Starting /dee2/code/volunteer_pipeline.sh SRR1799536 current disk space = 3088213958656 free memory = 1513277336 SRR1799536 SRAfilesize d2d2824726d282f9d6f38557e74340b8 SRR1799536.sra SRR1799536.sra file validated SRR1799536 is paired end SRR1799536 is conventional basespace SRR1799536 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR1799536_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.36375 34.0 33.0 34.0 31.0 34.0 2 33.56425 34.0 34.0 34.0 33.0 34.0 3 33.688 34.0 34.0 34.0 33.0 34.0 4 36.832 37.0 37.0 37.0 37.0 37.0 5 36.82925 37.0 37.0 37.0 37.0 37.0 6 36.84125 37.0 37.0 37.0 37.0 37.0 7 36.8025 37.0 37.0 37.0 37.0 37.0 8 36.82875 37.0 37.0 37.0 37.0 37.0 9 38.8085 39.0 39.0 39.0 39.0 39.0 10-14 39.13590000000001 39.4 39.4 39.4 39.0 39.4 15-19 40.5346 41.0 41.0 41.0 40.0 41.0 20-24 40.50075 41.0 41.0 41.0 40.0 41.0 25-29 40.4285 41.0 40.8 41.0 39.4 41.0 30-34 40.34435 41.0 40.0 41.0 39.0 41.0 35-39 40.17700000000001 41.0 40.0 41.0 38.6 41.0 40-44 40.1774 41.0 40.0 41.0 38.8 41.0 45-49 40.306200000000004 41.0 40.6 41.0 39.0 41.0 50-54 40.10680000000001 41.0 40.0 41.0 38.4 41.0 55-59 39.85955 41.0 39.8 41.0 37.2 41.0 60-64 39.37330000000001 40.8 38.8 41.0 35.8 41.0 65-69 38.587149999999994 39.4 36.8 41.0 35.0 41.0 70-74 37.501149999999996 37.8 35.6 39.8 35.0 41.0 75-79 36.0476 36.0 34.8 37.6 34.0 39.4 80-84 35.53175 35.4 35.0 36.6 35.0 37.8 85-89 34.96315 35.0 35.0 35.8 34.2 36.6 90-94 34.620349999999995 35.0 35.0 35.0 34.0 36.0 95-99 34.4764 35.0 35.0 35.0 34.0 35.4 100-104 34.3854 35.0 35.0 35.0 34.0 35.0 105-109 34.304500000000004 35.0 35.0 35.0 34.0 35.0 110-114 34.20095 35.0 35.0 35.0 33.6 35.0 115-119 34.1008 35.0 35.0 35.0 33.2 35.0 120-124 33.9942 35.0 34.6 35.0 32.8 35.0 125-129 33.78405 35.0 34.0 35.0 32.8 35.0 130-134 33.6759 35.0 34.0 35.0 32.2 35.0 135-139 33.52165000000001 35.0 34.0 35.0 32.0 35.0 140-144 33.27575 35.0 34.0 35.0 31.4 35.0 145-149 32.833349999999996 35.0 33.8 35.0 30.6 35.0 150 26.63025 32.0 23.0 35.0 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 2.0 8 1.0 9 1.0 10 0.0 11 0.0 12 2.0 13 0.0 14 3.0 15 0.0 16 3.0 17 1.0 18 1.0 19 4.0 20 5.0 21 3.0 22 2.0 23 6.0 24 6.0 25 3.0 26 7.0 27 4.0 28 9.0 29 15.0 30 16.0 31 16.0 32 28.0 33 43.0 34 76.0 35 185.0 36 1018.0 37 2507.0 38 33.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.77448518332496 11.426418884982422 7.584128578603718 42.2149673530889 2 22.05 13.075000000000001 35.925000000000004 28.95 3 18.4 16.775000000000002 26.424999999999997 38.4 4 23.075000000000003 22.925 22.525000000000002 31.474999999999998 5 23.175 31.0 24.075 21.75 6 21.2 33.0 23.25 22.55 7 13.675 28.7 39.0 18.625 8 16.650000000000002 26.525 32.725 24.099999999999998 9 17.424999999999997 24.775 34.775 23.025000000000002 10-14 19.115 30.470000000000002 28.01 22.405 15-19 19.495 28.575 27.905 24.025 20-24 19.895 29.29 27.35 23.465 25-29 19.509999999999998 29.145 27.375 23.97 30-34 19.314999999999998 29.439999999999998 27.224999999999998 24.02 35-39 19.825 28.785 27.575 23.815 40-44 19.695 29.015 27.755000000000003 23.535 45-49 19.950000000000003 29.12 27.200000000000003 23.73 50-54 20.325 29.205 27.255000000000003 23.215 55-59 19.925 29.470000000000002 27.200000000000003 23.405 60-64 20.125 29.020000000000003 27.62 23.235 65-69 19.865 29.07 27.045 24.02 70-74 20.84 28.63 27.339999999999996 23.189999999999998 75-79 20.126006300315016 29.186459322966147 26.95634781739087 23.731186559327966 80-84 19.965 28.555000000000003 27.075 24.404999999999998 85-89 20.305 28.105000000000004 27.52 24.07 90-94 19.774887443721862 28.60430215107554 27.523761880940473 24.09704852426213 95-99 20.040030022516888 28.45133850387791 27.660745559169374 23.847885914435825 100-104 20.36314525810324 28.711484593837532 27.055822328931573 23.86954781912765 105-109 20.64516129032258 28.667166791697923 26.811702925731435 23.875968992248062 110-114 20.124117912016416 28.822381262199087 27.045693408738302 24.007807417046195 115-119 20.809566696687682 28.925247673371363 26.758731111778246 23.506454518162716 120-124 21.02 28.96 26.005 24.015 125-129 20.57 28.315 26.590000000000003 24.525 130-134 20.37305595839376 28.814322148322248 26.568985347802172 24.243636545481824 135-139 20.646355495522535 29.381159637800792 26.404522487368055 23.567962379308618 140-144 21.493223983597538 28.374256138420762 25.78386758013702 24.348652297844676 145-149 22.11 29.43 24.77 23.69 150 18.16362271703778 31.798849136852642 24.0180135101326 26.019514635976982 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 0.5 24 0.0 25 1.0 26 3.0 27 4.5 28 7.5 29 11.0 30 15.0 31 22.5 32 36.5 33 50.0 34 61.0 35 81.5 36 97.0 37 119.5 38 136.0 39 159.0 40 198.0 41 212.5 42 212.0 43 239.5 44 281.0 45 279.5 46 266.5 47 242.0 48 223.0 49 204.0 50 180.5 51 155.5 52 118.0 53 92.0 54 74.5 55 57.0 56 43.0 57 36.5 58 23.0 59 16.0 60 11.5 61 6.5 62 4.0 63 3.5 64 4.0 65 2.0 66 1.0 67 1.0 68 0.5 69 0.0 70 1.0 71 1.5 72 1.0 73 0.5 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.44999999999999996 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.005 80-84 0.0 85-89 0.0 90-94 0.05 95-99 0.075 100-104 0.04 105-109 0.025 110-114 0.095 115-119 0.06999999999999999 120-124 0.0 125-129 0.0 130-134 0.015 135-139 0.055 140-144 0.015 145-149 0.0 150 0.075 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.82460536206464 99.6 2 0.15033826108744675 0.3 3 0.0 0.0 4 0.025056376847907794 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.0625 0.0 0.0 0.0 0.0 54-55 0.075 0.0 0.0 0.0 0.0 56-57 0.1 0.0 0.0 0.0 0.0 58-59 0.1 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.16249999999999998 0.0 0.0 0.0 0.0 64-65 0.21250000000000002 0.0 0.0 0.0 0.0 66-67 0.25 0.0 0.0 0.0 0.0 68-69 0.25 0.0 0.0 0.0 0.0 70-71 0.3 0.0 0.0 0.0 0.0 72-73 0.325 0.0 0.0 0.0 0.0 74-75 0.3375 0.0 0.0 0.0 0.0 76-77 0.375 0.0 0.0 0.0 0.0 78-79 0.42500000000000004 0.0 0.0 0.0 0.0 80-81 0.6 0.0 0.0 0.0 0.0 82-83 0.6 0.0 0.0 0.0 0.0 84-85 0.6 0.0 0.0 0.0 0.0 86-87 0.6 0.0 0.0 0.0 0.0 88-89 0.6 0.0 0.0 0.0 0.0 90-91 0.625 0.0 0.0 0.0 0.0 92-93 0.675 0.0 0.0 0.0 0.0 94-95 0.925 0.0 0.0 0.0 0.0 96-97 0.975 0.0 0.0 0.0 0.0 98-99 1.0375 0.0 0.0 0.0 0.0 100-101 1.6625 0.0 0.0 0.0 0.0 102-103 1.8875 0.0 0.0 0.0 0.0 104-105 2.0125 0.0 0.0 0.0 0.0 106-107 2.3625 0.0 0.0 0.0 0.0 108-109 3.075 0.0 0.0 0.0 0.0 110-111 3.4875 0.0 0.0 0.0 0.0 112-113 4.1625 0.0 0.0 0.0 0.0 114-115 4.6 0.0 0.0 0.0 0.0 116-117 5.425000000000001 0.0 0.0 0.0 0.0 118-119 5.7625 0.0 0.0 0.0 0.0 120-121 5.775 0.0 0.0 0.0 0.0 122-123 5.9875 0.0 0.0 0.0 0.0 124-125 6.9125 0.0 0.0 0.0 0.0 126-127 7.1 0.0 0.0 0.0 0.0 128-129 7.637499999999999 0.0 0.0 0.0 0.0 130-131 7.775 0.0 0.0 0.0 0.0 132-133 8.3 0.0 0.0 0.0 0.0 134-135 9.725 0.0 0.0 0.0 0.0 136-137 11.600000000000001 0.0 0.0 0.0 0.0 138 12.8 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TAGCATA 10 0.006973645 144.0 7 CAGGTAT 10 0.006973645 144.0 1 >>END_MODULE SRR1799536 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR1799536_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.3555 34.0 34.0 34.0 31.0 34.0 2 33.389 34.0 34.0 34.0 33.0 34.0 3 33.4335 34.0 34.0 34.0 33.0 34.0 4 36.52325 37.0 37.0 37.0 37.0 37.0 5 36.52125 37.0 37.0 37.0 37.0 37.0 6 36.53175 37.0 37.0 37.0 37.0 37.0 7 36.543 37.0 37.0 37.0 37.0 37.0 8 36.53475 37.0 37.0 37.0 37.0 37.0 9 38.443 39.0 39.0 39.0 39.0 39.0 10-14 38.8091 39.4 39.4 39.4 39.2 39.4 15-19 40.23495 41.0 41.0 41.0 40.0 41.0 20-24 40.1888 41.0 41.0 41.0 39.2 41.0 25-29 40.1188 41.0 40.8 41.0 39.0 41.0 30-34 40.0017 41.0 40.2 41.0 39.0 41.0 35-39 39.91125 41.0 40.0 41.0 38.6 41.0 40-44 39.7855 41.0 40.0 41.0 38.4 41.0 45-49 39.744099999999996 41.0 40.0 41.0 38.0 41.0 50-54 38.9544 40.2 39.2 40.6 37.0 41.0 55-59 39.28505 41.0 39.4 41.0 36.4 41.0 60-64 38.70305 40.4 38.2 41.0 35.2 41.0 65-69 38.103300000000004 39.2 36.8 41.0 35.0 41.0 70-74 37.06945 37.6 35.4 39.6 35.0 41.0 75-79 35.93935 36.2 35.0 37.8 35.0 39.4 80-84 35.0778 35.2 35.0 36.4 34.2 37.6 85-89 34.5523 35.0 35.0 35.8 34.0 36.4 90-94 34.2783 35.0 35.0 35.0 34.0 36.0 95-99 34.1289 35.0 35.0 35.0 34.0 36.0 100-104 34.07340000000001 35.0 35.0 35.0 34.0 35.4 105-109 33.98775 35.0 35.0 35.0 33.2 35.0 110-114 33.90575 35.0 35.0 35.0 33.0 35.0 115-119 33.8557 35.0 35.0 35.0 33.0 35.0 120-124 33.6491 35.0 35.0 35.0 32.6 35.0 125-129 33.57075 35.0 34.0 35.0 32.0 35.0 130-134 33.3319 35.0 34.0 35.0 31.8 35.0 135-139 33.13105 35.0 34.0 35.0 31.0 35.0 140-144 32.96215 35.0 34.0 35.0 30.6 35.0 145-149 32.588849999999994 35.0 33.8 35.0 30.0 35.0 150 29.1435 32.0 29.0 34.0 19.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 29.0 3 0.0 4 1.0 5 2.0 6 0.0 7 1.0 8 3.0 9 2.0 10 4.0 11 1.0 12 2.0 13 1.0 14 2.0 15 2.0 16 5.0 17 0.0 18 2.0 19 5.0 20 1.0 21 2.0 22 1.0 23 3.0 24 6.0 25 5.0 26 13.0 27 6.0 28 7.0 29 10.0 30 11.0 31 18.0 32 34.0 33 48.0 34 87.0 35 210.0 36 1023.0 37 2384.0 38 69.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.35 19.75 13.875000000000002 30.025000000000002 2 28.599999999999998 25.5 30.45 15.45 3 19.775000000000002 27.474999999999998 32.775 19.975 4 24.4 32.175 23.95 19.475 5 26.775 35.525 22.325 15.375 6 20.175 36.75 25.174999999999997 17.9 7 22.325 21.375 38.175 18.125 8 22.625 26.325 28.849999999999998 22.2 9 23.067300475356518 24.7935951963973 30.322742056542406 21.816362271703778 10-14 24.03860579086863 28.70430564584688 26.35895384307646 20.89813472020803 15-19 23.745 27.639999999999997 27.939999999999998 20.674999999999997 20-24 24.265 28.249999999999996 27.165 20.32 25-29 23.630000000000003 27.889999999999997 28.24 20.24 30-34 23.391695847923963 27.688844422211105 28.204102051025515 20.715357678839418 35-39 24.035 27.375 28.075 20.515 40-44 23.94 27.345000000000002 28.285 20.43 45-49 23.6580119065486 27.435089299114512 28.560708389614287 20.3461904047226 50-54 23.33466693338668 28.260652130426084 27.805561112222442 20.59911982396479 55-59 23.54706411923577 27.70331099329799 28.088426527958386 20.66119835950785 60-64 23.523528529279393 27.88418262739411 28.40926138920838 20.18302745411812 65-69 23.903585537830672 27.639145871880782 28.654298144721707 19.802970445566835 70-74 24.250762995947365 27.47786060939611 28.16830940111072 20.103066993545802 75-79 23.576178808940448 27.01635081754088 28.766438321916095 20.641032051602583 80-84 24.245 27.500000000000004 28.285 19.97 85-89 24.27849747411594 27.25453908868104 28.264892712449356 20.202070724753664 90-94 23.61 27.255000000000003 28.845 20.29 95-99 24.154999999999998 27.675 28.349999999999998 19.82 100-104 23.93 28.08 27.72 20.27 105-109 24.36365454818223 27.529129369405407 28.43926588988348 19.66795019252888 110-114 24.775 27.685 27.955000000000002 19.585 115-119 24.529999999999998 27.384999999999998 28.02 20.064999999999998 120-124 25.283906148381607 27.890339686827755 27.670218620241133 19.1555355445495 125-129 25.02125106255313 27.966398319915996 27.57637881894095 19.43597179858993 130-134 25.75515103020604 28.210642128425683 27.015403080616124 19.01880376075215 135-139 25.247524752475247 28.18781878187819 27.07270727072707 19.491949194919492 140-144 26.176779550797857 29.038067130208596 26.371867340303133 18.41328597869041 145-149 27.264991490639705 28.436279907898687 25.372910201221345 18.925818400240264 150 28.8360450563204 26.83354192740926 25.431789737171464 18.89862327909887 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.5 22 0.5 23 1.5 24 2.0 25 2.0 26 2.5 27 4.0 28 4.0 29 8.0 30 12.5 31 14.0 32 22.5 33 32.0 34 45.0 35 61.5 36 85.0 37 112.0 38 135.5 39 163.5 40 191.0 41 220.0 42 243.5 43 262.0 44 293.5 45 317.5 46 293.5 47 252.0 48 230.5 49 200.5 50 167.0 51 147.5 52 122.0 53 89.5 54 68.5 55 52.5 56 40.5 57 28.5 58 19.5 59 14.0 60 6.5 61 6.0 62 5.0 63 4.0 64 3.5 65 3.0 66 3.0 67 1.5 68 0.5 69 0.5 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.5 79 1.0 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.075 10-14 0.015 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.05 35-39 0.0 40-44 0.0 45-49 0.055 50-54 0.02 55-59 0.03 60-64 0.015 65-69 0.015 70-74 0.065 75-79 0.005 80-84 0.0 85-89 0.034999999999999996 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.015 110-114 0.0 115-119 0.0 120-124 0.055 125-129 0.005 130-134 0.02 135-139 0.01 140-144 0.045 145-149 0.11 150 0.125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74937343358395 99.5 2 0.2506265664160401 0.5 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.0625 0.0 0.0 0.0 0.0 54-55 0.075 0.0 0.0 0.0 0.0 56-57 0.1 0.0 0.0 0.0 0.0 58-59 0.1 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.16249999999999998 0.0 0.0 0.0 0.0 64-65 0.21250000000000002 0.0 0.0 0.0 0.0 66-67 0.25 0.0 0.0 0.0 0.0 68-69 0.25 0.0 0.0 0.0 0.0 70-71 0.3 0.0 0.0 0.0 0.0 72-73 0.35 0.0 0.0 0.0 0.0 74-75 0.3625 0.0 0.0 0.0 0.0 76-77 0.4 0.0 0.0 0.0 0.0 78-79 0.44999999999999996 0.0 0.0 0.0 0.0 80-81 0.625 0.0 0.0 0.0 0.0 82-83 0.625 0.0 0.0 0.0 0.0 84-85 0.625 0.0 0.0 0.0 0.0 86-87 0.625 0.0 0.0 0.0 0.0 88-89 0.625 0.0 0.0 0.0 0.0 90-91 0.65 0.0 0.0 0.0 0.0 92-93 0.7 0.0 0.0 0.0 0.0 94-95 0.95 0.0 0.0 0.0 0.0 96-97 1.0 0.0 0.0 0.0 0.0 98-99 1.0625 0.0 0.0 0.0 0.0 100-101 1.6875 0.0 0.0 0.0 0.0 102-103 1.9125 0.0 0.0 0.0 0.0 104-105 2.0375 0.0 0.0 0.0 0.0 106-107 2.3875 0.0 0.0 0.0 0.0 108-109 3.125 0.0 0.0 0.0 0.0 110-111 3.525 0.0 0.0 0.0 0.0 112-113 4.1875 0.0 0.0 0.0 0.0 114-115 4.625 0.0 0.0 0.0 0.0 116-117 5.4625 0.0 0.0 0.0 0.0 118-119 5.7875 0.0 0.0 0.0 0.0 120-121 5.8 0.0 0.0 0.0 0.0 122-123 6.0125 0.0 0.0 0.0 0.0 124-125 6.9125 0.0 0.0 0.0 0.0 126-127 7.1 0.0 0.0 0.0 0.0 128-129 7.637499999999999 0.0 0.0 0.0 0.0 130-131 7.775 0.0 0.0 0.0 0.0 132-133 8.3375 0.0 0.0 0.0 0.0 134-135 9.75 0.0 0.0 0.0 0.0 136-137 11.625 0.0 0.0 0.0 0.0 138 12.85 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAAAAA 40 0.007966741 18.0 140-144 >>END_MODULE Read 968110 spots for SRR1799536.sra Written 968110 spots for SRR1799536.sra Read 968110 spots for SRR1799536.sra Written 968110 spots for SRR1799536.sra Read 968110 spots for SRR1799536.sra Written 968110 spots for SRR1799536.sra Read 968110 spots for SRR1799536.sra Written 968110 spots for SRR1799536.sra Read 968110 spots for SRR1799536.sra Written 968110 spots for SRR1799536.sra Read 968110 spots for SRR1799536.sra Written 968110 spots for SRR1799536.sra Read 968110 spots for SRR1799536.sra Written 968110 spots for SRR1799536.sra Read 968110 spots for SRR1799536.sra Written 968110 spots for SRR1799536.sra Read 968120 spots for SRR1799536.sra Written 968120 spots for SRR1799536.sra Read 968110 spots for SRR1799536.sra Written 968110 spots for SRR1799536.sra Read 968110 spots for SRR1799536.sra Written 968110 spots for SRR1799536.sra Read 968110 spots for SRR1799536.sra Written 968110 spots for SRR1799536.sra Read 968110 spots for SRR1799536.sra Written 968110 spots for SRR1799536.sra Read 968110 spots for SRR1799536.sra Written 968110 spots for SRR1799536.sra Read 968110 spots for SRR1799536.sra Written 968110 spots for SRR1799536.sra Read 968110 spots for SRR1799536.sra Written 968110 spots for SRR1799536.sra Read 968110 spots for SRR1799536.sra Written 968110 spots for SRR1799536.sra Read 968110 spots for SRR1799536.sra Written 968110 spots for SRR1799536.sra Read 968110 spots for SRR1799536.sra Written 968110 spots for SRR1799536.sra Read 968110 spots for SRR1799536.sra Written 968110 spots for SRR1799536.sra SRR ids: ['SRR1799536.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_kolv_nyc SRR1799536.sra spots: 19362210 blocks: [[1, 968110], [968111, 1936220], [1936221, 2904330], [2904331, 3872440], [3872441, 4840550], [4840551, 5808660], [5808661, 6776770], [6776771, 7744880], [7744881, 8712990], [8712991, 9681100], [9681101, 10649210], [10649211, 11617320], [11617321, 12585430], [12585431, 13553540], [13553541, 14521650], [14521651, 15489760], [15489761, 16457870], [16457871, 17425980], [17425981, 18394090], [18394091, 19362210]] SRR1799536 file size 6501700 SRR1799536 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR1799536 SRR1799536_1.fastq SRR1799536_2.fastq Input file: SRR1799536_1.fastq Paired file: SRR1799536_2.fastq trimmed: SRR1799536-trimmed-pair1.fastq, SRR1799536-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 21:29:25 2025 >> started Thu Feb 13 21:29:45 2025 >> done (20.576s) 19362210 read pairs processed; of these: 37668 ( 0.19%) short read pairs filtered out after trimming by size control 89285 ( 0.46%) empty read pairs filtered out after trimming by size control 19235257 (99.34%) read pairs available; of these: 6814200 (35.43%) trimmed read pairs available after processing 12421057 (64.57%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 1 0.00% 20 5 0.00% 21 7 0.00% 22 6 0.00% 23 20 0.00% 24 20 0.00% 25 21 0.00% 26 27 0.00% 27 38 0.00% 28 49 0.00% 29 55 0.00% 30 60 0.00% 31 86 0.00% 32 84 0.00% 33 96 0.00% 34 114 0.00% 35 155 0.00% 36 155 0.00% 37 178 0.00% 38 205 0.00% 39 217 0.00% 40 222 0.00% 41 273 0.00% 42 322 0.00% 43 326 0.00% 44 339 0.00% 45 390 0.00% 46 435 0.00% 47 466 0.00% 48 513 0.00% 49 525 0.00% 50 632 0.00% 51 689 0.00% 52 741 0.00% 53 781 0.00% 54 824 0.00% 55 867 0.00% 56 936 0.00% 57 1050 0.01% 58 1179 0.01% 59 1368 0.01% 60 1456 0.01% 61 1592 0.01% 62 1790 0.01% 63 1887 0.01% 64 2123 0.01% 65 2308 0.01% 66 2610 0.01% 67 3800 0.02% 68 4243 0.02% 69 3521 0.02% 70 3831 0.02% 71 4325 0.02% 72 5002 0.03% 73 5745 0.03% 74 6221 0.03% 75 6919 0.04% 76 7401 0.04% 77 7213 0.04% 78 6982 0.04% 79 6273 0.03% 80 5277 0.03% 81 4655 0.02% 82 4083 0.02% 83 3697 0.02% 84 6720 0.03% 85 6990 0.04% 86 7490 0.04% 87 8706 0.05% 88 9752 0.05% 89 12219 0.06% 90 10629 0.06% 91 10522 0.05% 92 12369 0.06% 93 43960 0.23% 94 15662 0.08% 95 11831 0.06% 96 12524 0.07% 97 13495 0.07% 98 13794 0.07% 99 42059 0.22% 100 34699 0.18% 101 12864 0.07% 102 12967 0.07% 103 29168 0.15% 104 21803 0.11% 105 21222 0.11% 106 68049 0.35% 107 83615 0.43% 108 17789 0.09% 109 49247 0.26% 110 20719 0.11% 111 80228 0.42% 112 20964 0.11% 113 77788 0.40% 114 23321 0.12% 115 131184 0.68% 116 33098 0.17% 117 60679 0.32% 118 13680 0.07% 119 13293 0.07% 120 14980 0.08% 121 23125 0.12% 122 72653 0.38% 123 99983 0.52% 124 49858 0.26% 125 23412 0.12% 126 20147 0.10% 127 80540 0.42% 128 39219 0.20% 129 23390 0.12% 130 35766 0.19% 131 85761 0.45% 132 94247 0.49% 133 86265 0.45% 134 161624 0.84% 135 168104 0.87% 136 173575 0.90% 137 171279 0.89% 138 178378 0.93% 139 184432 0.96% 140 188401 0.98% 141 194451 1.01% 142 199013 1.03% 143 207289 1.08% 144 213889 1.11% 145 234195 1.22% 146 272180 1.42% 147 315040 1.64% 148 438603 2.28% 149 1581871 8.22% 150 12421057 64.57% 19235257 reads passed initial QC criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=2.66 fanout-score-rank=35 prefix-density=0.21 prefix-fanout=2.5 sequence=CTCCACACTTGTA criterion=fanout-score sequence-density=0.11 sequence-density-rank=7 fanout-score=85.36 fanout-score-rank=1 prefix-density=0.67 prefix-fanout=14.2 sequence=CCACCACCATGGGCTCCCCAGCCACCATAGGTGTCAATAATGATCTTGCGTCCAGTGAGACCTGCATCACCATGAGGACCACCAATAAC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=4.25 fanout-score-rank=24 prefix-density=0.25 prefix-fanout=3.2 sequence=TGGCTCCTTGTGCATCAGCAGCACAGGATGAGAATTCTTCAGTTTCGAGCCAGTGCTGCGCTCGGGTGAAGAAAATTGGACAGAACCCAGCGTGCCTTTGTGCTGTTATGCTTTCCAAAACTGCTAAGAGCTCTGGAATCAAGCCAGAAATTGCAATGACCATTCCCAAACGATGCAACATTGCTGATCGTCCCGTGGGCTACAAGTGTGG criterion=fanout-score sequence-density=0.10 sequence-density-rank=19 fanout-score=26.58 fanout-score-rank=1 prefix-density=0.20 prefix-fanout=12.7 sequence=TTTTCTTCATTGCTGAGATATGCTTGCTTGCGGGTTCAGTAAGGAATGCCTACCACACCAGGTACCGGAATATTTTCGATGAAACCCTGGATTGCCCGTCATTGAGG SRR1799536 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 21:30:52 Started mapping on | Feb 13 21:30:52 Finished on | Feb 13 21:33:03 Mapping speed, Million of reads per hour | 528.60 Number of input reads | 19235257 Average input read length | 280 UNIQUE READS: Uniquely mapped reads number | 16120044 Uniquely mapped reads % | 83.80% Average mapped length | 277.79 Number of splices: Total | 13525474 Number of splices: Annotated (sjdb) | 13176621 Number of splices: GT/AG | 13256857 Number of splices: GC/AG | 164740 Number of splices: AT/AC | 11335 Number of splices: Non-canonical | 92542 Mismatch rate per base, % | 1.18% Deletion rate per base | 0.10% Deletion average length | 2.94 Insertion rate per base | 0.07% Insertion average length | 2.63 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 604730 % of reads mapped to multiple loci | 3.14% Number of reads mapped to too many loci | 31159 % of reads mapped to too many loci | 0.16% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 12.84% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2522478 2522478 2522478 N_multimapping 604730 604730 604730 N_noFeature 441507 15900326 541608 N_ambiguous 299970 1917 179358 UnstrandedReadsAssigned:15378567 PositiveStrandReadsAssigned:217801 NegativeStrandReadsAssigned:15399078 Dataset is classified negative stranded MeadianReadLen=142 20thPercentileLength=138 echo kmer=133 SRR1799536 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR1799536-trimmed-pair1.fastq SRR1799536-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,235,257 reads, 16,961,283 reads pseudoaligned [quant] estimated average fragment length: 179.757 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,091 rounds 52401 SRR1799536.ke.tsv 34699 SRR1799536.se.tsv 87100 total ==> SRR1799536.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1839.24 366 13.0583 Potri.005G024800.1.v4.1 1035 856.243 163 12.4921 Potri.004G059700.1.v4.1 961 782.243 24 2.01332 Potri.007G009000.2.v4.1 1416 1237.24 0 0 Potri.003G141000.2.v4.1 2943 2764.24 252.297 5.98936 Potri.016G087400.1.v4.1 270 104.361 1668 1048.83 Potri.015G069301.1.v4.1 564 385.518 0 0 Potri.010G195200.1.v4.1 1773 1594.24 25 1.02903 Potri.012G127500.1.v4.1 977 798.243 4093 336.473 ==> SRR1799536.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 747 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 325 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 6 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 7 SRR1799536 completed mapping pipeline successfully