Starting /dee2/code/volunteer_pipeline.sh SRR1799538 current disk space = 3088244224000 free memory = 1419675400 SRR1799538 SRAfilesize 1a2c269efeda36943cac7c51725e38b5 SRR1799538.sra SRR1799538.sra file validated SRR1799538 is paired end SRR1799538 is conventional basespace SRR1799538 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR1799538_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.20875 34.0 33.0 34.0 31.0 34.0 2 33.3855 34.0 34.0 34.0 31.0 34.0 3 33.43425 34.0 34.0 34.0 31.0 34.0 4 36.663 37.0 37.0 37.0 35.0 37.0 5 36.46025 37.0 37.0 37.0 35.0 37.0 6 36.56875 37.0 37.0 37.0 35.0 37.0 7 36.63875 37.0 37.0 37.0 35.0 37.0 8 36.6605 37.0 37.0 37.0 35.0 37.0 9 38.6035 39.0 39.0 39.0 38.0 39.0 10-14 38.8536 39.4 39.2 39.4 37.6 39.4 15-19 40.1691 41.0 40.0 41.0 38.0 41.0 20-24 40.13845 41.0 40.0 41.0 38.2 41.0 25-29 40.0144 41.0 40.0 41.0 38.0 41.0 30-34 39.852050000000006 41.0 40.0 41.0 38.0 41.0 35-39 39.5364 41.0 39.6 41.0 37.0 41.0 40-44 39.637299999999996 41.0 40.0 41.0 37.2 41.0 45-49 39.817800000000005 41.0 40.0 41.0 37.8 41.0 50-54 39.64575 41.0 40.0 41.0 37.0 41.0 55-59 39.328 41.0 39.0 41.0 36.0 41.0 60-64 38.846000000000004 40.2 37.8 41.0 35.0 41.0 65-69 38.111900000000006 39.2 36.4 41.0 35.0 41.0 70-74 37.10035 37.4 35.2 39.4 34.2 41.0 75-79 35.57789999999999 36.0 34.6 37.4 33.0 39.4 80-84 35.178900000000006 35.0 35.0 36.6 34.0 37.8 85-89 34.626999999999995 35.0 35.0 35.6 33.6 36.6 90-94 34.30265000000001 35.0 35.0 35.0 33.0 36.0 95-99 34.06245 35.0 34.8 35.0 33.0 35.2 100-104 33.91565 35.0 34.4 35.0 32.6 35.0 105-109 33.8521 35.0 34.0 35.0 32.0 35.0 110-114 33.8077 35.0 34.0 35.0 32.0 35.0 115-119 33.66925 35.0 34.0 35.0 31.6 35.0 120-124 33.453799999999994 35.0 34.0 35.0 31.0 35.0 125-129 33.30775 35.0 34.0 35.0 31.0 35.0 130-134 33.0758 35.0 34.0 35.0 30.4 35.0 135-139 32.847699999999996 35.0 33.0 35.0 29.8 35.0 140-144 32.4685 35.0 33.0 35.0 29.0 35.0 145-149 31.826100000000004 34.2 32.8 35.0 28.2 35.0 150 25.859 32.0 19.0 34.0 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 2.0 8 0.0 9 0.0 10 2.0 11 2.0 12 0.0 13 5.0 14 1.0 15 3.0 16 1.0 17 1.0 18 4.0 19 3.0 20 4.0 21 6.0 22 7.0 23 6.0 24 7.0 25 9.0 26 5.0 27 10.0 28 15.0 29 25.0 30 42.0 31 46.0 32 61.0 33 100.0 34 165.0 35 330.0 36 1119.0 37 1994.0 38 25.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.62453066332916 11.939924906132667 7.634543178973717 40.80100125156446 2 22.35 14.95 35.55 27.150000000000002 3 20.1 15.925 24.925 39.050000000000004 4 23.625 26.075 21.8 28.499999999999996 5 22.613065326633166 32.21105527638191 23.417085427135678 21.758793969849247 6 19.575 35.025 24.75 20.65 7 14.025000000000002 28.625 39.95 17.4 8 17.224999999999998 26.8 32.1 23.875 9 17.5 24.95 33.050000000000004 24.5 10-14 19.665 30.654999999999998 26.775 22.905 15-19 19.55 28.365000000000002 27.395000000000003 24.69 20-24 19.625 29.365000000000002 26.950000000000003 24.060000000000002 25-29 19.34 29.955 27.01 23.695 30-34 20.025000000000002 29.154999999999998 26.895000000000003 23.925 35-39 20.044999999999998 29.7 26.91 23.345 40-44 19.71 29.335 27.27 23.685000000000002 45-49 19.93 29.054999999999996 27.650000000000002 23.365 50-54 19.88 28.96 27.544999999999998 23.615 55-59 20.205000000000002 29.07 27.185 23.54 60-64 19.865 29.56 27.01 23.565 65-69 19.869999999999997 29.220000000000002 26.755000000000003 24.154999999999998 70-74 19.685 28.71 27.74 23.865 75-79 20.397039703970396 28.537853785378537 27.59275927592759 23.472347234723472 80-84 20.45 29.18 27.1 23.27 85-89 20.44 28.549999999999997 27.255000000000003 23.755000000000003 90-94 20.31312525010004 29.081632653061224 26.87575030012005 23.729491796718687 95-99 20.76226679337768 28.2098734557095 27.40459160706247 23.62326814385035 100-104 20.621186355906772 29.388816644993497 26.582974892467742 23.407022106631988 105-109 20.555138784696176 28.637159289822456 27.046761690422606 23.760940235058765 110-114 20.842505503301982 28.762257354412647 27.171302781669 23.22393436061637 115-119 21.559701865839628 28.97303786704017 25.931669251163026 23.53559101595718 120-124 21.355 29.654999999999998 25.395 23.595 125-129 21.17 29.060000000000002 25.86 23.91 130-134 21.307130713071306 28.982898289828984 25.217521752175216 24.49244924492449 135-139 21.44072036018009 29.02951475737869 25.012506253126567 24.517258629314657 140-144 21.246062303115156 29.391469573478673 24.676233811690583 24.686234311715584 145-149 20.61 29.465000000000003 25.319999999999997 24.605 150 18.034017008504254 30.71535767883942 24.16208104052026 27.088544272136065 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.0 24 1.5 25 5.5 26 8.5 27 8.5 28 8.5 29 17.0 30 23.5 31 21.0 32 30.0 33 46.0 34 59.5 35 70.0 36 87.5 37 102.0 38 127.5 39 160.0 40 175.5 41 207.5 42 234.5 43 247.0 44 272.0 45 277.0 46 274.5 47 255.0 48 228.0 49 215.5 50 179.5 51 148.0 52 134.0 53 106.5 54 75.5 55 55.5 56 34.5 57 25.5 58 21.0 59 13.5 60 10.5 61 8.5 62 6.0 63 5.0 64 3.0 65 0.5 66 1.5 67 1.5 68 0.0 69 1.0 70 1.5 71 0.5 72 1.0 73 1.0 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.125 2 0.0 3 0.0 4 0.0 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.01 80-84 0.0 85-89 0.0 90-94 0.04 95-99 0.034999999999999996 100-104 0.03 105-109 0.025 110-114 0.06 115-119 0.045 120-124 0.0 125-129 0.0 130-134 0.01 135-139 0.05 140-144 0.005 145-149 0.0 150 0.05 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77449260836883 99.55000000000001 2 0.22550739163117012 0.44999999999999996 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.0875 0.0 0.0 0.0 0.0 70-71 0.1375 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.2125 0.0 0.0 0.0 0.0 80-81 0.2875 0.0 0.0 0.0 0.0 82-83 0.4125 0.0 0.0 0.0 0.0 84-85 0.525 0.0 0.0 0.0 0.0 86-87 0.6375 0.0 0.0 0.0 0.0 88-89 0.825 0.0 0.0 0.0 0.0 90-91 0.9875 0.0 0.0 0.0 0.0 92-93 1.1 0.0 0.0 0.0 0.0 94-95 1.3375 0.0 0.0 0.0 0.0 96-97 1.6 0.0 0.0 0.0 0.0 98-99 1.8125 0.0 0.0 0.0 0.0 100-101 2.0875 0.0 0.0 0.0 0.0 102-103 2.4375 0.0 0.0 0.0 0.0 104-105 3.0375 0.0 0.0 0.0 0.0 106-107 3.7750000000000004 0.0 0.0 0.0 0.0 108-109 4.8 0.0 0.0 0.0 0.0 110-111 5.8125 0.0 0.0 0.0 0.0 112-113 6.5375 0.0 0.0 0.0 0.0 114-115 7.512499999999999 0.0 0.0 0.0 0.0 116-117 8.5625 0.0 0.0 0.0 0.0 118-119 9.662500000000001 0.0 0.0 0.0 0.0 120-121 10.4625 0.0 0.0 0.0 0.0 122-123 11.5875 0.0 0.0 0.0 0.0 124-125 12.725000000000001 0.0 0.0 0.0 0.0 126-127 13.587499999999999 0.0 0.0 0.0 0.0 128-129 14.9125 0.0 0.0 0.0 0.0 130-131 16.475 0.0 0.0 0.0 0.0 132-133 17.95 0.0 0.0 0.0 0.0 134-135 19.275 0.0 0.0 0.0 0.0 136-137 20.4875 0.0 0.0 0.0 0.0 138 21.525 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GATAATC 40 0.008006735 18.445513 5 >>END_MODULE SRR1799538 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR1799538_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.86825 34.0 33.0 34.0 31.0 34.0 2 32.909 34.0 34.0 34.0 31.0 34.0 3 32.96175 34.0 34.0 34.0 31.0 34.0 4 36.19575 37.0 37.0 37.0 35.0 37.0 5 36.21075 37.0 37.0 37.0 35.0 37.0 6 36.22825 37.0 37.0 37.0 35.0 37.0 7 36.1875 37.0 37.0 37.0 35.0 37.0 8 36.1935 37.0 37.0 37.0 35.0 37.0 9 38.0225 39.0 39.0 39.0 37.0 39.0 10-14 38.40095 39.4 39.2 39.4 37.2 39.4 15-19 39.626999999999995 41.0 40.0 41.0 38.0 41.0 20-24 39.59920000000001 41.0 40.0 41.0 38.0 41.0 25-29 39.479200000000006 41.0 40.0 41.0 37.8 41.0 30-34 39.365500000000004 41.0 40.0 41.0 37.6 41.0 35-39 39.2044 41.0 40.0 41.0 37.0 41.0 40-44 39.132450000000006 41.0 39.8 41.0 37.0 41.0 45-49 39.0663 41.0 39.6 41.0 36.6 41.0 50-54 38.1422 39.8 38.2 40.6 34.6 40.6 55-59 38.42525 40.0 38.2 41.0 35.0 41.0 60-64 37.8786 39.6 37.0 41.0 34.2 41.0 65-69 37.3732 39.0 36.0 40.8 34.0 41.0 70-74 36.297250000000005 37.0 35.0 39.2 33.8 41.0 75-79 35.25585 35.8 35.0 37.4 33.2 39.2 80-84 34.45575 35.0 35.0 36.2 33.0 37.4 85-89 33.9638 35.0 35.0 35.4 32.0 36.4 90-94 33.62565 35.0 34.8 35.0 32.0 36.0 95-99 33.415350000000004 35.0 34.0 35.0 31.2 35.2 100-104 33.296749999999996 35.0 34.0 35.0 31.0 35.0 105-109 33.10445 35.0 34.0 35.0 31.0 35.0 110-114 33.0096 35.0 34.0 35.0 30.2 35.0 115-119 32.8372 35.0 34.0 35.0 29.6 35.0 120-124 32.61605 35.0 33.8 35.0 29.2 35.0 125-129 32.4819 35.0 33.4 35.0 29.0 35.0 130-134 32.07225 35.0 32.8 35.0 27.0 35.0 135-139 31.6901 34.8 32.6 35.0 25.8 35.0 140-144 31.282799999999998 34.0 32.0 35.0 24.8 35.0 145-149 30.529700000000002 34.0 31.4 35.0 17.8 35.0 150 26.1835 31.0 24.0 34.0 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 37.0 3 3.0 4 0.0 5 1.0 6 2.0 7 2.0 8 2.0 9 5.0 10 1.0 11 5.0 12 4.0 13 5.0 14 1.0 15 6.0 16 0.0 17 2.0 18 4.0 19 3.0 20 6.0 21 7.0 22 7.0 23 8.0 24 10.0 25 18.0 26 23.0 27 16.0 28 20.0 29 36.0 30 38.0 31 35.0 32 88.0 33 102.0 34 183.0 35 380.0 36 1314.0 37 1603.0 38 23.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.825 17.0 12.35 30.825000000000003 2 26.1 24.175 32.975 16.75 3 21.175 26.85 32.05 19.925 4 24.325 33.375 23.375 18.925 5 25.6 35.625 22.3 16.475 6 20.724999999999998 37.125 24.575 17.575 7 19.425 22.400000000000002 40.050000000000004 18.125 8 22.6 25.3 28.599999999999998 23.5 9 23.861930965482742 23.861930965482742 30.890445222611305 21.38569284642321 10-14 24.301215060753037 28.57142857142857 26.441322066103307 20.686034301715086 15-19 23.705000000000002 28.22 27.465 20.61 20-24 23.580000000000002 27.82 28.139999999999997 20.46 25-29 24.044999999999998 27.284999999999997 27.58 21.09 30-34 23.575893973493372 27.85696424106027 27.991997999499873 20.575143785946487 35-39 22.884999999999998 28.325 28.1 20.69 40-44 23.39 27.200000000000003 28.044999999999998 21.365000000000002 45-49 23.15694708412524 27.838351505451637 28.423527058117436 20.58117435230569 50-54 23.463212124243483 27.74971239933977 28.164857700195068 20.622217776221678 55-59 24.003600540081013 27.274091113667048 28.00920138020703 20.713106966044904 60-64 23.010752688172044 27.66191547886972 28.527131782945737 20.800200050012503 65-69 23.514702940588116 27.160432086417284 29.295859171834365 20.02900580116023 70-74 23.790705817617926 27.377319793907258 28.432794757640938 20.399179630833874 75-79 23.67118355917796 27.466373318665934 28.916445822291116 19.94599729986499 80-84 24.44 27.77 27.865000000000002 19.925 85-89 23.69092273068267 27.56689172293073 28.557139284821204 20.185046261565393 90-94 23.855 27.68 28.199999999999996 20.265 95-99 23.990000000000002 27.894999999999996 28.09 20.025000000000002 100-104 24.285 26.82 28.410000000000004 20.485 105-109 24.46122306115306 26.66133306665333 28.55642782139107 20.32101605080254 110-114 24.385 27.33 28.389999999999997 19.895 115-119 25.455 27.96 27.455000000000002 19.13 120-124 25.924073425698996 27.61466513279648 27.16450757765218 19.29675386385235 125-129 26.09630481524076 27.78638931946597 26.55632781639082 19.560978048902445 130-134 26.929039355903384 27.544131619742963 27.13407011051658 18.392758913837078 135-139 27.061353067653382 27.901395069753487 26.561328066403323 18.475923796189807 140-144 27.479617866253186 27.854749162206772 26.284199469814435 18.381433501725606 145-149 28.173312653224595 28.108270375744233 25.83679391604543 17.88162305498574 150 29.422066549912433 26.920190142606952 25.494120590442833 18.16362271703778 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 1.0 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 1.5 17 1.0 18 0.5 19 0.5 20 1.5 21 1.0 22 0.5 23 3.0 24 3.5 25 2.5 26 4.5 27 5.5 28 6.5 29 8.0 30 16.5 31 23.0 32 21.0 33 31.5 34 50.5 35 72.0 36 80.5 37 95.0 38 128.0 39 161.0 40 185.5 41 218.5 42 246.5 43 266.5 44 289.0 45 266.5 46 260.5 47 275.0 48 248.5 49 204.0 50 161.0 51 137.5 52 124.5 53 101.0 54 78.0 55 54.0 56 38.5 57 32.5 58 24.0 59 16.5 60 11.0 61 9.0 62 6.5 63 6.5 64 5.5 65 2.5 66 1.5 67 1.5 68 1.5 69 1.0 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 1.0 76 1.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.05 10-14 0.005 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.025 35-39 0.0 40-44 0.0 45-49 0.03 50-54 0.034999999999999996 55-59 0.015 60-64 0.025 65-69 0.02 70-74 0.045 75-79 0.005 80-84 0.0 85-89 0.025 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.005 110-114 0.0 115-119 0.0 120-124 0.034999999999999996 125-129 0.005 130-134 0.015 135-139 0.005 140-144 0.034999999999999996 145-149 0.065 150 0.075 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67394030599448 99.35000000000001 2 0.32605969400551793 0.65 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.0875 0.0 0.0 0.0 0.0 70-71 0.1375 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.2125 0.0 0.0 0.0 0.0 80-81 0.2875 0.0 0.0 0.0 0.0 82-83 0.4125 0.0 0.0 0.0 0.0 84-85 0.55 0.0 0.0 0.0 0.0 86-87 0.6625 0.0 0.0 0.0 0.0 88-89 0.8500000000000001 0.0 0.0 0.0 0.0 90-91 1.0125 0.0 0.0 0.0 0.0 92-93 1.15 0.0 0.0 0.0 0.0 94-95 1.3875 0.0 0.0 0.0 0.0 96-97 1.6625 0.0 0.0 0.0 0.0 98-99 1.8875000000000002 0.0 0.0 0.0 0.0 100-101 2.1625 0.0 0.0 0.0 0.0 102-103 2.5125 0.0 0.0 0.0 0.0 104-105 3.1125 0.0 0.0 0.0 0.0 106-107 3.8875 0.0 0.0 0.0 0.0 108-109 4.9 0.0 0.0 0.0 0.0 110-111 5.925 0.0 0.0 0.0 0.0 112-113 6.637499999999999 0.0 0.0 0.0 0.0 114-115 7.5875 0.0 0.0 0.0 0.0 116-117 8.662500000000001 0.0 0.0 0.0 0.0 118-119 9.825 0.0 0.0 0.0 0.0 120-121 10.6625 0.0 0.0 0.0 0.0 122-123 11.7875 0.0 0.0 0.0 0.0 124-125 12.925 0.0 0.0 0.0 0.0 126-127 13.775 0.0 0.0 0.0 0.0 128-129 15.075 0.0 0.0 0.0 0.0 130-131 16.674999999999997 0.0 0.0 0.0 0.0 132-133 18.1375 0.0 0.0 0.0 0.0 134-135 19.450000000000003 0.0 0.0 0.0 0.0 136-137 20.7 0.0 0.0 0.0 0.0 138 21.75 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTCGGTG 35 0.0036813593 20.571428 140-144 >>END_MODULE Read 1505769 spots for SRR1799538.sra Written 1505769 spots for SRR1799538.sra Read 1505769 spots for SRR1799538.sra Written 1505769 spots for SRR1799538.sra Read 1505769 spots for SRR1799538.sra Written 1505769 spots for SRR1799538.sra Read 1505769 spots for SRR1799538.sra Written 1505769 spots for SRR1799538.sra Read 1505769 spots for SRR1799538.sra Written 1505769 spots for SRR1799538.sra Read 1505769 spots for SRR1799538.sra Written 1505769 spots for SRR1799538.sra Read 1505769 spots for SRR1799538.sra Written 1505769 spots for SRR1799538.sra Read 1505769 spots for SRR1799538.sra Written 1505769 spots for SRR1799538.sra Read 1505769 spots for SRR1799538.sra Written 1505769 spots for SRR1799538.sra Read 1505769 spots for SRR1799538.sra Written 1505769 spots for SRR1799538.sra Read 1505769 spots for SRR1799538.sra Written 1505769 spots for SRR1799538.sra Read 1505769 spots for SRR1799538.sra Written 1505769 spots for SRR1799538.sra Read 1505769 spots for SRR1799538.sra Written 1505769 spots for SRR1799538.sra Read 1505769 spots for SRR1799538.sra Written 1505769 spots for SRR1799538.sra Read 1505769 spots for SRR1799538.sra Written 1505769 spots for SRR1799538.sra Read 1505769 spots for SRR1799538.sra Written 1505769 spots for SRR1799538.sra Read 1505769 spots for SRR1799538.sra Written 1505769 spots for SRR1799538.sra Read 1505786 spots for SRR1799538.sra Written 1505786 spots for SRR1799538.sra Read 1505769 spots for SRR1799538.sra Written 1505769 spots for SRR1799538.sra Read 1505769 spots for SRR1799538.sra Written 1505769 spots for SRR1799538.sra SRR ids: ['SRR1799538.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_zgqo6z94 SRR1799538.sra spots: 30115397 blocks: [[1, 1505769], [1505770, 3011538], [3011539, 4517307], [4517308, 6023076], [6023077, 7528845], [7528846, 9034614], [9034615, 10540383], [10540384, 12046152], [12046153, 13551921], [13551922, 15057690], [15057691, 16563459], [16563460, 18069228], [18069229, 19574997], [19574998, 21080766], [21080767, 22586535], [22586536, 24092304], [24092305, 25598073], [25598074, 27103842], [27103843, 28609611], [28609612, 30115397]] SRR1799538 file size 10124600 SRR1799538 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR1799538 SRR1799538_1.fastq SRR1799538_2.fastq Input file: SRR1799538_1.fastq Paired file: SRR1799538_2.fastq trimmed: SRR1799538-trimmed-pair1.fastq, SRR1799538-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 21:31:36 2025 >> started Thu Feb 13 21:32:13 2025 >> done (37.234s) 30115397 read pairs processed; of these: 80790 ( 0.27%) short read pairs filtered out after trimming by size control 204473 ( 0.68%) empty read pairs filtered out after trimming by size control 29830134 (99.05%) read pairs available; of these: 13606887 (45.61%) trimmed read pairs available after processing 16223247 (54.39%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 2 0.00% 20 6 0.00% 21 18 0.00% 22 19 0.00% 23 29 0.00% 24 43 0.00% 25 53 0.00% 26 75 0.00% 27 87 0.00% 28 111 0.00% 29 142 0.00% 30 172 0.00% 31 193 0.00% 32 232 0.00% 33 292 0.00% 34 338 0.00% 35 389 0.00% 36 413 0.00% 37 494 0.00% 38 555 0.00% 39 594 0.00% 40 690 0.00% 41 702 0.00% 42 802 0.00% 43 860 0.00% 44 936 0.00% 45 1027 0.00% 46 1110 0.00% 47 1201 0.00% 48 1356 0.00% 49 1447 0.00% 50 1570 0.01% 51 1639 0.01% 52 1679 0.01% 53 1809 0.01% 54 2000 0.01% 55 2166 0.01% 56 2339 0.01% 57 2599 0.01% 58 3563 0.01% 59 3196 0.01% 60 3319 0.01% 61 3402 0.01% 62 3560 0.01% 63 3990 0.01% 64 4399 0.01% 65 4907 0.02% 66 6567 0.02% 67 6518 0.02% 68 7365 0.02% 69 7290 0.02% 70 7739 0.03% 71 8629 0.03% 72 9917 0.03% 73 11121 0.04% 74 12603 0.04% 75 14223 0.05% 76 16214 0.05% 77 16900 0.06% 78 18475 0.06% 79 19556 0.07% 80 19616 0.07% 81 17699 0.06% 82 15258 0.05% 83 14621 0.05% 84 19151 0.06% 85 20787 0.07% 86 24806 0.08% 87 30276 0.10% 88 38522 0.13% 89 33014 0.11% 90 30439 0.10% 91 33301 0.11% 92 34417 0.12% 93 43357 0.15% 94 39957 0.13% 95 40095 0.13% 96 46758 0.16% 97 49742 0.17% 98 53239 0.18% 99 66060 0.22% 100 69601 0.23% 101 59609 0.20% 102 73267 0.25% 103 75174 0.25% 104 103506 0.35% 105 127730 0.43% 106 159007 0.53% 107 134737 0.45% 108 133025 0.45% 109 145216 0.49% 110 139301 0.47% 111 116396 0.39% 112 137064 0.46% 113 159148 0.53% 114 151666 0.51% 115 212207 0.71% 116 165118 0.55% 117 181185 0.61% 118 142468 0.48% 119 165360 0.55% 120 162364 0.54% 121 203633 0.68% 122 208532 0.70% 123 201884 0.68% 124 172415 0.58% 125 151323 0.51% 126 193702 0.65% 127 205786 0.69% 128 208054 0.70% 129 238594 0.80% 130 233412 0.78% 131 241575 0.81% 132 234199 0.79% 133 248824 0.83% 134 257466 0.86% 135 258131 0.87% 136 268194 0.90% 137 271796 0.91% 138 278195 0.93% 139 286244 0.96% 140 288285 0.97% 141 294776 0.99% 142 306898 1.03% 143 320953 1.08% 144 344889 1.16% 145 375552 1.26% 146 445853 1.49% 147 519804 1.74% 148 725850 2.43% 149 1914161 6.42% 150 16223247 54.39% 29830134 reads passed initial QC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=12.66 fanout-score-rank=12 prefix-density=0.29 prefix-fanout=6.4 sequence=AAGATCAAATGC criterion=fanout-score sequence-density=0.09 sequence-density-rank=12 fanout-score=284.05 fanout-score-rank=1 prefix-density=0.84 prefix-fanout=31.0 sequence=TTCTTCTTCTTT criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=2.75 fanout-score-rank=42 prefix-density=0.17 prefix-fanout=2.4 sequence=TCTAGCTAGTGGTTTAATAAAGGATTGTTATGCTAATGGGGGTGTAGGTATGGAAATGTTCCACTTGGATCAAACCAATGCGA criterion=fanout-score sequence-density=0.09 sequence-density-rank=15 fanout-score=288.17 fanout-score-rank=1 prefix-density=0.92 prefix-fanout=28.2 sequence=AAGAAGAAGAAG SRR1799538 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 21:32:52 Started mapping on | Feb 13 21:32:52 Finished on | Feb 13 21:35:15 Mapping speed, Million of reads per hour | 750.97 Number of input reads | 29830134 Average input read length | 281 UNIQUE READS: Uniquely mapped reads number | 28873527 Uniquely mapped reads % | 96.79% Average mapped length | 281.32 Number of splices: Total | 24927709 Number of splices: Annotated (sjdb) | 24503213 Number of splices: GT/AG | 24524877 Number of splices: GC/AG | 311712 Number of splices: AT/AC | 22574 Number of splices: Non-canonical | 68546 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.03% Deletion average length | 2.52 Insertion rate per base | 0.02% Insertion average length | 2.30 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 581781 % of reads mapped to multiple loci | 1.95% Number of reads mapped to too many loci | 32202 % of reads mapped to too many loci | 0.11% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.12% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 395621 395621 395621 N_multimapping 581781 581781 581781 N_noFeature 851338 28522210 1048406 N_ambiguous 259509 1236 104449 UnstrandedReadsAssigned:27762680 PositiveStrandReadsAssigned:350081 NegativeStrandReadsAssigned:27720672 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=133 echo kmer=129 SRR1799538 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR1799538-trimmed-pair1.fastq SRR1799538-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 29,830,134 reads, 27,621,366 reads pseudoaligned [quant] estimated average fragment length: 179.918 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,285 rounds 52401 SRR1799538.ke.tsv 34699 SRR1799538.se.tsv 87100 total ==> SRR1799538.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1839.08 592 12.9855 Potri.005G024800.1.v4.1 1035 856.082 67 3.15717 Potri.004G059700.1.v4.1 961 782.088 26 1.34109 Potri.007G009000.2.v4.1 1416 1237.08 0 0 Potri.003G141000.2.v4.1 2943 2764.08 434.089 6.33529 Potri.016G087400.1.v4.1 270 107.545 3200 1200.32 Potri.015G069301.1.v4.1 564 385.661 0 0 Potri.010G195200.1.v4.1 1773 1594.08 171.874 4.34949 Potri.012G127500.1.v4.1 977 798.088 14368 726.247 ==> SRR1799538.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2351 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 564 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR1799538 completed mapping pipeline successfully