Starting /dee2/code/volunteer_pipeline.sh SRR1799539 current disk space = 3088204615680 free memory = 1447460364 SRR1799539 SRAfilesize a4b322cf3ca54a6c536752768a71df87 SRR1799539.sra SRR1799539.sra file validated SRR1799539 is paired end SRR1799539 is conventional basespace SRR1799539 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR1799539_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.0855 34.0 34.0 34.0 31.0 34.0 2 33.38525 34.0 34.0 34.0 31.0 34.0 3 33.58375 34.0 34.0 34.0 33.0 34.0 4 36.7835 37.0 37.0 37.0 37.0 37.0 5 36.71925 37.0 37.0 37.0 35.0 37.0 6 36.76675 37.0 37.0 37.0 37.0 37.0 7 36.76875 37.0 37.0 37.0 37.0 37.0 8 36.72875 37.0 37.0 37.0 37.0 37.0 9 38.708 39.0 39.0 39.0 39.0 39.0 10-14 39.03385 39.4 39.4 39.4 38.6 39.4 15-19 40.459649999999996 41.0 41.0 41.0 39.2 41.0 20-24 40.3993 41.0 40.6 41.0 39.0 41.0 25-29 40.302049999999994 41.0 40.0 41.0 39.0 41.0 30-34 40.18879999999999 41.0 40.0 41.0 38.8 41.0 35-39 40.01195 41.0 40.0 41.0 38.0 41.0 40-44 40.0445 41.0 40.0 41.0 38.0 41.0 45-49 40.131899999999995 41.0 40.0 41.0 38.2 41.0 50-54 39.9699 41.0 40.0 41.0 37.6 41.0 55-59 39.609500000000004 41.0 39.4 41.0 36.6 41.0 60-64 39.156349999999996 40.6 38.8 41.0 35.2 41.0 65-69 38.4534 39.4 36.8 41.0 35.0 41.0 70-74 37.42315 37.8 35.6 39.8 35.0 41.0 75-79 35.95725 36.0 34.8 37.6 33.8 39.4 80-84 35.510000000000005 35.4 35.0 36.6 34.2 38.0 85-89 34.92815 35.0 35.0 35.8 34.0 36.6 90-94 34.607749999999996 35.0 35.0 35.0 34.0 36.0 95-99 34.46665 35.0 35.0 35.0 34.0 35.4 100-104 34.38844999999999 35.0 35.0 35.0 34.0 35.0 105-109 34.3163 35.0 35.0 35.0 33.6 35.0 110-114 34.188500000000005 35.0 35.0 35.0 33.0 35.0 115-119 34.11725 35.0 35.0 35.0 33.0 35.0 120-124 33.97085 35.0 34.4 35.0 33.0 35.0 125-129 33.782050000000005 35.0 34.0 35.0 32.2 35.0 130-134 33.562549999999995 35.0 34.0 35.0 31.8 35.0 135-139 33.428999999999995 35.0 34.0 35.0 31.0 35.0 140-144 33.10105 35.0 34.0 35.0 30.6 35.0 145-149 32.404399999999995 35.0 33.4 35.0 29.6 35.0 150 28.24475 32.0 27.0 34.0 17.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 1.0 11 2.0 12 2.0 13 0.0 14 0.0 15 2.0 16 1.0 17 2.0 18 2.0 19 2.0 20 5.0 21 3.0 22 3.0 23 3.0 24 4.0 25 4.0 26 4.0 27 14.0 28 21.0 29 9.0 30 14.0 31 31.0 32 49.0 33 48.0 34 96.0 35 232.0 36 1020.0 37 2397.0 38 28.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.4363912823112 11.125190065889507 6.436898124683224 39.00152052711607 2 23.025000000000002 12.65 35.449999999999996 28.875 3 19.425 15.85 27.525 37.2 4 24.4 24.675 23.125 27.800000000000004 5 23.525 30.725 24.625 21.125 6 19.675 34.425 25.25 20.65 7 14.399999999999999 28.025 38.9 18.675 8 17.549999999999997 24.975 31.95 25.525 9 17.1 23.799999999999997 34.325 24.775 10-14 19.91 29.805 27.794999999999998 22.49 15-19 20.1 28.754999999999995 27.389999999999997 23.755000000000003 20-24 19.485 29.09 28.04 23.385 25-29 20.215 29.125 27.6 23.06 30-34 20.36 28.37 27.46 23.810000000000002 35-39 19.97 29.235 27.58 23.215 40-44 20.205000000000002 29.215000000000003 27.275 23.305 45-49 20.16 28.64 27.18 24.02 50-54 20.26 29.104999999999997 27.185 23.45 55-59 20.505000000000003 28.775000000000002 27.55 23.169999999999998 60-64 20.330000000000002 28.444999999999997 26.945000000000004 24.279999999999998 65-69 20.29 28.915000000000003 27.139999999999997 23.655 70-74 20.28 28.525 27.284999999999997 23.91 75-79 20.04803122029319 28.21834192224946 27.45784760094061 24.275779256516735 80-84 19.58891778355671 29.575915183036606 27.385477095419088 23.449689937987596 85-89 20.262026202620262 28.797879787978797 26.927692769276927 24.012401240124014 90-94 20.76849952469105 28.238354930704958 27.10761995296943 23.88552559163456 95-99 20.20813528793716 28.348426477210186 27.607945164356835 23.835493070495822 100-104 20.821451798489168 28.370603832107662 27.465105808194508 23.342838561208666 105-109 20.413268624605994 28.658628108270374 27.35778255866313 23.5703207084605 110-114 21.26200960768615 28.02742193755004 27.311849479583667 23.398718975180145 115-119 20.758493020463302 29.469154950717968 25.92685245409516 23.84549957472357 120-124 20.768115217282592 28.899334900235036 26.71900785117768 23.613542031304696 125-129 21.33 28.025 26.584999999999997 24.060000000000002 130-134 20.744148829765955 29.15083016603321 26.04020804160832 24.06481296259252 135-139 21.1848293805664 28.314820374261984 25.93315320724507 24.56719703792655 140-144 20.9781467220083 29.014352152822926 26.043906585987898 23.96359453918088 145-149 20.695 28.945 25.275 25.085 150 19.05 28.799999999999997 26.825 25.324999999999996 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 2.5 26 3.5 27 4.5 28 7.0 29 9.0 30 15.5 31 23.5 32 32.0 33 48.0 34 58.5 35 68.0 36 80.0 37 95.5 38 125.5 39 154.5 40 181.5 41 212.5 42 240.5 43 253.0 44 270.0 45 296.0 46 282.0 47 262.5 48 244.0 49 204.0 50 183.0 51 146.0 52 109.0 53 94.0 54 76.0 55 61.0 56 40.5 57 27.0 58 22.0 59 16.5 60 11.5 61 8.0 62 7.5 63 7.5 64 4.5 65 3.0 66 3.5 67 2.5 68 1.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.35 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.065 80-84 0.02 85-89 0.01 90-94 0.065 95-99 0.065 100-104 0.055 105-109 0.065 110-114 0.08 115-119 0.065 120-124 0.015 125-129 0.0 130-134 0.02 135-139 0.06999999999999999 140-144 0.015 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72424166457759 99.45 2 0.2757583354224116 0.5499999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.175 0.0 0.0 0.0 0.0 78-79 0.25 0.0 0.0 0.0 0.0 80-81 0.3125 0.0 0.0 0.0 0.0 82-83 0.325 0.0 0.0 0.0 0.0 84-85 0.325 0.0 0.0 0.0 0.0 86-87 0.325 0.0 0.0 0.0 0.0 88-89 0.35 0.0 0.0 0.0 0.0 90-91 0.47500000000000003 0.0 0.0 0.0 0.0 92-93 0.8625 0.0 0.0 0.0 0.0 94-95 1.0375 0.0 0.0 0.0 0.0 96-97 1.4874999999999998 0.0 0.0 0.0 0.0 98-99 1.8125 0.0 0.0 0.0 0.0 100-101 2.075 0.0 0.0 0.0 0.0 102-103 2.3875 0.0 0.0 0.0 0.0 104-105 2.6375 0.0 0.0 0.0 0.0 106-107 3.325 0.0 0.0 0.0 0.0 108-109 4.2 0.0 0.0 0.0 0.0 110-111 4.925000000000001 0.0 0.0 0.0 0.0 112-113 5.387499999999999 0.0 0.0 0.0 0.0 114-115 5.7125 0.0 0.0 0.0 0.0 116-117 6.6375 0.0 0.0 0.0 0.0 118-119 6.949999999999999 0.0 0.0 0.0 0.0 120-121 7.637499999999999 0.0 0.0 0.0 0.0 122-123 8.587499999999999 0.0 0.0 0.0 0.0 124-125 9.399999999999999 0.0 0.0 0.0 0.0 126-127 10.5125 0.0 0.0 0.0 0.0 128-129 11.375 0.0 0.0 0.0 0.0 130-131 12.350000000000001 0.0 0.0 0.0 0.0 132-133 13.5 0.0 0.0 0.0 0.0 134-135 14.8625 0.0 0.0 0.0 0.0 136-137 16.225 0.0 0.0 0.0 0.0 138 17.125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAATCAC 10 0.0069754543 143.9875 5 >>END_MODULE SRR1799539 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR1799539_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.09675 34.0 33.0 34.0 31.0 34.0 2 33.2525 34.0 34.0 34.0 31.0 34.0 3 33.289 34.0 34.0 34.0 31.0 34.0 4 36.442 37.0 37.0 37.0 35.0 37.0 5 36.47325 37.0 37.0 37.0 37.0 37.0 6 36.50925 37.0 37.0 37.0 37.0 37.0 7 36.45175 37.0 37.0 37.0 37.0 37.0 8 36.4685 37.0 37.0 37.0 37.0 37.0 9 38.323 39.0 39.0 39.0 38.0 39.0 10-14 38.661950000000004 39.4 39.4 39.4 38.2 39.4 15-19 40.0287 41.0 40.8 41.0 39.0 41.0 20-24 39.98805 41.0 40.4 41.0 39.0 41.0 25-29 39.912099999999995 41.0 40.0 41.0 38.8 41.0 30-34 39.767849999999996 41.0 40.0 41.0 38.0 41.0 35-39 39.6501 41.0 40.0 41.0 38.0 41.0 40-44 39.5477 41.0 40.0 41.0 38.0 41.0 45-49 39.4805 41.0 40.0 41.0 37.6 41.0 50-54 38.69515 40.2 38.8 40.6 36.0 40.8 55-59 38.980050000000006 41.0 39.0 41.0 35.8 41.0 60-64 38.3881 40.0 37.6 41.0 35.0 41.0 65-69 37.846500000000006 39.0 36.4 41.0 35.0 41.0 70-74 36.79105 37.4 35.2 39.6 34.8 41.0 75-79 35.75525 36.2 35.0 37.8 34.0 39.2 80-84 34.907000000000004 35.2 35.0 36.4 34.0 37.4 85-89 34.32475 35.0 35.0 35.6 33.8 36.4 90-94 34.063100000000006 35.0 35.0 35.0 33.6 36.0 95-99 33.9114 35.0 35.0 35.0 33.0 35.4 100-104 33.7636 35.0 35.0 35.0 33.0 35.0 105-109 33.70455 35.0 35.0 35.0 32.8 35.0 110-114 33.55050000000001 35.0 35.0 35.0 32.2 35.0 115-119 33.40945 35.0 34.0 35.0 31.6 35.0 120-124 33.2635 35.0 34.0 35.0 31.0 35.0 125-129 33.197799999999994 35.0 34.0 35.0 31.0 35.0 130-134 32.9156 35.0 34.0 35.0 30.0 35.0 135-139 32.6383 35.0 33.8 35.0 29.2 35.0 140-144 32.197500000000005 35.0 33.0 35.0 28.2 35.0 145-149 31.514000000000003 35.0 33.0 35.0 25.8 35.0 150 27.1995 31.0 25.0 34.0 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 30.0 3 2.0 4 2.0 5 3.0 6 1.0 7 1.0 8 3.0 9 3.0 10 4.0 11 2.0 12 1.0 13 4.0 14 2.0 15 1.0 16 3.0 17 4.0 18 3.0 19 2.0 20 1.0 21 7.0 22 3.0 23 6.0 24 5.0 25 7.0 26 10.0 27 5.0 28 17.0 29 17.0 30 24.0 31 33.0 32 47.0 33 61.0 34 142.0 35 285.0 36 1159.0 37 2051.0 38 49.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.675 20.05 10.75 30.525000000000002 2 24.925 27.650000000000002 32.25 15.174999999999999 3 21.275 26.974999999999998 30.125 21.625 4 23.575 32.7 24.15 19.575 5 25.1 37.075 21.525 16.3 6 20.025000000000002 39.525 22.8 17.65 7 20.455113778444613 21.50537634408602 39.6099024756189 18.42960740185046 8 21.275 23.825 30.425 24.474999999999998 9 24.06805103827871 22.692019014260694 29.997498123592692 23.2424318238679 10-14 24.191047761940485 28.512128032008 26.756689172293076 20.54013503375844 15-19 24.14 27.37 27.73 20.76 20-24 22.86 28.49 27.6 21.05 25-29 22.80114005700285 28.496424821241064 28.196409820491024 20.506025301265062 30-34 23.6168084042021 27.483741870935468 28.3791895947974 20.520260130065033 35-39 23.155 27.51 28.32 21.015 40-44 24.121206060303017 27.74638731936597 27.67138356917846 20.46102305115256 45-49 23.892919689767325 27.30047535651739 28.19614711033275 20.610457843382537 50-54 22.963778266960176 28.201921152691618 28.10686411847108 20.727436461877126 55-59 23.390847711927982 27.556889222305575 28.237059264816207 20.81520380095024 60-64 23.281640820410203 27.85892946473237 28.634317158579293 20.225112556278138 65-69 23.369021412847708 27.54652791675005 28.77226335801481 20.312187312387433 70-74 24.164331465172136 27.04163330664532 28.467774219375503 20.326261008807045 75-79 23.41936774709884 27.926170468187273 28.206282513005203 20.448179271708682 80-84 23.585 27.965 27.975 20.474999999999998 85-89 23.5029266096353 27.50512782030117 28.175496523087702 20.816449046975837 90-94 23.880000000000003 27.685 28.22 20.215 95-99 23.57 27.810000000000002 28.12 20.5 100-104 24.9 27.51 28.095 19.495 105-109 24.237271181354405 27.788336500950283 27.953386015804742 20.02100630189057 110-114 24.377437743774376 27.487748774877485 27.45274527452745 20.68206820682068 115-119 24.865000000000002 28.435 27.250000000000004 19.45 120-124 25.581511680256114 27.2822770246611 27.012155469961485 20.124055825121303 125-129 25.430172068827535 27.501000400160063 27.58603441376551 19.4827931172469 130-134 26.67433601760616 28.12484369529335 26.00910318611514 19.191717100985343 135-139 26.85671417854464 27.47186796699175 26.926731682920728 18.744686171542885 140-144 26.771417133706965 28.39271417133707 25.88070456365092 18.955164131305043 145-149 27.381011961363296 27.606225914618886 25.66938591662079 19.34337620739703 150 28.053053053053052 27.902902902902905 25.675675675675674 18.36836836836837 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.5 22 2.0 23 1.0 24 2.0 25 1.5 26 2.5 27 8.5 28 10.5 29 11.5 30 16.5 31 16.0 32 22.5 33 35.0 34 44.5 35 56.5 36 77.5 37 96.5 38 121.5 39 162.0 40 206.5 41 232.5 42 241.5 43 260.5 44 281.0 45 302.0 46 299.0 47 271.5 48 240.0 49 196.5 50 157.5 51 139.0 52 118.5 53 88.0 54 72.5 55 54.5 56 38.5 57 32.0 58 20.5 59 13.5 60 10.5 61 8.0 62 4.5 63 4.5 64 5.5 65 4.0 66 1.5 67 1.0 68 0.5 69 0.0 70 0.5 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.025 8 0.0 9 0.075 10-14 0.025 15-19 0.0 20-24 0.0 25-29 0.005 30-34 0.05 35-39 0.0 40-44 0.005 45-49 0.075 50-54 0.06 55-59 0.025 60-64 0.05 65-69 0.06 70-74 0.08 75-79 0.04 80-84 0.0 85-89 0.055 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.03 110-114 0.01 115-119 0.0 120-124 0.045 125-129 0.04 130-134 0.034999999999999996 135-139 0.025 140-144 0.08 145-149 0.095 150 0.1 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67394030599448 99.35000000000001 2 0.32605969400551793 0.65 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.175 0.0 0.0 0.0 0.0 78-79 0.25 0.0 0.0 0.0 0.0 80-81 0.3375 0.0 0.0 0.0 0.0 82-83 0.35 0.0 0.0 0.0 0.0 84-85 0.35 0.0 0.0 0.0 0.0 86-87 0.35 0.0 0.0 0.0 0.0 88-89 0.375 0.0 0.0 0.0 0.0 90-91 0.5 0.0 0.0 0.0 0.0 92-93 0.8875 0.0 0.0 0.0 0.0 94-95 1.0625 0.0 0.0 0.0 0.0 96-97 1.5125000000000002 0.0 0.0 0.0 0.0 98-99 1.8375 0.0 0.0 0.0 0.0 100-101 2.1 0.0 0.0 0.0 0.0 102-103 2.4125 0.0 0.0 0.0 0.0 104-105 2.6875 0.0 0.0 0.0 0.0 106-107 3.375 0.0 0.0 0.0 0.0 108-109 4.25 0.0 0.0 0.0 0.0 110-111 4.975 0.0 0.0 0.0 0.0 112-113 5.4375 0.0 0.0 0.0 0.0 114-115 5.7375 0.0 0.0 0.0 0.0 116-117 6.6375 0.0 0.0 0.0 0.0 118-119 6.949999999999999 0.0 0.0 0.0 0.0 120-121 7.65 0.0 0.0 0.0 0.0 122-123 8.6125 0.0 0.0 0.0 0.0 124-125 9.45 0.0 0.0 0.0 0.0 126-127 10.5625 0.0 0.0 0.0 0.0 128-129 11.425 0.0 0.0 0.0 0.0 130-131 12.425 0.0 0.0 0.0 0.0 132-133 13.6 0.0 0.0 0.0 0.0 134-135 14.9875 0.0 0.0 0.0 0.0 136-137 16.4 0.0 0.0 0.0 0.0 138 17.3 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CACAAAA 10 0.006973645 144.0 9 CGGGAAT 10 0.006973645 144.0 1 TCACAAA 10 0.006973645 144.0 8 >>END_MODULE Read 1167843 spots for SRR1799539.sra Written 1167843 spots for SRR1799539.sra Read 1167843 spots for SRR1799539.sra Written 1167843 spots for SRR1799539.sra Read 1167843 spots for SRR1799539.sra Written 1167843 spots for SRR1799539.sra Read 1167843 spots for SRR1799539.sra Written 1167843 spots for SRR1799539.sra Read 1167843 spots for SRR1799539.sra Written 1167843 spots for SRR1799539.sra Read 1167843 spots for SRR1799539.sra Written 1167843 spots for SRR1799539.sra Read 1167843 spots for SRR1799539.sra Written 1167843 spots for SRR1799539.sra Read 1167843 spots for SRR1799539.sra Written 1167843 spots for SRR1799539.sra Read 1167843 spots for SRR1799539.sra Written 1167843 spots for SRR1799539.sra Read 1167851 spots for SRR1799539.sra Written 1167851 spots for SRR1799539.sra Read 1167843 spots for SRR1799539.sra Written 1167843 spots for SRR1799539.sra Read 1167843 spots for SRR1799539.sra Written 1167843 spots for SRR1799539.sra Read 1167843 spots for SRR1799539.sra Written 1167843 spots for SRR1799539.sra Read 1167843 spots for SRR1799539.sra Written 1167843 spots for SRR1799539.sra Read 1167843 spots for SRR1799539.sra Written 1167843 spots for SRR1799539.sra Read 1167843 spots for SRR1799539.sra Written 1167843 spots for SRR1799539.sra Read 1167843 spots for SRR1799539.sra Written 1167843 spots for SRR1799539.sra Read 1167843 spots for SRR1799539.sra Written 1167843 spots for SRR1799539.sra Read 1167843 spots for SRR1799539.sra Written 1167843 spots for SRR1799539.sra Read 1167843 spots for SRR1799539.sra Written 1167843 spots for SRR1799539.sra SRR ids: ['SRR1799539.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ca88b3o_ SRR1799539.sra spots: 23356868 blocks: [[1, 1167843], [1167844, 2335686], [2335687, 3503529], [3503530, 4671372], [4671373, 5839215], [5839216, 7007058], [7007059, 8174901], [8174902, 9342744], [9342745, 10510587], [10510588, 11678430], [11678431, 12846273], [12846274, 14014116], [14014117, 15181959], [15181960, 16349802], [16349803, 17517645], [17517646, 18685488], [18685489, 19853331], [19853332, 21021174], [21021175, 22189017], [22189018, 23356868]] SRR1799539 file size 7847556 SRR1799539 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR1799539 SRR1799539_1.fastq SRR1799539_2.fastq Input file: SRR1799539_1.fastq Paired file: SRR1799539_2.fastq trimmed: SRR1799539-trimmed-pair1.fastq, SRR1799539-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 21:13:21 2025 >> started Thu Feb 13 21:13:50 2025 >> done (29.429s) 23356868 read pairs processed; of these: 67309 ( 0.29%) short read pairs filtered out after trimming by size control 194522 ( 0.83%) empty read pairs filtered out after trimming by size control 23095037 (98.88%) read pairs available; of these: 9594271 (41.54%) trimmed read pairs available after processing 13500766 (58.46%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 2 0.00% 20 5 0.00% 21 8 0.00% 22 18 0.00% 23 18 0.00% 24 25 0.00% 25 34 0.00% 26 34 0.00% 27 49 0.00% 28 66 0.00% 29 94 0.00% 30 93 0.00% 31 114 0.00% 32 143 0.00% 33 161 0.00% 34 186 0.00% 35 231 0.00% 36 245 0.00% 37 261 0.00% 38 300 0.00% 39 346 0.00% 40 409 0.00% 41 441 0.00% 42 468 0.00% 43 501 0.00% 44 540 0.00% 45 559 0.00% 46 705 0.00% 47 701 0.00% 48 755 0.00% 49 862 0.00% 50 909 0.00% 51 952 0.00% 52 1015 0.00% 53 1046 0.00% 54 1224 0.01% 55 1239 0.01% 56 1408 0.01% 57 1622 0.01% 58 1889 0.01% 59 3515 0.02% 60 2171 0.01% 61 2097 0.01% 62 2307 0.01% 63 2548 0.01% 64 2920 0.01% 65 3268 0.01% 66 3374 0.01% 67 4901 0.02% 68 5237 0.02% 69 4916 0.02% 70 4980 0.02% 71 5772 0.02% 72 6334 0.03% 73 7187 0.03% 74 8097 0.04% 75 8997 0.04% 76 10128 0.04% 77 10741 0.05% 78 11654 0.05% 79 11593 0.05% 80 10803 0.05% 81 8198 0.04% 82 7487 0.03% 83 7017 0.03% 84 11735 0.05% 85 12386 0.05% 86 13627 0.06% 87 16188 0.07% 88 20554 0.09% 89 25958 0.11% 90 35047 0.15% 91 45192 0.20% 92 24679 0.11% 93 24031 0.10% 94 43896 0.19% 95 51993 0.23% 96 40801 0.18% 97 54268 0.23% 98 38890 0.17% 99 31218 0.14% 100 40383 0.17% 101 79719 0.35% 102 47338 0.20% 103 37603 0.16% 104 65698 0.28% 105 88011 0.38% 106 80622 0.35% 107 114485 0.50% 108 109984 0.48% 109 95995 0.42% 110 103519 0.45% 111 80461 0.35% 112 91612 0.40% 113 72210 0.31% 114 67840 0.29% 115 145342 0.63% 116 89522 0.39% 117 63332 0.27% 118 100551 0.44% 119 118737 0.51% 120 98673 0.43% 121 136202 0.59% 122 123560 0.54% 123 117496 0.51% 124 125509 0.54% 125 145385 0.63% 126 126220 0.55% 127 126075 0.55% 128 147835 0.64% 129 154183 0.67% 130 147955 0.64% 131 153692 0.67% 132 185860 0.80% 133 187451 0.81% 134 178400 0.77% 135 190522 0.82% 136 192410 0.83% 137 196237 0.85% 138 200403 0.87% 139 207051 0.90% 140 209105 0.91% 141 214488 0.93% 142 222660 0.96% 143 233637 1.01% 144 251570 1.09% 145 273420 1.18% 146 316626 1.37% 147 395439 1.71% 148 533731 2.31% 149 1443129 6.25% 150 13500766 58.46% 23095037 reads passed initial QC criterion=sequence-density sequence-density=0.13 sequence-density-rank=1 fanout-score=6.73 fanout-score-rank=21 prefix-density=0.24 prefix-fanout=3.7 sequence=TCCTTGTCCTGGATCTTGGCCTT criterion=fanout-score sequence-density=0.09 sequence-density-rank=25 fanout-score=281.56 fanout-score-rank=1 prefix-density=0.83 prefix-fanout=29.6 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=2.56 fanout-score-rank=38 prefix-density=0.15 prefix-fanout=2.3 sequence=CCAGACCAGCAGAGG criterion=fanout-score sequence-density=0.09 sequence-density-rank=23 fanout-score=276.32 fanout-score-rank=1 prefix-density=0.87 prefix-fanout=28.9 sequence=AAGAAGAAGAAA SRR1799539 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 21:14:33 Started mapping on | Feb 13 21:14:34 Finished on | Feb 13 21:16:13 Mapping speed, Million of reads per hour | 839.82 Number of input reads | 23095037 Average input read length | 284 UNIQUE READS: Uniquely mapped reads number | 22426907 Uniquely mapped reads % | 97.11% Average mapped length | 283.39 Number of splices: Total | 19721630 Number of splices: Annotated (sjdb) | 19365315 Number of splices: GT/AG | 19413845 Number of splices: GC/AG | 243677 Number of splices: AT/AC | 19526 Number of splices: Non-canonical | 44582 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.03% Deletion average length | 2.75 Insertion rate per base | 0.02% Insertion average length | 2.33 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 446337 % of reads mapped to multiple loci | 1.93% Number of reads mapped to too many loci | 28466 % of reads mapped to too many loci | 0.12% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.80% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 242498 242498 242498 N_multimapping 446337 446337 446337 N_noFeature 708551 22163343 853832 N_ambiguous 209001 1703 89514 UnstrandedReadsAssigned:21509355 PositiveStrandReadsAssigned:261861 NegativeStrandReadsAssigned:21483561 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=140 echo kmer=135 SRR1799539 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR1799539-trimmed-pair1.fastq SRR1799539-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,095,037 reads, 21,411,966 reads pseudoaligned [quant] estimated average fragment length: 188.081 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,142 rounds 52401 SRR1799539.ke.tsv 34699 SRR1799539.se.tsv 87100 total ==> SRR1799539.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1830.92 538 15.908 Potri.005G024800.1.v4.1 1035 847.919 37 2.36238 Potri.004G059700.1.v4.1 961 773.926 20 1.39905 Potri.007G009000.2.v4.1 1416 1228.92 0 0 Potri.003G141000.2.v4.1 2943 2755.92 422.225 8.2943 Potri.016G087400.1.v4.1 270 102.414 2356 1245.43 Potri.015G069301.1.v4.1 564 377.637 0 0 Potri.010G195200.1.v4.1 1773 1585.92 133 4.54018 Potri.012G127500.1.v4.1 977 789.926 8856 606.951 ==> SRR1799539.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2215 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 422 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 20 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR1799539 completed mapping pipeline successfully