Starting /dee2/code/volunteer_pipeline.sh SRR1799537 current disk space = 3087992438784 free memory = 1400623220 SRR1799537 SRAfilesize 24b504573ca04fa63300e6d306d9a007 SRR1799537.sra SRR1799537.sra file validated SRR1799537 is paired end SRR1799537 is conventional basespace SRR1799537 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR1799537_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.28025 34.0 34.0 34.0 31.0 34.0 2 33.409 34.0 34.0 34.0 31.0 34.0 3 33.4475 34.0 34.0 34.0 31.0 34.0 4 36.7045 37.0 37.0 37.0 35.0 37.0 5 36.677 37.0 37.0 37.0 35.0 37.0 6 36.572 37.0 37.0 37.0 35.0 37.0 7 36.62975 37.0 37.0 37.0 35.0 37.0 8 36.67175 37.0 37.0 37.0 35.0 37.0 9 38.56175 39.0 39.0 39.0 37.0 39.0 10-14 38.85355 39.4 39.2 39.4 37.4 39.4 15-19 40.122550000000004 41.0 40.0 41.0 38.0 41.0 20-24 39.90385 41.0 40.0 41.0 38.0 41.0 25-29 39.85 41.0 40.0 41.0 38.0 41.0 30-34 39.8004 41.0 40.0 41.0 37.8 41.0 35-39 39.812850000000005 41.0 40.0 41.0 38.0 41.0 40-44 39.7024 41.0 40.0 41.0 37.8 41.0 45-49 39.49885 41.0 39.6 41.0 37.0 41.0 50-54 39.346 41.0 39.0 41.0 36.6 41.0 55-59 39.140499999999996 40.6 38.6 41.0 35.6 41.0 60-64 38.557649999999995 40.0 37.4 41.0 35.0 41.0 65-69 37.737100000000005 39.0 36.2 40.8 34.4 41.0 70-74 36.65605 37.2 35.0 39.4 33.8 41.0 75-79 35.27235 35.6 34.4 37.4 32.4 39.2 80-84 34.9388 35.0 35.0 36.6 32.8 37.8 85-89 34.22375 35.0 34.2 35.6 32.0 36.6 90-94 33.95335 35.0 34.0 35.0 32.0 36.0 95-99 33.7532 35.0 34.0 35.0 31.8 35.0 100-104 33.4013 35.0 34.0 35.0 30.6 35.0 105-109 33.21855 35.0 34.0 35.0 30.6 35.0 110-114 33.0609 35.0 34.0 35.0 30.0 35.0 115-119 32.7349 35.0 33.0 35.0 29.0 35.0 120-124 32.367549999999994 34.8 33.0 35.0 27.4 35.0 125-129 32.01469999999999 34.0 32.0 35.0 26.6 35.0 130-134 31.296799999999998 34.0 31.4 35.0 24.2 35.0 135-139 30.736349999999998 34.0 31.0 35.0 23.2 35.0 140-144 29.80375 34.0 30.0 35.0 17.4 35.0 145-149 27.28485 33.0 26.8 34.6 2.0 35.0 150 18.9005 23.0 2.0 31.0 2.0 34.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 2.0 8 1.0 9 2.0 10 3.0 11 2.0 12 4.0 13 2.0 14 3.0 15 2.0 16 4.0 17 5.0 18 3.0 19 5.0 20 4.0 21 6.0 22 9.0 23 9.0 24 15.0 25 7.0 26 14.0 27 19.0 28 35.0 29 44.0 30 52.0 31 75.0 32 113.0 33 182.0 34 279.0 35 564.0 36 1303.0 37 1221.0 38 11.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.42792679869641 12.058159939834546 8.423163700175483 42.090749561293556 2 23.225 13.375 33.425 29.975 3 19.1 15.7 25.1 40.1 4 22.725 23.849999999999998 22.025 31.4 5 22.650000000000002 30.575000000000003 23.45 23.325000000000003 6 19.05239408373026 35.47254951115568 23.865630483830532 21.609425921283528 7 13.275 29.825000000000003 39.825 17.075000000000003 8 17.175 27.375 32.6 22.85 9 17.775 23.799999999999997 35.025 23.400000000000002 10-14 19.515 31.119999999999997 27.22 22.145 15-19 19.31 28.975 28.37 23.345 20-24 19.439999999999998 29.59 27.54 23.43 25-29 19.134999999999998 29.73 27.3 23.835 30-34 19.785 29.65 27.46 23.105 35-39 19.355 29.794999999999998 27.400000000000002 23.45 40-44 19.45 29.285 27.43 23.835 45-49 20.16 29.09 27.175 23.575 50-54 19.415 29.035 27.29 24.26 55-59 19.36 29.5 27.54 23.599999999999998 60-64 19.845 29.57 26.82 23.765 65-69 19.695 29.515 27.500000000000004 23.29 70-74 19.925 29.28 27.575 23.22 75-79 19.77 29.725 26.525 23.98 80-84 19.805 29.744999999999997 27.439999999999998 23.01 85-89 19.79 29.085 27.200000000000003 23.925 90-94 20.13 29.220000000000002 26.965 23.685000000000002 95-99 19.56 29.104999999999997 27.295 24.04 100-104 20.200000000000003 29.035 27.589999999999996 23.175 105-109 20.395 28.804999999999996 26.815 23.985 110-114 21.08 28.439999999999998 26.8 23.68 115-119 20.385 29.404999999999998 26.795 23.415 120-124 21.025 29.044999999999998 26.064999999999998 23.865 125-129 20.175 28.355000000000004 27.21 24.26 130-134 20.855 29.115000000000002 26.435 23.595 135-139 20.395 29.18 25.7 24.725 140-144 20.945 29.095 25.314999999999998 24.645 145-149 21.51 29.049999999999997 24.675 24.765 150 9.775 37.125 25.424999999999997 27.675 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.5 20 0.5 21 0.0 22 0.5 23 2.0 24 2.5 25 2.5 26 7.5 27 11.5 28 9.5 29 11.0 30 20.0 31 29.0 32 46.5 33 58.5 34 65.5 35 80.0 36 99.0 37 140.0 38 159.0 39 159.5 40 183.0 41 214.0 42 239.5 43 249.5 44 272.0 45 269.0 46 235.0 47 226.5 48 223.5 49 192.5 50 163.0 51 144.5 52 117.5 53 95.0 54 68.5 55 49.0 56 40.5 57 31.0 58 25.0 59 19.5 60 11.0 61 6.5 62 5.0 63 3.5 64 1.0 65 1.5 66 2.0 67 1.0 68 1.0 69 0.5 70 0.5 71 1.0 72 0.5 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.27499999999999997 2 0.0 3 0.0 4 0.0 5 0.0 6 0.27499999999999997 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72417251755266 99.425 2 0.25075225677031093 0.5 3 0.025075225677031094 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.2125 0.0 0.0 0.0 0.0 78-79 0.275 0.0 0.0 0.0 0.0 80-81 0.325 0.0 0.0 0.0 0.0 82-83 0.3625 0.0 0.0 0.0 0.0 84-85 0.3875 0.0 0.0 0.0 0.0 86-87 0.4 0.0 0.0 0.0 0.0 88-89 0.4 0.0 0.0 0.0 0.0 90-91 0.65 0.0 0.0 0.0 0.0 92-93 0.8625 0.0 0.0 0.0 0.0 94-95 0.975 0.0 0.0 0.0 0.0 96-97 1.1625 0.0 0.0 0.0 0.0 98-99 1.2875 0.0 0.0 0.0 0.0 100-101 1.4625 0.0 0.0 0.0 0.0 102-103 1.9875 0.0 0.0 0.0 0.0 104-105 2.3375 0.0 0.0 0.0 0.0 106-107 3.075 0.0 0.0 0.0 0.0 108-109 4.125 0.0 0.0 0.0 0.0 110-111 4.75 0.0 0.0 0.0 0.0 112-113 5.225 0.0 0.0 0.0 0.0 114-115 5.5 0.0 0.0 0.0 0.0 116-117 6.35 0.0 0.0 0.0 0.0 118-119 6.425 0.0 0.0 0.0 0.0 120-121 6.55 0.0 0.0 0.0 0.0 122-123 6.800000000000001 0.0 0.0 0.0 0.0 124-125 7.8375 0.0 0.0 0.0 0.0 126-127 8.875 0.0 0.0 0.0 0.0 128-129 9.3875 0.0 0.0 0.0 0.0 130-131 10.175 0.0 0.0 0.0 0.0 132-133 10.95 0.0 0.0 0.0 0.0 134-135 12.35 0.0 0.0 0.0 0.0 136-137 13.725 0.0 0.0 0.0 0.0 138 14.8 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GACAGAG 10 0.006973645 144.0 5 GTTCAAC 10 0.006973645 144.0 6 AGTTCAA 10 0.006973645 144.0 5 >>END_MODULE SRR1799537 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR1799537_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.926 34.0 33.0 34.0 31.0 34.0 2 33.05 34.0 33.0 34.0 31.0 34.0 3 33.0805 34.0 34.0 34.0 31.0 34.0 4 36.318 37.0 37.0 37.0 35.0 37.0 5 36.35125 37.0 37.0 37.0 35.0 37.0 6 36.38275 37.0 37.0 37.0 35.0 37.0 7 36.37575 37.0 37.0 37.0 35.0 37.0 8 36.38725 37.0 37.0 37.0 35.0 37.0 9 38.21575 39.0 39.0 39.0 37.0 39.0 10-14 38.5567 39.4 39.2 39.4 37.2 39.4 15-19 39.765249999999995 41.0 40.0 41.0 38.0 41.0 20-24 39.699 41.0 40.0 41.0 38.0 41.0 25-29 39.4972 41.0 40.0 41.0 37.8 41.0 30-34 39.28805 40.6 39.4 41.0 37.0 41.0 35-39 38.979150000000004 40.0 38.8 41.0 36.4 41.0 40-44 38.85615 40.0 38.4 41.0 35.8 41.0 45-49 39.0617 40.6 39.0 41.0 36.2 41.0 50-54 38.088 39.4 38.0 40.2 34.6 40.6 55-59 38.32995 40.0 37.8 41.0 34.4 41.0 60-64 37.774 39.4 36.8 41.0 33.8 41.0 65-69 36.8678 38.2 35.4 40.2 32.6 41.0 70-74 36.248949999999994 36.8 35.0 39.2 33.0 40.8 75-79 35.258950000000006 35.6 35.0 37.4 32.6 39.2 80-84 34.35985 35.0 34.4 36.2 31.8 37.6 85-89 33.563750000000006 35.0 34.0 35.2 30.6 36.4 90-94 33.259550000000004 35.0 34.0 35.0 30.0 36.0 95-99 32.9931 35.0 34.0 35.0 29.8 35.0 100-104 32.70605 35.0 33.2 35.0 29.0 35.0 105-109 32.2907 35.0 33.0 35.0 27.4 35.0 110-114 32.09255 34.8 32.6 35.0 27.0 35.0 115-119 31.843200000000003 34.0 32.0 35.0 26.2 35.0 120-124 31.315949999999997 34.0 31.2 35.0 24.8 35.0 125-129 30.948950000000004 34.0 31.0 35.0 23.8 35.0 130-134 30.19535 34.0 30.2 35.0 20.0 35.0 135-139 29.45025 33.6 29.0 35.0 17.6 35.0 140-144 28.585649999999998 33.0 28.2 34.8 7.6 35.0 145-149 26.752500000000005 32.6 25.6 34.2 2.0 35.0 150 20.50275 25.0 2.0 32.0 2.0 34.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 22.0 3 3.0 4 1.0 5 2.0 6 0.0 7 2.0 8 1.0 9 1.0 10 4.0 11 3.0 12 5.0 13 5.0 14 4.0 15 3.0 16 2.0 17 7.0 18 5.0 19 7.0 20 8.0 21 6.0 22 13.0 23 11.0 24 10.0 25 17.0 26 24.0 27 35.0 28 30.0 29 56.0 30 80.0 31 89.0 32 145.0 33 222.0 34 332.0 35 677.0 36 1337.0 37 821.0 38 10.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.1 20.674999999999997 12.625 30.599999999999998 2 26.474999999999998 25.174999999999997 32.25 16.1 3 19.8 28.000000000000004 32.025 20.175 4 25.7 30.75 25.35 18.2 5 25.95 34.225 24.2 15.625 6 21.75 37.6 23.225 17.424999999999997 7 20.075000000000003 22.400000000000002 38.2 19.325 8 21.7 25.124999999999996 28.975 24.2 9 22.325 24.55 30.9 22.225 10-14 24.065 28.544999999999998 26.855 20.535 15-19 23.544999999999998 28.215 28.389999999999997 19.85 20-24 23.685000000000002 27.35 28.405 20.560000000000002 25-29 23.82 27.534999999999997 28.035 20.61 30-34 24.34 27.57 28.444999999999997 19.645000000000003 35-39 23.835 26.99 28.610000000000003 20.565 40-44 23.64 27.55 28.470000000000002 20.34 45-49 23.325000000000003 27.500000000000004 28.765 20.41 50-54 23.525 27.66 28.294999999999998 20.52 55-59 23.715 27.584999999999997 28.65 20.05 60-64 23.845 27.779999999999998 28.544999999999998 19.830000000000002 65-69 24.07 27.500000000000004 28.42 20.01 70-74 24.285 26.645000000000003 29.360000000000003 19.71 75-79 23.275000000000002 27.43 28.910000000000004 20.385 80-84 23.555 27.725 28.455000000000002 20.265 85-89 23.555 27.57 29.065 19.81 90-94 24.18 27.145000000000003 29.160000000000004 19.515 95-99 23.745 27.365000000000002 29.244999999999997 19.645000000000003 100-104 24.38 27.625 28.375 19.62 105-109 24.404999999999998 27.655 28.23 19.71 110-114 24.54 27.725 27.815 19.919999999999998 115-119 24.505 28.23 27.82 19.445 120-124 24.935 27.200000000000003 28.299999999999997 19.564999999999998 125-129 24.654999999999998 27.725 28.194999999999997 19.425 130-134 25.955000000000002 28.475 27.195000000000004 18.375 135-139 26.215 28.17 27.584999999999997 18.029999999999998 140-144 26.625 28.285 26.69 18.4 145-149 27.66 27.505000000000003 26.14 18.695 150 28.499999999999996 26.775 25.374999999999996 19.35 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.5 20 1.0 21 0.5 22 0.0 23 0.0 24 1.5 25 2.0 26 2.0 27 5.5 28 8.0 29 14.0 30 22.5 31 21.5 32 30.5 33 39.5 34 42.0 35 66.0 36 103.5 37 119.5 38 137.0 39 169.0 40 190.0 41 234.0 42 260.0 43 255.5 44 272.5 45 265.5 46 274.0 47 261.5 48 231.5 49 204.5 50 155.5 51 140.5 52 117.5 53 85.0 54 66.0 55 50.5 56 38.0 57 29.5 58 21.5 59 15.5 60 10.0 61 6.5 62 4.0 63 3.5 64 2.5 65 2.5 66 4.0 67 2.5 68 0.0 69 0.5 70 1.5 71 2.5 72 1.5 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.84977466199298 99.7 2 0.15022533800701052 0.3 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.2125 0.0 0.0 0.0 0.0 78-79 0.275 0.0 0.0 0.0 0.0 80-81 0.325 0.0 0.0 0.0 0.0 82-83 0.3625 0.0 0.0 0.0 0.0 84-85 0.3875 0.0 0.0 0.0 0.0 86-87 0.4 0.0 0.0 0.0 0.0 88-89 0.4 0.0 0.0 0.0 0.0 90-91 0.6375 0.0 0.0 0.0 0.0 92-93 0.8374999999999999 0.0 0.0 0.0 0.0 94-95 0.95 0.0 0.0 0.0 0.0 96-97 1.1375 0.0 0.0 0.0 0.0 98-99 1.275 0.0 0.0 0.0 0.0 100-101 1.4625 0.0 0.0 0.0 0.0 102-103 2.0125 0.0 0.0 0.0 0.0 104-105 2.3625 0.0 0.0 0.0 0.0 106-107 3.1 0.0 0.0 0.0 0.0 108-109 4.15 0.0 0.0 0.0 0.0 110-111 4.775 0.0 0.0 0.0 0.0 112-113 5.275 0.0 0.0 0.0 0.0 114-115 5.550000000000001 0.0 0.0 0.0 0.0 116-117 6.4 0.0 0.0 0.0 0.0 118-119 6.475 0.0 0.0 0.0 0.0 120-121 6.6 0.0 0.0 0.0 0.0 122-123 6.85 0.0 0.0 0.0 0.0 124-125 7.887499999999999 0.0 0.0 0.0 0.0 126-127 9.0125 0.0 0.0 0.0 0.0 128-129 9.55 0.0 0.0 0.0 0.0 130-131 10.375 0.0 0.0 0.0 0.0 132-133 11.1625 0.0 0.0 0.0 0.0 134-135 12.55 0.0 0.0 0.0 0.0 136-137 13.9375 0.0 0.0 0.0 0.0 138 15.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATGATAC 10 0.006973645 144.0 9 CGATGAT 10 0.006973645 144.0 7 >>END_MODULE Read 1182858 spots for SRR1799537.sra Written 1182858 spots for SRR1799537.sra Read 1182858 spots for SRR1799537.sra Written 1182858 spots for SRR1799537.sra Read 1182858 spots for SRR1799537.sra Written 1182858 spots for SRR1799537.sra Read 1182858 spots for SRR1799537.sra Written 1182858 spots for SRR1799537.sra Read 1182858 spots for SRR1799537.sra Written 1182858 spots for SRR1799537.sra Read 1182858 spots for SRR1799537.sra Written 1182858 spots for SRR1799537.sra Read 1182858 spots for SRR1799537.sra Written 1182858 spots for SRR1799537.sra Read 1182858 spots for SRR1799537.sra Written 1182858 spots for SRR1799537.sra Read 1182858 spots for SRR1799537.sra Written 1182858 spots for SRR1799537.sra Read 1182858 spots for SRR1799537.sra Written 1182858 spots for SRR1799537.sra Read 1182858 spots for SRR1799537.sra Written 1182858 spots for SRR1799537.sra Read 1182858 spots for SRR1799537.sra Written 1182858 spots for SRR1799537.sra Read 1182858 spots for SRR1799537.sra Written 1182858 spots for SRR1799537.sra Read 1182858 spots for SRR1799537.sra Written 1182858 spots for SRR1799537.sra Read 1182858 spots for SRR1799537.sra Written 1182858 spots for SRR1799537.sra Read 1182868 spots for SRR1799537.sra Written 1182868 spots for SRR1799537.sra Read 1182858 spots for SRR1799537.sra Written 1182858 spots for SRR1799537.sra Read 1182858 spots for SRR1799537.sra Written 1182858 spots for SRR1799537.sra Read 1182858 spots for SRR1799537.sra Written 1182858 spots for SRR1799537.sra Read 1182858 spots for SRR1799537.sra Written 1182858 spots for SRR1799537.sra SRR ids: ['SRR1799537.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ld49vo74 SRR1799537.sra spots: 23657170 blocks: [[1, 1182858], [1182859, 2365716], [2365717, 3548574], [3548575, 4731432], [4731433, 5914290], [5914291, 7097148], [7097149, 8280006], [8280007, 9462864], [9462865, 10645722], [10645723, 11828580], [11828581, 13011438], [13011439, 14194296], [14194297, 15377154], [15377155, 16560012], [16560013, 17742870], [17742871, 18925728], [18925729, 20108586], [20108587, 21291444], [21291445, 22474302], [22474303, 23657170]] SRR1799537 file size 7948732 SRR1799537 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR1799537 SRR1799537_1.fastq SRR1799537_2.fastq Input file: SRR1799537_1.fastq Paired file: SRR1799537_2.fastq trimmed: SRR1799537-trimmed-pair1.fastq, SRR1799537-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 20:57:13 2025 >> started Thu Feb 13 20:57:39 2025 >> done (25.595s) 23657170 read pairs processed; of these: 54040 ( 0.23%) short read pairs filtered out after trimming by size control 125969 ( 0.53%) empty read pairs filtered out after trimming by size control 23477161 (99.24%) read pairs available; of these: 12575906 (53.57%) trimmed read pairs available after processing 10901255 (46.43%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 2 0.00% 20 2 0.00% 21 9 0.00% 22 14 0.00% 23 15 0.00% 24 20 0.00% 25 30 0.00% 26 49 0.00% 27 58 0.00% 28 67 0.00% 29 83 0.00% 30 106 0.00% 31 136 0.00% 32 156 0.00% 33 162 0.00% 34 179 0.00% 35 231 0.00% 36 264 0.00% 37 263 0.00% 38 330 0.00% 39 371 0.00% 40 414 0.00% 41 504 0.00% 42 558 0.00% 43 545 0.00% 44 575 0.00% 45 688 0.00% 46 677 0.00% 47 821 0.00% 48 877 0.00% 49 977 0.00% 50 1040 0.00% 51 1115 0.00% 52 1242 0.01% 53 1288 0.01% 54 1468 0.01% 55 1487 0.01% 56 1624 0.01% 57 1787 0.01% 58 1873 0.01% 59 2065 0.01% 60 2266 0.01% 61 2543 0.01% 62 2645 0.01% 63 3016 0.01% 64 3284 0.01% 65 3468 0.01% 66 3747 0.02% 67 4137 0.02% 68 4411 0.02% 69 5044 0.02% 70 5523 0.02% 71 6158 0.03% 72 7036 0.03% 73 7729 0.03% 74 8913 0.04% 75 9800 0.04% 76 10606 0.05% 77 11153 0.05% 78 11214 0.05% 79 11055 0.05% 80 9866 0.04% 81 10190 0.04% 82 9672 0.04% 83 9199 0.04% 84 11330 0.05% 85 11582 0.05% 86 12213 0.05% 87 13955 0.06% 88 15652 0.07% 89 24887 0.11% 90 47499 0.20% 91 26951 0.11% 92 19395 0.08% 93 20316 0.09% 94 43176 0.18% 95 41045 0.17% 96 22648 0.10% 97 22074 0.09% 98 22784 0.10% 99 24840 0.11% 100 55425 0.24% 101 89292 0.38% 102 45410 0.19% 103 27698 0.12% 104 65658 0.28% 105 95600 0.41% 106 87344 0.37% 107 128871 0.55% 108 143361 0.61% 109 71940 0.31% 110 77230 0.33% 111 62343 0.27% 112 72651 0.31% 113 38057 0.16% 114 47432 0.20% 115 172641 0.74% 116 51410 0.22% 117 23505 0.10% 118 23193 0.10% 119 53162 0.23% 120 36201 0.15% 121 67559 0.29% 122 61051 0.26% 123 141184 0.60% 124 198535 0.85% 125 152085 0.65% 126 86428 0.37% 127 49775 0.21% 128 133765 0.57% 129 97179 0.41% 130 101614 0.43% 131 123960 0.53% 132 233139 0.99% 133 230817 0.98% 134 187031 0.80% 135 229891 0.98% 136 253394 1.08% 137 248720 1.06% 138 259451 1.11% 139 269175 1.15% 140 281450 1.20% 141 296552 1.26% 142 316601 1.35% 143 333681 1.42% 144 373026 1.59% 145 424090 1.81% 146 516587 2.20% 147 685714 2.92% 148 1045397 4.45% 149 3142437 13.39% 150 10901255 46.43% 23477161 reads passed initial QC criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=3.96 fanout-score-rank=33 prefix-density=0.30 prefix-fanout=3.1 sequence=CTCCACACTTGTA criterion=fanout-score sequence-density=0.10 sequence-density-rank=7 fanout-score=94.38 fanout-score-rank=1 prefix-density=0.60 prefix-fanout=15.8 sequence=CCACCACCATGGGCTCCCCAGCCACCATAGGTGTCAATAATGATCTTGCGTCCAGTGAGACCTGCATCACCATGAGGACCACCAATAAC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=6.29 fanout-score-rank=18 prefix-density=0.23 prefix-fanout=3.9 sequence=ATCCAGAAGGAGTCCAC criterion=fanout-score sequence-density=0.02 sequence-density-rank=36 fanout-score=93.14 fanout-score-rank=1 prefix-density=0.17 prefix-fanout=13.5 sequence=ATTTCTTCATCCTCTTCTGTGATAATTACTCCAACGTACCTTTTTGCTTCTTACAGTTTTCTTTTGCATCCCAGCTGTGCTTTATTTTCCTTCTAGTTCCAATGGCCACTGTTGAGGTTGTGTCAGCGCAGAATGCACTTGTAGAGGAAAAAAATGAACAACCAATCAAGGTTGAGACCACCAC SRR1799537 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 20:58:33 Started mapping on | Feb 13 20:58:33 Finished on | Feb 13 21:02:16 Mapping speed, Million of reads per hour | 379.00 Number of input reads | 23477161 Average input read length | 285 UNIQUE READS: Uniquely mapped reads number | 21686908 Uniquely mapped reads % | 92.37% Average mapped length | 282.64 Number of splices: Total | 17749779 Number of splices: Annotated (sjdb) | 17303390 Number of splices: GT/AG | 17406320 Number of splices: GC/AG | 221343 Number of splices: AT/AC | 15522 Number of splices: Non-canonical | 106594 Mismatch rate per base, % | 1.16% Deletion rate per base | 0.11% Deletion average length | 2.92 Insertion rate per base | 0.07% Insertion average length | 2.64 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 811681 % of reads mapped to multiple loci | 3.46% Number of reads mapped to too many loci | 47627 % of reads mapped to too many loci | 0.20% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.91% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1003568 1003568 1003568 N_multimapping 811681 811681 811681 N_noFeature 650886 21387273 797404 N_ambiguous 261918 1089 108426 UnstrandedReadsAssigned:20774104 PositiveStrandReadsAssigned:298546 NegativeStrandReadsAssigned:20781078 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=138 echo kmer=133 SRR1799537 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR1799537-trimmed-pair1.fastq SRR1799537-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,477,161 reads, 20,237,662 reads pseudoaligned [quant] estimated average fragment length: 187.186 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,239 rounds 52401 SRR1799537.ke.tsv 34699 SRR1799537.se.tsv 87100 total ==> SRR1799537.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1831.81 550 15.9241 Potri.005G024800.1.v4.1 1035 848.814 644 40.2391 Potri.004G059700.1.v4.1 961 774.814 20 1.36901 Potri.007G009000.2.v4.1 1416 1229.81 0 0 Potri.003G141000.2.v4.1 2943 2756.81 312.102 6.00432 Potri.016G087400.1.v4.1 270 101.104 2333 1223.83 Potri.015G069301.1.v4.1 564 378.363 0 0 Potri.010G195200.1.v4.1 1773 1586.81 30 1.0027 Potri.012G127500.1.v4.1 977 790.814 4653 312.057 ==> SRR1799537.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1684 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 387 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 12 SRR1799537 completed mapping pipeline successfully