0 3 2.0 4 2.0 5 3.0 6 6.0 7 1.0 8 1.0 9 4.0 10 4.0 11 0.0 12 7.0 13 1.0 14 3.0 15 6.0 16 6.0 17 5.0 18 3.0 19 7.0 20 8.0 21 10.0 22 4.0 23 13.0 24 15.0 25 19.0 26 20.0 27 22.0 28 39.0 29 44.0 30 59.0 31 77.0 32 90.0 33 143.0 34 230.0 35 480.0 36 1231.0 37 1347.0 38 28.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.074999999999996 18.75 12.25 29.925 2 25.95 27.224999999999998 31.55 15.275 3 20.775 27.750000000000004 30.85 20.625 4 25.174999999999997 32.475 22.900000000000002 19.45 5 23.849999999999998 37.175000000000004 21.5 17.474999999999998 6 19.45 38.5 24.25 17.8 7 21.099999999999998 21.55 38.45 18.9 8 21.65 25.674999999999997 28.799999999999997 23.875 9 22.525000000000002 23.95 32.0 21.525 10-14 23.805 28.64 26.555 21.0 15-19 22.925 27.765 28.51 20.8 20-24 23.215 28.16 28.04 20.585 25-29 23.365 27.96 28.09 20.585 30-34 22.994999999999997 27.839999999999996 28.725 20.44 35-39 23.580000000000002 28.21 27.92 20.29 40-44 23.419999999999998 27.83 28.205000000000002 20.544999999999998 45-49 23.16 27.425 28.93 20.485 50-54 23.075000000000003 27.87 28.375 20.68 55-59 23.415 27.61 28.49 20.485 60-64 23.169999999999998 27.575 28.794999999999998 20.46 65-69 23.65 27.54 28.59 20.22 70-74 23.849999999999998 27.775 27.875 20.5 75-79 23.369999999999997 27.860000000000003 28.625 20.145 80-84 23.57 27.185 28.804999999999996 20.44 85-89 23.735 27.625 28.595 20.044999999999998 90-94 23.855 27.139999999999997 28.765 20.24 95-99 23.549999999999997 27.62 28.549999999999997 20.28 100-104 24.505 27.6 28.134999999999998 19.759999999999998 105-109 24.01 27.415 28.410000000000004 20.165 110-114 24.485 27.634999999999998 28.065 19.814999999999998 115-119 24.89 27.705000000000002 27.42 19.985 120-124 25.074999999999996 27.644999999999996 27.52 19.759999999999998 125-129 24.91 27.13 28.235 19.725 130-134 25.580000000000002 27.589999999999996 28.110000000000003 18.72 135-139 25.180000000000003 28.98 26.724999999999998 19.115 140-144 25.705 29.17 26.400000000000002 18.725 145-149 26.515 27.855 26.195 19.435 150 29.075 27.150000000000002 24.75 19.025 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 1.0 17 1.0 18 0.5 19 1.5 20 1.0 21 0.5 22 1.5 23 2.0 24 3.5 25 3.5 26 3.5 27 9.5 28 9.5 29 9.0 30 16.0 31 26.5 32 39.5 33 43.5 34 43.5 35 62.5 36 89.5 37 114.5 38 141.5 39 172.0 40 186.5 41 212.5 42 233.0 43 242.0 44 267.0 45 279.5 46 280.5 47 268.0 48 256.5 49 221.5 50 175.5 51 140.5 52 101.5 53 72.5 54 58.5 55 44.0 56 36.0 57 31.5 58 20.0 59 16.5 60 13.0 61 8.5 62 9.5 63 7.5 64 4.5 65 4.5 66 3.0 67 1.5 68 1.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67377666248431 99.3 2 0.27603513174404015 0.5499999999999999 3 0.05018820577164366 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0125 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.125 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.16249999999999998 0.0 0.0 0.0 0.0 72-73 0.2 0.0 0.0 0.0 0.0 74-75 0.225 0.0 0.0 0.0 0.0 76-77 0.25 0.0 0.0 0.0 0.0 78-79 0.375 0.0 0.0 0.0 0.0 80-81 0.44999999999999996 0.0 0.0 0.0 0.0 82-83 0.4875 0.0 0.0 0.0 0.0 84-85 0.5 0.0 0.0 0.0 0.0 86-87 0.5 0.0 0.0 0.0 0.0 88-89 0.5 0.0 0.0 0.0 0.0 90-91 0.5125 0.0 0.0 0.0 0.0 92-93 0.5375000000000001 0.0 0.0 0.0 0.0 94-95 0.6 0.0 0.0 0.0 0.0 96-97 0.8125 0.0 0.0 0.0 0.0 98-99 0.8875 0.0 0.0 0.0 0.0 100-101 0.975 0.0 0.0 0.0 0.0 102-103 1.2375 0.0 0.0 0.0 0.0 104-105 1.4875 0.0 0.0 0.0 0.0 106-107 2.2625 0.0 0.0 0.0 0.0 108-109 3.0 0.0 0.0 0.0 0.0 110-111 3.8625 0.0 0.0 0.0 0.0 112-113 4.6875 0.0 0.0 0.0 0.0 114-115 4.9875 0.0 0.0 0.0 0.0 116-117 5.7375 0.0 0.0 0.0 0.0 118-119 5.9125 0.0 0.0 0.0 0.0 120-121 6.0375 0.0 0.0 0.0 0.0 122-123 6.1625 0.0 0.0 0.0 0.0 124-125 6.3375 0.0 0.0 0.0 0.0 126-127 6.7625 0.0 0.0 0.0 0.0 128-129 7.1375 0.0 0.0 0.0 0.0 130-131 7.4625 0.0 0.0 0.0 0.0 132-133 7.7 0.0 0.0 0.0 0.0 134-135 9.087499999999999 0.0 0.0 0.0 0.0 136-137 10.5375 0.0 0.0 0.0 0.0 138 11.7 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1064760 spots for SRR1799534.sra Written 1064760 spots for SRR1799534.sra Read 1064760 spots for SRR1799534.sra Written 1064760 spots for SRR1799534.sra Read 1064760 spots for SRR1799534.sra Written 1064760 spots for SRR1799534.sra Read 1064760 spots for SRR1799534.sra Written 1064760 spots for SRR1799534.sra Read 1064760 spots for SRR1799534.sra Written 1064760 spots for SRR1799534.sra Read 1064760 spots for SRR1799534.sra Written 1064760 spots for SRR1799534.sra Read 1064773 spots for SRR1799534.sra Written 1064773 spots for SRR1799534.sra Read 1064760 spots for SRR1799534.sra Written 1064760 spots for SRR1799534.sra Read 1064760 spots for SRR1799534.sra Written 1064760 spots for SRR1799534.sra Read 1064760 spots for SRR1799534.sra Written 1064760 spots for SRR1799534.sra Read 1064760 spots for SRR1799534.sra Written 1064760 spots for SRR1799534.sra Read 1064760 spots for SRR1799534.sra Written 1064760 spots for SRR1799534.sra Read 1064760 spots for SRR1799534.sra Written 1064760 spots for SRR1799534.sra Read 1064760 spots for SRR1799534.sra Written 1064760 spots for SRR1799534.sra Read 1064760 spots for SRR1799534.sra Written 1064760 spots for SRR1799534.sra Read 1064760 spots for SRR1799534.sra Written 1064760 spots for SRR1799534.sra Read 1064760 spots for SRR1799534.sra Written 1064760 spots for SRR1799534.sra Read 1064760 spots for SRR1799534.sra Written 1064760 spots for SRR1799534.sra Read 1064760 spots for SRR1799534.sra Written 1064760 spots for SRR1799534.sra Read 1064760 spots for SRR1799534.sra Written 1064760 spots for SRR1799534.sra SRR ids: ['SRR1799534.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_lqjisptc SRR1799534.sra spots: 21295213 blocks: [[1, 1064760], [1064761, 2129520], [2129521, 3194280], [3194281, 4259040], [4259041, 5323800], [5323801, 6388560], [6388561, 7453320], [7453321, 8518080], [8518081, 9582840], [9582841, 10647600], [10647601, 11712360], [11712361, 12777120], [12777121, 13841880], [13841881, 14906640], [14906641, 15971400], [15971401, 17036160], [17036161, 18100920], [18100921, 19165680], [19165681, 20230440], [20230441, 21295213]] SRR1799534 file size 7152956 SRR1799534 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR1799534 SRR1799534_1.fastq SRR1799534_2.fastq Input file: SRR1799534_1.fastq Paired file: SRR1799534_2.fastq trimmed: SRR1799534-trimmed-pair1.fastq, SRR1799534-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 21:24:53 2025 >> started Thu Feb 13 21:25:17 2025 >> done (24.579s) 21295213 read pairs processed; of these: 64164 ( 0.30%) short read pairs filtered out after trimming by size control 200009 ( 0.94%) empty read pairs filtered out after trimming by size control 21031040 (98.76%) read pairs available; of these: 9410405 (44.75%) trimmed read pairs available after processing 11620635 (55.25%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 4 0.00% 20 3 0.00% 21 11 0.00% 22 13 0.00% 23 16 0.00% 24 28 0.00% 25 27 0.00% 26 34 0.00% 27 44 0.00% 28 56 0.00% 29 76 0.00% 30 98 0.00% 31 123 0.00% 32 114 0.00% 33 172 0.00% 34 173 0.00% 35 187 0.00% 36 220 0.00% 37 272 0.00% 38 301 0.00% 39 370 0.00% 40 357 0.00% 41 412 0.00% 42 456 0.00% 43 482 0.00% 44 517 0.00% 45 613 0.00% 46 700 0.00% 47 746 0.00% 48 779 0.00% 49 843 0.00% 50 915 0.00% 51 1005 0.00% 52 1140 0.01% 53 1199 0.01% 54 1327 0.01% 55 1468 0.01% 56 1516 0.01% 57 1661 0.01% 58 1805 0.01% 59 1924 0.01% 60 2109 0.01% 61 2388 0.01% 62 2584 0.01% 63 2828 0.01% 64 3117 0.01% 65 3419 0.02% 66 3742 0.02% 67 4180 0.02% 68 4514 0.02% 69 5067 0.02% 70 5544 0.03% 71 6310 0.03% 72 6909 0.03% 73 7826 0.04% 74 8725 0.04% 75 9651 0.05% 76 10034 0.05% 77 10262 0.05% 78 9813 0.05% 79 8829 0.04% 80 7552 0.04% 81 6311 0.03% 82 5820 0.03% 83 6286 0.03% 84 9867 0.05% 85 10267 0.05% 86 11314 0.05% 87 12314 0.06% 88 12622 0.06% 89 12839 0.06% 90 14044 0.07% 91 17393 0.08% 92 19268 0.09% 93 17717 0.08% 94 16337 0.08% 95 36735 0.17% 96 19093 0.09% 97 16619 0.08% 98 20856 0.10% 99 22403 0.11% 100 16866 0.08% 101 19956 0.09% 102 65654 0.31% 103 26182 0.12% 104 22569 0.11% 105 127676 0.61% 106 86062 0.41% 107 37791 0.18% 108 97362 0.46% 109 129984 0.62% 110 47562 0.23% 111 59319 0.28% 112 98996 0.47% 113 34834 0.17% 114 32824 0.16% 115 171008 0.81% 116 69210 0.33% 117 29702 0.14% 118 24654 0.12% 119 31048 0.15% 120 31521 0.15% 121 24936 0.12% 122 29333 0.14% 123 38285 0.18% 124 55596 0.26% 125 75378 0.36% 126 109133 0.52% 127 63827 0.30% 128 30653 0.15% 129 47225 0.22% 130 93623 0.45% 131 42219 0.20% 132 63521 0.30% 133 209599 1.00% 134 204375 0.97% 135 166822 0.79% 136 210552 1.00% 137 225367 1.07% 138 221638 1.05% 139 233093 1.11% 140 232870 1.11% 141 245312 1.17% 142 254167 1.21% 143 268495 1.28% 144 289342 1.38% 145 322295 1.53% 146 375012 1.78% 147 479490 2.28% 148 705404 3.35% 149 2396348 11.39% 150 11620635 55.25% 21031040 reads passed initial QC criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=2.80 fanout-score-rank=33 prefix-density=0.23 prefix-fanout=2.5 sequence=GATAAATCACTC criterion=fanout-score sequence-density=0.14 sequence-density-rank=7 fanout-score=49.54 fanout-score-rank=1 prefix-density=0.71 prefix-fanout=9.7 sequence=CCACCACCATGGGCTCCCCAGCCACCATAGGTGTCAATAATGATCTTGCGTCCAGTGAGACCTGCATCACCATGAGGACCACCAATAAC criterion=sequence-density sequence-density=0.27 sequence-density-rank=1 fanout-score=11.48 fanout-score-rank=4 prefix-density=0.42 prefix-fanout=7.2 sequence=AGGTTCTTGAAGACAGCTGCATACGGACA criterion=fanout-score sequence-density=0.12 sequence-density-rank=21 fanout-score=27.81 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=13.1 sequence=TTTTCTTCATTG SRR1799534 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 21:26:02 Started mapping on | Feb 13 21:26:02 Finished on | Feb 13 21:28:44 Mapping speed, Million of reads per hour | 467.36 Number of input reads | 21031040 Average input read length | 287 UNIQUE READS: Uniquely mapped reads number | 19846603 Uniquely mapped reads % | 94.37% Average mapped length | 285.11 Number of splices: Total | 16288561 Number of splices: Annotated (sjdb) | 15917479 Number of splices: GT/AG | 16000042 Number of splices: GC/AG | 185963 Number of splices: AT/AC | 13403 Number of splices: Non-canonical | 89153 Mismatch rate per base, % | 1.13% Deletion rate per base | 0.10% Deletion average length | 2.94 Insertion rate per base | 0.07% Insertion average length | 2.62 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 702300 % of reads mapped to multiple loci | 3.34% Number of reads mapped to too many loci | 27098 % of reads mapped to too many loci | 0.13% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.10% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 508780 508780 508780 N_multimapping 702300 702300 702300 N_noFeature 532338 19570738 648396 N_ambiguous 256136 958 95926 UnstrandedReadsAssigned:19058129 PositiveStrandReadsAssigned:274907 NegativeStrandReadsAssigned:19102281 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=143 echo kmer=139 SRR1799534 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR1799534-trimmed-pair1.fastq SRR1799534-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,031,040 reads, 18,493,806 reads pseudoaligned [quant] estimated average fragment length: 190.375 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,182 rounds 52401 SRR1799534.ke.tsv 34699 SRR1799534.se.tsv 87100 total ==> SRR1799534.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1828.63 594 19.8403 Potri.005G024800.1.v4.1 1035 845.625 240 17.3349 Potri.004G059700.1.v4.1 961 771.63 23 1.82057 Potri.007G009000.2.v4.1 1416 1226.63 0 0 Potri.003G141000.2.v4.1 2943 2753.63 323.132 7.16741 Potri.016G087400.1.v4.1 270 99.0215 2063 1272.5 Potri.015G069301.1.v4.1 564 375.233 0 0 Potri.010G195200.1.v4.1 1773 1583.63 23 0.88708 Potri.012G127500.1.v4.1 977 787.625 2665 206.664 ==> SRR1799534.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2065 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 495 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR1799534 completed mapping pipeline successfully