Starting /dee2/code/volunteer_pipeline.sh SRR1799535 current disk space = 3088239321088 free memory = 1496432308 SRR1799535 SRAfilesize 97a90ac94c8177ffef2b7cd9f9a523f4 SRR1799535.sra SRR1799535.sra file validated SRR1799535 is paired end SRR1799535 is conventional basespace SRR1799535 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR1799535_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.63475 34.0 34.0 34.0 31.0 34.0 2 33.0445 34.0 34.0 34.0 31.0 34.0 3 33.39425 34.0 34.0 34.0 31.0 34.0 4 36.5755 37.0 37.0 37.0 35.0 37.0 5 36.605 37.0 37.0 37.0 35.0 37.0 6 36.69925 37.0 37.0 37.0 35.0 37.0 7 36.6325 37.0 37.0 37.0 35.0 37.0 8 36.63525 37.0 37.0 37.0 35.0 37.0 9 38.5345 39.0 39.0 39.0 37.0 39.0 10-14 38.88875 39.4 39.2 39.4 37.8 39.4 15-19 40.18555 41.0 40.0 41.0 38.0 41.0 20-24 40.193200000000004 41.0 40.0 41.0 38.4 41.0 25-29 40.06585 41.0 40.0 41.0 38.0 41.0 30-34 40.0093 41.0 40.0 41.0 38.0 41.0 35-39 39.7932 41.0 40.0 41.0 38.0 41.0 40-44 39.6429 41.0 40.0 41.0 37.2 41.0 45-49 39.43755 41.0 40.0 41.0 36.6 41.0 50-54 39.193149999999996 40.8 39.0 41.0 35.6 41.0 55-59 38.8734 40.0 38.4 41.0 35.0 41.0 60-64 38.58275 40.0 37.4 41.0 35.0 41.0 65-69 37.99545 39.2 36.4 41.0 35.0 41.0 70-74 36.90745 37.4 35.2 39.6 34.0 41.0 75-79 35.5851 36.2 34.8 37.8 33.2 39.4 80-84 35.005849999999995 35.2 35.0 36.6 33.8 37.8 85-89 34.44414999999999 35.0 35.0 35.8 33.2 36.6 90-94 33.927 35.0 35.0 35.0 32.8 36.0 95-99 33.7393 35.0 35.0 35.0 32.2 35.6 100-104 33.743849999999995 35.0 35.0 35.0 32.6 35.0 105-109 33.608850000000004 35.0 35.0 35.0 31.8 35.0 110-114 33.454249999999995 35.0 34.6 35.0 31.6 35.0 115-119 33.2419 35.0 34.0 35.0 31.2 35.0 120-124 33.182900000000004 35.0 34.0 35.0 31.0 35.0 125-129 33.041399999999996 35.0 34.0 35.0 30.4 35.0 130-134 32.69375 35.0 34.0 35.0 29.6 35.0 135-139 32.44199999999999 35.0 34.0 35.0 29.2 35.0 140-144 32.1293 35.0 33.4 35.0 27.8 35.0 145-149 31.4312 35.0 33.0 35.0 24.6 35.0 150 26.01325 33.0 19.0 35.0 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 2.0 10 4.0 11 3.0 12 1.0 13 3.0 14 4.0 15 4.0 16 11.0 17 9.0 18 4.0 19 14.0 20 6.0 21 9.0 22 8.0 23 5.0 24 15.0 25 7.0 26 13.0 27 17.0 28 27.0 29 32.0 30 34.0 31 50.0 32 71.0 33 72.0 34 108.0 35 292.0 36 1016.0 37 2099.0 38 59.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.56966897613549 11.419040287400565 7.698229407236336 40.313061329227615 2 22.364137240170297 13.248184322564487 33.30828950663661 31.0793889306286 3 19.275000000000002 17.025000000000002 25.124999999999996 38.574999999999996 4 23.107769423558896 23.583959899749374 22.080200501253135 31.2280701754386 5 23.825 29.099999999999998 23.974999999999998 23.1 6 20.3 32.875 24.725 22.1 7 15.2 28.675 38.025 18.099999999999998 8 15.825 29.5 32.15 22.525000000000002 9 18.175 25.25 34.050000000000004 22.525000000000002 10-14 18.855 31.275 27.51 22.36 15-19 19.009999999999998 29.28 27.63 24.08 20-24 19.125 29.335 27.63 23.91 25-29 19.16 29.765000000000004 27.515 23.56 30-34 19.765 30.049999999999997 27.08 23.105 35-39 19.134999999999998 29.595 27.495000000000005 23.775 40-44 19.919999999999998 29.470000000000002 27.700000000000003 22.91 45-49 19.8 29.685 27.455000000000002 23.06 50-54 20.11 29.225 27.395000000000003 23.27 55-59 19.54 29.409999999999997 27.534999999999997 23.515 60-64 19.67 29.555 27.11 23.665 65-69 19.220000000000002 29.175 27.435 24.169999999999998 70-74 19.34 29.505 27.98 23.175 75-79 19.7 29.439999999999998 27.01 23.849999999999998 80-84 20.235 28.985 27.29 23.49 85-89 19.86 29.87 26.419999999999998 23.849999999999998 90-94 19.895 28.9 27.525 23.68 95-99 20.0 28.749999999999996 27.63 23.62 100-104 20.155 28.79 27.245 23.810000000000002 105-109 19.98 29.459999999999997 26.950000000000003 23.61 110-114 19.945 29.044999999999998 26.855 24.154999999999998 115-119 21.205 29.854999999999997 25.66 23.28 120-124 20.765 28.845 25.869999999999997 24.52 125-129 20.495 28.46 26.400000000000002 24.645 130-134 20.945 28.694999999999997 26.029999999999998 24.33 135-139 20.615 28.96 25.705 24.72 140-144 21.625 28.785 24.81 24.779999999999998 145-149 21.790000000000003 30.15 23.669999999999998 24.39 150 15.996986438975389 30.035158211953792 25.665494726268207 28.302360622802613 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 1.0 22 0.0 23 1.0 24 3.0 25 3.5 26 7.0 27 13.5 28 13.0 29 14.0 30 21.0 31 33.5 32 45.5 33 58.0 34 63.5 35 77.0 36 106.5 37 135.5 38 159.0 39 181.5 40 206.5 41 215.5 42 230.0 43 244.0 44 230.0 45 237.0 46 264.5 47 254.0 48 215.0 49 177.0 50 147.5 51 131.0 52 115.5 53 92.5 54 77.5 55 60.5 56 42.5 57 29.5 58 20.5 59 15.5 60 12.0 61 8.5 62 7.5 63 7.0 64 4.5 65 4.0 66 2.0 67 3.0 68 2.5 69 0.0 70 0.5 71 1.5 72 1.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.5749999999999997 2 0.17500000000000002 3 0.0 4 0.25 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.44999999999999996 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64832956543582 99.175 2 0.30143180105501133 0.6 3 0.025119316754584273 0.075 4 0.0 0.0 5 0.0 0.0 6 0.025119316754584273 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCACCGGATCTCGTATGC 6 0.15 TruSeq Adapter, Index 7 (97% over 35bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.0625 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.175 0.0 0.0 0.0 0.0 72-73 0.225 0.0 0.0 0.0 0.0 74-75 0.2625 0.0 0.0 0.0 0.0 76-77 0.4125 0.0 0.0 0.0 0.0 78-79 0.5125 0.0 0.0 0.0 0.0 80-81 0.6499999999999999 0.0 0.0 0.0 0.0 82-83 0.8125 0.0 0.0 0.0 0.0 84-85 1.0499999999999998 0.0 0.0 0.0 0.0 86-87 1.0875 0.0 0.0 0.0 0.0 88-89 1.1625 0.0 0.0 0.0 0.0 90-91 1.2875 0.0 0.0 0.0 0.0 92-93 1.5125000000000002 0.0 0.0 0.0 0.0 94-95 1.6375000000000002 0.0 0.0 0.0 0.0 96-97 1.9 0.0 0.0 0.0 0.0 98-99 1.9875 0.0 0.0 0.0 0.0 100-101 2.125 0.0 0.0 0.0 0.0 102-103 2.8 0.0 0.0 0.0 0.0 104-105 3.075 0.0 0.0 0.0 0.0 106-107 3.7375000000000003 0.0 0.0 0.0 0.0 108-109 4.825 0.0 0.0 0.0 0.0 110-111 5.8125 0.0 0.0 0.0 0.0 112-113 6.45 0.0 0.0 0.0 0.0 114-115 7.55 0.0 0.0 0.0 0.0 116-117 8.8875 0.0 0.0 0.0 0.0 118-119 9.287500000000001 0.0 0.0 0.0 0.0 120-121 9.375 0.0 0.0 0.0 0.0 122-123 9.5625 0.0 0.0 0.0 0.0 124-125 10.1375 0.0 0.0 0.0 0.0 126-127 11.5625 0.0 0.0 0.0 0.0 128-129 11.9 0.0 0.0 0.0 0.0 130-131 12.375 0.0 0.0 0.0 0.0 132-133 13.475 0.0 0.0 0.0 0.0 134-135 15.1125 0.0 0.0 0.0 0.0 136-137 16.2375 0.0 0.0 0.0 0.0 138 17.5 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTTAGTT 10 0.0064622764 147.66667 1 GAGCACA 80 0.0021234357 12.597813 140-144 AGAGCAC 85 0.0033465791 11.856764 140-144 GGAAGAG 90 0.005130083 11.198056 135-139 TCGGAAG 95 0.0076720677 10.608685 135-139 CGGAAGA 95 0.0076720677 10.608685 135-139 AGATCGG 95 0.0076720677 10.608685 130-134 >>END_MODULE SRR1799535 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR1799535_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.69325 34.0 33.0 34.0 31.0 34.0 2 32.799 34.0 33.0 34.0 31.0 34.0 3 32.9145 34.0 34.0 34.0 31.0 34.0 4 36.091 37.0 37.0 37.0 35.0 37.0 5 36.182 37.0 37.0 37.0 35.0 37.0 6 36.219 37.0 37.0 37.0 35.0 37.0 7 36.16475 37.0 37.0 37.0 35.0 37.0 8 36.12325 37.0 37.0 37.0 35.0 37.0 9 38.08675 39.0 39.0 39.0 37.0 39.0 10-14 38.34155 39.4 39.2 39.4 37.2 39.4 15-19 39.583000000000006 41.0 40.0 41.0 38.0 41.0 20-24 39.610949999999995 41.0 40.0 41.0 38.0 41.0 25-29 39.51084999999999 41.0 40.0 41.0 38.0 41.0 30-34 39.3412 41.0 40.0 41.0 37.4 41.0 35-39 39.07565 41.0 40.0 41.0 36.6 41.0 40-44 38.864999999999995 41.0 39.6 41.0 35.8 41.0 45-49 38.48175 40.6 38.8 41.0 34.8 41.0 50-54 37.78975 39.6 37.8 40.6 33.8 40.8 55-59 37.86 40.0 37.6 41.0 33.8 41.0 60-64 37.81385 39.8 37.0 41.0 34.0 41.0 65-69 37.14625 39.0 35.8 41.0 33.8 41.0 70-74 36.2023 37.0 35.0 39.4 33.6 41.0 75-79 35.090199999999996 35.8 35.0 37.8 33.0 39.2 80-84 34.116200000000006 35.0 35.0 36.4 32.2 37.8 85-89 33.52094999999999 35.0 35.0 35.6 31.0 36.4 90-94 33.2835 35.0 34.4 35.0 31.2 36.0 95-99 33.0806 35.0 34.0 35.0 31.0 35.4 100-104 32.8711 35.0 34.0 35.0 30.2 35.0 105-109 32.74980000000001 35.0 34.0 35.0 30.0 35.0 110-114 32.46255 35.0 34.0 35.0 29.2 35.0 115-119 32.3219 35.0 34.0 35.0 29.0 35.0 120-124 32.1276 35.0 33.8 35.0 27.4 35.0 125-129 31.987099999999998 35.0 33.4 35.0 27.0 35.0 130-134 31.687850000000005 35.0 33.0 35.0 25.6 35.0 135-139 31.207150000000002 35.0 32.8 35.0 23.6 35.0 140-144 30.757849999999998 34.8 32.0 35.0 20.8 35.0 145-149 30.316000000000003 34.6 32.0 35.0 11.6 35.0 150 28.22225 33.0 29.0 35.0 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 37.0 3 2.0 4 2.0 5 3.0 6 4.0 7 8.0 8 5.0 9 2.0 10 3.0 11 7.0 12 4.0 13 4.0 14 6.0 15 12.0 16 12.0 17 6.0 18 10.0 19 9.0 20 15.0 21 12.0 22 9.0 23 8.0 24 12.0 25 19.0 26 20.0 27 17.0 28 23.0 29 27.0 30 24.0 31 55.0 32 69.0 33 105.0 34 176.0 35 347.0 36 1150.0 37 1732.0 38 44.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.55345911949686 22.062893081761008 13.484276729559749 27.899371069182386 2 28.0811623246493 25.626252505010022 30.435871743486974 15.856713426853709 3 19.814629258517034 27.90581162324649 32.765531062124246 19.514028056112224 4 23.39679358717435 34.243486973947896 24.273547094188377 18.086172344689377 5 25.651302605210418 34.644288577154306 23.171342685370742 16.53306613226453 6 20.200000000000003 38.224999999999994 23.825 17.75 7 20.150000000000002 22.175 39.35 18.325 8 21.3 25.924999999999997 30.375000000000004 22.400000000000002 9 22.825 23.75 31.7 21.725 10-14 24.77995599119824 28.505701140228044 26.940388077615523 19.773954790958193 15-19 23.89238923892389 27.972797279727974 27.682768276827684 20.452045204520452 20-24 23.487348734873486 27.94279427942794 28.15781578157816 20.412041204120413 25-29 23.630000000000003 27.544999999999998 28.12 20.705000000000002 30-34 23.400000000000002 27.67 28.505000000000003 20.424999999999997 35-39 23.990000000000002 28.105000000000004 27.839999999999996 20.064999999999998 40-44 23.96 27.229999999999997 28.57 20.24 45-49 23.72 26.935 28.860000000000003 20.485 50-54 24.055 27.775 28.505000000000003 19.665 55-59 23.695 28.050000000000004 28.27 19.985 60-64 22.865 28.754999999999995 28.449999999999996 19.93 65-69 23.305 28.255000000000003 28.555000000000003 19.885 70-74 23.845 27.015 28.82 20.32 75-79 23.810000000000002 27.22 29.110000000000003 19.86 80-84 23.73 27.685 28.360000000000003 20.225 85-89 23.78 28.139999999999997 28.515 19.564999999999998 90-94 24.185000000000002 27.805000000000003 28.32 19.689999999999998 95-99 24.104999999999997 26.995 29.09 19.81 100-104 24.529999999999998 27.605 28.749999999999996 19.115 105-109 24.565 27.93 27.889999999999997 19.615 110-114 25.264999999999997 27.99 28.08 18.665000000000003 115-119 25.2437865679852 27.82417362604391 27.53413011951793 19.39790968645297 120-124 25.88758875887589 27.217721772177217 27.542754275427544 19.351935193519353 125-129 26.0 27.705000000000002 27.51 18.785 130-134 26.595000000000002 28.09 27.11 18.205 135-139 26.68 28.535 26.450000000000003 18.335 140-144 26.840000000000003 29.17 25.955000000000002 18.035 145-149 27.950000000000003 27.700000000000003 25.929999999999996 18.42 150 28.636249054701285 28.73708091756995 24.62818250567179 17.99848752205697 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.5 9 0.5 10 0.5 11 0.5 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 1.0 20 1.5 21 0.5 22 0.0 23 0.0 24 0.5 25 1.0 26 2.5 27 4.5 28 7.0 29 11.0 30 20.5 31 25.5 32 31.0 33 48.5 34 62.0 35 79.5 36 98.5 37 121.0 38 152.0 39 166.5 40 202.5 41 232.5 42 241.0 43 256.0 44 248.0 45 259.5 46 269.0 47 254.5 48 246.0 49 204.5 50 157.5 51 125.0 52 98.5 53 84.5 54 68.0 55 56.0 56 42.0 57 27.0 58 22.0 59 18.0 60 12.5 61 10.5 62 7.5 63 4.0 64 2.0 65 3.0 66 3.5 67 2.0 68 0.5 69 0.5 70 1.0 71 1.0 72 1.0 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.625 2 0.2 3 0.2 4 0.2 5 0.2 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.02 15-19 0.01 20-24 0.01 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.015 120-124 0.01 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.8250000000000001 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64877069744105 99.3 2 0.35122930255895635 0.7000000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.0625 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.175 0.0 0.0 0.0 0.0 72-73 0.225 0.0 0.0 0.0 0.0 74-75 0.2625 0.0 0.0 0.0 0.0 76-77 0.4125 0.0 0.0 0.0 0.0 78-79 0.5125 0.0 0.0 0.0 0.0 80-81 0.675 0.0 0.0 0.0 0.0 82-83 0.8374999999999999 0.0 0.0 0.0 0.0 84-85 1.0750000000000002 0.0 0.0 0.0 0.0 86-87 1.1125 0.0 0.0 0.0 0.0 88-89 1.175 0.0 0.0 0.0 0.0 90-91 1.3125 0.0 0.0 0.0 0.0 92-93 1.5375 0.0 0.0 0.0 0.0 94-95 1.6625 0.0 0.0 0.0 0.0 96-97 1.925 0.0 0.0 0.0 0.0 98-99 2.0125 0.0 0.0 0.0 0.0 100-101 2.1500000000000004 0.0 0.0 0.0 0.0 102-103 2.7875 0.0 0.0 0.0 0.0 104-105 3.0625 0.0 0.0 0.0 0.0 106-107 3.7125 0.0 0.0 0.0 0.0 108-109 4.8 0.0 0.0 0.0 0.0 110-111 5.862500000000001 0.0 0.0 0.0 0.0 112-113 6.475 0.0 0.0 0.0 0.0 114-115 7.5375 0.0 0.0 0.0 0.0 116-117 8.9125 0.0 0.0 0.0 0.0 118-119 9.337499999999999 0.0 0.0 0.0 0.0 120-121 9.425 0.0 0.0 0.0 0.0 122-123 9.6125 0.0 0.0 0.0 0.0 124-125 10.162500000000001 0.0 0.0 0.0 0.0 126-127 11.5125 0.0 0.0 0.0 0.0 128-129 11.85 0.0 0.0 0.0 0.0 130-131 12.3125 0.0 0.0 0.0 0.0 132-133 13.4375 0.0 0.0 0.0 0.0 134-135 15.087499999999999 0.0 0.0 0.0 0.0 136-137 16.1875 0.0 0.0 0.0 0.0 138 17.45 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATAATTG 10 0.0069808904 143.95 3 AATTGAC 10 0.0069808904 143.95 5 CAGATCG 35 0.0036887764 20.564285 130-134 GAGCGTC 75 0.0013075337 13.435332 140-144 AGAGCGT 75 0.0013075337 13.435332 140-144 AGCGTCG 75 0.0013075337 13.435332 140-144 TCGGAAG 85 0.0033509342 11.854706 135-139 CGGAAGA 85 0.0033509342 11.854706 135-139 AGATCGG 95 0.0076819714 10.606842 130-134 AAAAAAA 155 0.0032608823 8.358387 70-74 >>END_MODULE Read 797354 spots for SRR1799535.sra Written 797354 spots for SRR1799535.sra Read 797354 spots for SRR1799535.sra Written 797354 spots for SRR1799535.sra Read 797354 spots for SRR1799535.sra Written 797354 spots for SRR1799535.sra Read 797354 spots for SRR1799535.sra Written 797354 spots for SRR1799535.sra Read 797354 spots for SRR1799535.sra Written 797354 spots for SRR1799535.sra Read 797354 spots for SRR1799535.sra Written 797354 spots for SRR1799535.sra Read 797354 spots for SRR1799535.sra Written 797354 spots for SRR1799535.sra Read 797354 spots for SRR1799535.sra Written 797354 spots for SRR1799535.sra Read 797354 spots for SRR1799535.sra Written 797354 spots for SRR1799535.sra Read 797354 spots for SRR1799535.sra Written 797354 spots for SRR1799535.sra Read 797354 spots for SRR1799535.sra Written 797354 spots for SRR1799535.sra Read 797354 spots for SRR1799535.sra Written 797354 spots for SRR1799535.sra Read 797354 spots for SRR1799535.sra Written 797354 spots for SRR1799535.sra Read 797354 spots for SRR1799535.sra Written 797354 spots for SRR1799535.sra Read 797354 spots for SRR1799535.sra Written 797354 spots for SRR1799535.sra Read 797354 spots for SRR1799535.sra Written 797354 spots for SRR1799535.sra Read 797358 spots for SRR1799535.sra Written 797358 spots for SRR1799535.sra Read 797354 spots for SRR1799535.sra Written 797354 spots for SRR1799535.sra Read 797354 spots for SRR1799535.sra Written 797354 spots for SRR1799535.sra Read 797354 spots for SRR1799535.sra Written 797354 spots for SRR1799535.sra SRR ids: ['SRR1799535.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_7p19ekyi SRR1799535.sra spots: 15947084 blocks: [[1, 797354], [797355, 1594708], [1594709, 2392062], [2392063, 3189416], [3189417, 3986770], [3986771, 4784124], [4784125, 5581478], [5581479, 6378832], [6378833, 7176186], [7176187, 7973540], [7973541, 8770894], [8770895, 9568248], [9568249, 10365602], [10365603, 11162956], [11162957, 11960310], [11960311, 12757664], [12757665, 13555018], [13555019, 14352372], [14352373, 15149726], [15149727, 15947084]] SRR1799535 file size 5351096 SRR1799535 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR1799535 SRR1799535_1.fastq SRR1799535_2.fastq Input file: SRR1799535_1.fastq Paired file: SRR1799535_2.fastq trimmed: SRR1799535-trimmed-pair1.fastq, SRR1799535-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 21:24:23 2025 >> started Thu Feb 13 21:24:40 2025 >> done (17.756s) 15947084 read pairs processed; of these: 38211 ( 0.24%) short read pairs filtered out after trimming by size control 100455 ( 0.63%) empty read pairs filtered out after trimming by size control 15808418 (99.13%) read pairs available; of these: 6611120 (41.82%) trimmed read pairs available after processing 9197298 (58.18%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 2 0.00% 20 3 0.00% 21 11 0.00% 22 15 0.00% 23 12 0.00% 24 18 0.00% 25 32 0.00% 26 30 0.00% 27 41 0.00% 28 52 0.00% 29 63 0.00% 30 87 0.00% 31 107 0.00% 32 129 0.00% 33 151 0.00% 34 140 0.00% 35 175 0.00% 36 206 0.00% 37 223 0.00% 38 252 0.00% 39 291 0.00% 40 299 0.00% 41 371 0.00% 42 360 0.00% 43 428 0.00% 44 399 0.00% 45 444 0.00% 46 523 0.00% 47 555 0.00% 48 564 0.00% 49 681 0.00% 50 701 0.00% 51 768 0.00% 52 837 0.01% 53 914 0.01% 54 1023 0.01% 55 1177 0.01% 56 1235 0.01% 57 1321 0.01% 58 1591 0.01% 59 1784 0.01% 60 2009 0.01% 61 2204 0.01% 62 2533 0.02% 63 2825 0.02% 64 3161 0.02% 65 3443 0.02% 66 3857 0.02% 67 4239 0.03% 68 4559 0.03% 69 5209 0.03% 70 5700 0.04% 71 6735 0.04% 72 7597 0.05% 73 8667 0.05% 74 9693 0.06% 75 10726 0.07% 76 11846 0.07% 77 12657 0.08% 78 13235 0.08% 79 14028 0.09% 80 13732 0.09% 81 13489 0.09% 82 11737 0.07% 83 9642 0.06% 84 10009 0.06% 85 8676 0.05% 86 9017 0.06% 87 10547 0.07% 88 11100 0.07% 89 13801 0.09% 90 23729 0.15% 91 22028 0.14% 92 11699 0.07% 93 12171 0.08% 94 14210 0.09% 95 29777 0.19% 96 14462 0.09% 97 12460 0.08% 98 13509 0.09% 99 13855 0.09% 100 13986 0.09% 101 60724 0.38% 102 45466 0.29% 103 12759 0.08% 104 14608 0.09% 105 73515 0.47% 106 37788 0.24% 107 72881 0.46% 108 92553 0.59% 109 69024 0.44% 110 19537 0.12% 111 45521 0.29% 112 41357 0.26% 113 77367 0.49% 114 104305 0.66% 115 152786 0.97% 116 54261 0.34% 117 15350 0.10% 118 13034 0.08% 119 19759 0.12% 120 12723 0.08% 121 14101 0.09% 122 31879 0.20% 123 23826 0.15% 124 107889 0.68% 125 131862 0.83% 126 63299 0.40% 127 18482 0.12% 128 17857 0.11% 129 46430 0.29% 130 33527 0.21% 131 64703 0.41% 132 122065 0.77% 133 128411 0.81% 134 116477 0.74% 135 91828 0.58% 136 173546 1.10% 137 166699 1.05% 138 162281 1.03% 139 170696 1.08% 140 172258 1.09% 141 179615 1.14% 142 188325 1.19% 143 189728 1.20% 144 197433 1.25% 145 207756 1.31% 146 223942 1.42% 147 264988 1.68% 148 360059 2.28% 149 1459265 9.23% 150 9197298 58.18% 15808418 reads passed initial QC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=5.27 fanout-score-rank=26 prefix-density=0.25 prefix-fanout=2.9 sequence=CTCCACACTTGTA criterion=fanout-score sequence-density=0.01 sequence-density-rank=37 fanout-score=161.80 fanout-score-rank=1 prefix-density=0.17 prefix-fanout=11.5 sequence=ATCAAACAAGCAGAAAAGCAGACATAAGCTAGCCTAAACTGTAACTAGGCAAACACTTCACTTTTTCTTCACTGCAGACTTGGTGACCTTGGCACCAGATGGATCCTTCTTCTCAACACTCTTAATGACACCAAC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=6.06 fanout-score-rank=13 prefix-density=0.22 prefix-fanout=3.8 sequence=ATCCAGAAGGAGTCCAC criterion=fanout-score sequence-density=0.08 sequence-density-rank=15 fanout-score=53.12 fanout-score-rank=1 prefix-density=0.29 prefix-fanout=14.5 sequence=GAGAAGGCAATGAGAGATGCTATTGATGGAATGAACGGTCAGGACCTCGATGGCCGTAACATCACCGTGAACGAAGCTCAATCCCGCGGAAGTGGAGGCGGC SRR1799535 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 21:25:31 Started mapping on | Feb 13 21:25:32 Finished on | Feb 13 21:28:52 Mapping speed, Million of reads per hour | 284.55 Number of input reads | 15808418 Average input read length | 285 UNIQUE READS: Uniquely mapped reads number | 14176897 Uniquely mapped reads % | 89.68% Average mapped length | 283.32 Number of splices: Total | 11099995 Number of splices: Annotated (sjdb) | 10787154 Number of splices: GT/AG | 10872690 Number of splices: GC/AG | 139097 Number of splices: AT/AC | 10678 Number of splices: Non-canonical | 77530 Mismatch rate per base, % | 1.16% Deletion rate per base | 0.12% Deletion average length | 3.03 Insertion rate per base | 0.08% Insertion average length | 2.66 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 568959 % of reads mapped to multiple loci | 3.60% Number of reads mapped to too many loci | 39953 % of reads mapped to too many loci | 0.25% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.37% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1080492 1080492 1080492 N_multimapping 568959 568959 568959 N_noFeature 519148 13973227 621808 N_ambiguous 187818 987 86350 UnstrandedReadsAssigned:13469931 PositiveStrandReadsAssigned:202683 NegativeStrandReadsAssigned:13468739 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=140 echo kmer=135 SRR1799535 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR1799535-trimmed-pair1.fastq SRR1799535-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,808,418 reads, 13,156,937 reads pseudoaligned [quant] estimated average fragment length: 184.907 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,148 rounds 52401 SRR1799535.ke.tsv 34699 SRR1799535.se.tsv 87100 total ==> SRR1799535.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1834.09 688 32.3642 Potri.005G024800.1.v4.1 1035 851.093 882 89.4108 Potri.004G059700.1.v4.1 961 777.098 29 3.21974 Potri.007G009000.2.v4.1 1416 1232.09 0 0 Potri.003G141000.2.v4.1 2943 2759.09 250.087 7.8203 Potri.016G087400.1.v4.1 270 103.274 960 802.004 Potri.015G069301.1.v4.1 564 380.722 0 0 Potri.010G195200.1.v4.1 1773 1589.09 36 1.95457 Potri.012G127500.1.v4.1 977 793.098 11290 1228.19 ==> SRR1799535.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 787 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 306 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 5 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 6 SRR1799535 completed mapping pipeline successfully