Starting /dee2/code/volunteer_pipeline.sh SRR1799540 current disk space = 3088224702464 free memory = 1512583412 SRR1799540 SRAfilesize 53771f97a2e5524de8b8ebdcf3f4a8d2 SRR1799540.sra SRR1799540.sra file validated SRR1799540 is paired end SRR1799540 is conventional basespace SRR1799540 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR1799540_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.26775 34.0 34.0 34.0 31.0 34.0 2 32.845 34.0 34.0 34.0 31.0 34.0 3 33.3735 34.0 34.0 34.0 31.0 34.0 4 36.62375 37.0 37.0 37.0 35.0 37.0 5 36.68275 37.0 37.0 37.0 35.0 37.0 6 36.7325 37.0 37.0 37.0 37.0 37.0 7 36.68925 37.0 37.0 37.0 36.0 37.0 8 36.718 37.0 37.0 37.0 36.0 37.0 9 38.60925 39.0 39.0 39.0 38.0 39.0 10-14 38.9848 39.4 39.4 39.4 38.2 39.4 15-19 40.3158 41.0 40.0 41.0 39.0 41.0 20-24 40.268449999999994 41.0 40.0 41.0 39.0 41.0 25-29 40.189 41.0 40.0 41.0 38.6 41.0 30-34 40.07525 41.0 40.0 41.0 38.0 41.0 35-39 39.9434 41.0 40.0 41.0 38.0 41.0 40-44 39.74565 41.0 40.0 41.0 38.0 41.0 45-49 39.5673 41.0 40.0 41.0 37.0 41.0 50-54 39.30219999999999 40.8 39.2 41.0 36.0 41.0 55-59 39.0238 40.2 38.8 41.0 35.4 41.0 60-64 38.82275 40.0 38.0 41.0 35.0 41.0 65-69 38.1688 39.2 36.6 41.0 35.0 41.0 70-74 37.1195 37.6 35.4 39.6 34.6 41.0 75-79 35.82295 36.2 34.8 37.8 33.4 39.2 80-84 35.2137 35.2 35.0 36.6 34.0 37.8 85-89 34.597249999999995 35.0 35.0 35.8 33.6 36.6 90-94 34.33990000000001 35.0 35.0 35.0 33.6 36.0 95-99 34.17685 35.0 35.0 35.0 33.0 35.6 100-104 34.0082 35.0 35.0 35.0 33.0 35.0 105-109 33.874249999999996 35.0 35.0 35.0 33.0 35.0 110-114 33.79795 35.0 35.0 35.0 32.8 35.0 115-119 33.67275 35.0 34.0 35.0 32.0 35.0 120-124 33.5326 35.0 34.0 35.0 32.0 35.0 125-129 33.3441 35.0 34.0 35.0 31.2 35.0 130-134 33.0421 35.0 34.0 35.0 30.4 35.0 135-139 32.8915 35.0 34.0 35.0 29.8 35.0 140-144 32.48270000000001 35.0 33.6 35.0 29.0 35.0 145-149 30.9514 35.0 32.4 35.0 18.8 35.0 150 24.768 32.0 17.0 35.0 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 3.0 9 2.0 10 3.0 11 3.0 12 3.0 13 2.0 14 2.0 15 0.0 16 1.0 17 4.0 18 8.0 19 5.0 20 5.0 21 4.0 22 8.0 23 10.0 24 6.0 25 14.0 26 15.0 27 10.0 28 12.0 29 15.0 30 28.0 31 40.0 32 57.0 33 75.0 34 136.0 35 307.0 36 1205.0 37 1977.0 38 40.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.753510140405616 10.9204368174727 7.306292251690068 44.01976079043162 2 21.401752190237797 15.068836045056319 35.89486858573216 27.63454317897372 3 19.125 17.0 25.35 38.525 4 22.063611319809667 25.494615577260205 21.788129226145756 30.65364387678437 5 23.1 32.300000000000004 23.025000000000002 21.575 6 19.55 36.025 22.5 21.925 7 13.900000000000002 29.075 38.574999999999996 18.45 8 16.975 26.8 33.25 22.975 9 16.575 26.275 34.0 23.150000000000002 10-14 19.275000000000002 31.130000000000003 26.75 22.845 15-19 19.53 28.9 26.99 24.58 20-24 19.405 29.805 27.105 23.685000000000002 25-29 19.705000000000002 30.209999999999997 26.97 23.115 30-34 19.63 29.385 27.305 23.68 35-39 19.689999999999998 29.67 27.075 23.565 40-44 19.39 30.035 26.784999999999997 23.79 45-49 19.52 29.544999999999998 27.015 23.919999999999998 50-54 19.43 28.955 27.584999999999997 24.03 55-59 20.175 29.29 27.245 23.29 60-64 19.965 29.099999999999998 26.919999999999998 24.015 65-69 19.835 29.29 27.13 23.745 70-74 20.369999999999997 29.375 27.26 22.994999999999997 75-79 19.96 28.705000000000002 27.560000000000002 23.775 80-84 19.74 29.494999999999997 26.840000000000003 23.925 85-89 20.419999999999998 29.134999999999998 26.895000000000003 23.549999999999997 90-94 19.8 29.075 27.295 23.830000000000002 95-99 19.74 28.53 27.800000000000004 23.93 100-104 20.265 28.544999999999998 27.82 23.369999999999997 105-109 20.815 28.860000000000003 27.0 23.325000000000003 110-114 20.419999999999998 29.354999999999997 26.525 23.7 115-119 20.525 29.375 26.3 23.799999999999997 120-124 20.84 28.67 26.784999999999997 23.705000000000002 125-129 21.005 28.735 26.39 23.87 130-134 21.455 29.099999999999998 25.96 23.485 135-139 21.54 29.595 25.28 23.585 140-144 21.18 30.270000000000003 24.42 24.13 145-149 20.615 30.314999999999998 23.61 25.46 150 18.72169099144439 30.47307498741822 25.13839959738299 25.666834423754402 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.5 22 1.0 23 0.5 24 1.0 25 2.5 26 4.5 27 5.5 28 7.0 29 14.5 30 22.5 31 30.5 32 41.0 33 45.5 34 45.5 35 67.0 36 103.5 37 132.5 38 150.0 39 174.0 40 191.0 41 213.5 42 245.5 43 253.0 44 265.0 45 251.0 46 245.5 47 255.5 48 240.0 49 210.5 50 172.0 51 138.0 52 109.0 53 89.0 54 75.0 55 53.5 56 34.5 57 28.5 58 23.5 59 19.5 60 10.0 61 6.0 62 4.5 63 3.5 64 4.5 65 2.5 66 1.0 67 0.5 68 1.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.85 2 0.125 3 0.0 4 0.17500000000000002 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.65 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77443609022556 99.52499999999999 2 0.20050125313283207 0.4 3 0.02506265664160401 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0125 0.0 66-67 0.075 0.0 0.0 0.025 0.0 68-69 0.1 0.0 0.0 0.025 0.0 70-71 0.1125 0.0 0.0 0.025 0.0 72-73 0.1875 0.0 0.0 0.025 0.0 74-75 0.225 0.0 0.0 0.025 0.0 76-77 0.3375 0.0 0.0 0.025 0.0 78-79 0.3875 0.0 0.0 0.025 0.0 80-81 0.4 0.0 0.0 0.025 0.0 82-83 0.42500000000000004 0.0 0.0 0.025 0.0 84-85 0.5125 0.0 0.0 0.025 0.0 86-87 0.6875 0.0 0.0 0.025 0.0 88-89 0.7375 0.0 0.0 0.025 0.0 90-91 0.8375 0.0 0.0 0.025 0.0 92-93 1.0 0.0 0.0 0.025 0.0 94-95 1.075 0.0 0.0 0.025 0.0 96-97 1.25 0.0 0.0 0.025 0.0 98-99 1.55 0.0 0.0 0.025 0.0 100-101 1.7625000000000002 0.0 0.0 0.025 0.0 102-103 2.0875 0.0 0.0 0.025 0.0 104-105 2.725 0.0 0.0 0.025 0.0 106-107 3.0125 0.0 0.0 0.025 0.0 108-109 3.5125 0.0 0.0 0.025 0.0 110-111 3.9875000000000003 0.0 0.0 0.025 0.0 112-113 4.2375 0.0 0.0 0.025 0.0 114-115 4.675 0.0 0.0 0.025 0.0 116-117 5.5125 0.0 0.0 0.05 0.0 118-119 5.8625 0.0 0.0 0.05 0.0 120-121 6.6125 0.0 0.0 0.05 0.0 122-123 7.5875 0.0 0.0 0.05 0.0 124-125 8.0125 0.0 0.0 0.05 0.0 126-127 8.75 0.0 0.0 0.05 0.0 128-129 9.875 0.0 0.0 0.05 0.0 130-131 11.0875 0.0 0.0 0.05 0.0 132-133 12.55 0.0 0.0 0.05 0.0 134-135 14.3125 0.0 0.0 0.05 0.0 136-137 15.85 0.0 0.0 0.05 0.0 138 16.85 0.0 0.0 0.05 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AATCTTC 10 0.0069790767 143.96251 3 >>END_MODULE SRR1799540 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR1799540_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.8815 34.0 33.0 34.0 31.0 34.0 2 32.97675 34.0 34.0 34.0 31.0 34.0 3 33.02 34.0 34.0 34.0 31.0 34.0 4 36.27675 37.0 37.0 37.0 35.0 37.0 5 36.318 37.0 37.0 37.0 35.0 37.0 6 36.35675 37.0 37.0 37.0 35.0 37.0 7 36.3315 37.0 37.0 37.0 35.0 37.0 8 36.32575 37.0 37.0 37.0 35.0 37.0 9 38.25425 39.0 39.0 39.0 38.0 39.0 10-14 38.56375 39.4 39.2 39.4 37.6 39.4 15-19 39.8981 41.0 40.0 41.0 38.4 41.0 20-24 39.855450000000005 41.0 40.0 41.0 38.4 41.0 25-29 39.7421 41.0 40.0 41.0 38.0 41.0 30-34 39.624550000000006 41.0 40.0 41.0 38.0 41.0 35-39 39.428250000000006 41.0 40.0 41.0 37.8 41.0 40-44 39.23375 41.0 40.0 41.0 37.0 41.0 45-49 38.9722 41.0 39.2 41.0 36.2 41.0 50-54 38.1133 39.6 38.0 40.6 34.4 40.8 55-59 38.2812 40.0 38.0 41.0 34.4 41.0 60-64 38.162349999999996 39.8 37.4 41.0 35.0 41.0 65-69 37.5549 39.0 36.2 41.0 35.0 41.0 70-74 36.56475 37.2 35.0 39.2 34.0 41.0 75-79 35.46655 36.0 35.0 37.6 33.6 39.2 80-84 34.58964999999999 35.0 35.0 36.4 33.0 37.4 85-89 34.00125 35.0 35.0 35.4 33.0 36.4 90-94 33.68525 35.0 35.0 35.0 32.4 36.0 95-99 33.4773 35.0 34.8 35.0 31.8 35.6 100-104 33.31355 35.0 34.0 35.0 31.2 35.0 105-109 33.221450000000004 35.0 34.0 35.0 31.0 35.0 110-114 33.05890000000001 35.0 34.0 35.0 30.8 35.0 115-119 32.87575 35.0 34.0 35.0 30.2 35.0 120-124 32.7378 35.0 34.0 35.0 30.0 35.0 125-129 32.54585 35.0 34.0 35.0 29.0 35.0 130-134 32.2882 35.0 33.6 35.0 29.0 35.0 135-139 31.8572 35.0 33.0 35.0 26.2 35.0 140-144 31.393399999999996 35.0 32.6 35.0 24.8 35.0 145-149 30.615199999999998 34.6 31.6 35.0 17.2 35.0 150 28.1435 33.0 27.0 35.0 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 32.0 3 2.0 4 1.0 5 0.0 6 1.0 7 4.0 8 4.0 9 2.0 10 4.0 11 3.0 12 3.0 13 6.0 14 4.0 15 7.0 16 2.0 17 4.0 18 6.0 19 4.0 20 4.0 21 11.0 22 6.0 23 12.0 24 10.0 25 13.0 26 17.0 27 13.0 28 24.0 29 22.0 30 32.0 31 39.0 32 57.0 33 93.0 34 174.0 35 380.0 36 1134.0 37 1820.0 38 50.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.79718875502008 19.929718875502008 12.600401606425704 30.672690763052206 2 25.957446808510635 26.583229036295368 31.214017521902377 16.245306633291616 3 20.67067067067067 28.32832832832833 30.180180180180184 20.82082082082082 4 25.769326995246434 30.848136102076555 23.692769577182887 19.68976732549412 5 26.594946209657245 35.351513635226425 22.041531148361273 16.012009006755065 6 20.7 39.550000000000004 23.0 16.75 7 20.45 20.875 38.95 19.725 8 22.625 25.2 29.525000000000002 22.650000000000002 9 23.724999999999998 22.475 30.575000000000003 23.225 10-14 24.116205810290513 28.131406570328515 26.906345317265863 20.846042302115105 15-19 23.79 28.095 28.1 20.015 20-24 23.549999999999997 28.060000000000002 27.525 20.865000000000002 25-29 23.56 27.93 27.925 20.585 30-34 24.18 27.575 28.144999999999996 20.1 35-39 23.880000000000003 27.72 28.144999999999996 20.255000000000003 40-44 23.64 27.375 28.27 20.715 45-49 23.36 27.634999999999998 28.48 20.525 50-54 24.415 27.355 28.09 20.14 55-59 23.674999999999997 27.534999999999997 28.854999999999997 19.935 60-64 23.935000000000002 27.915 28.4 19.75 65-69 23.785 27.22 28.945 20.05 70-74 23.64 27.375 28.98 20.005 75-79 24.169999999999998 27.21 28.849999999999998 19.77 80-84 24.044999999999998 27.744999999999997 28.4 19.81 85-89 24.03 27.584999999999997 28.560000000000002 19.825 90-94 23.945 26.895000000000003 29.035 20.125 95-99 24.07 26.810000000000002 29.095 20.025000000000002 100-104 24.01 27.889999999999997 28.16 19.939999999999998 105-109 24.565 27.66 28.189999999999998 19.585 110-114 24.310000000000002 27.839999999999996 27.634999999999998 20.215 115-119 24.93 27.560000000000002 28.444999999999997 19.064999999999998 120-124 24.75 28.310000000000002 28.194999999999997 18.745 125-129 25.465 27.58 27.91 19.045 130-134 26.21 27.944999999999997 27.08 18.765 135-139 26.384999999999998 27.515 27.615000000000002 18.485 140-144 27.389999999999997 27.595 26.655 18.360000000000003 145-149 27.54 27.200000000000003 26.58 18.68 150 29.32216298552932 27.545062198527543 25.666412795125666 17.466362020817467 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 1.0 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.5 13 0.5 14 0.5 15 1.0 16 0.5 17 0.5 18 1.0 19 0.5 20 0.5 21 1.0 22 0.5 23 0.5 24 1.0 25 1.5 26 4.5 27 5.5 28 7.5 29 9.5 30 11.5 31 17.0 32 29.5 33 41.5 34 46.5 35 53.5 36 72.0 37 118.0 38 146.0 39 141.0 40 181.5 41 241.5 42 262.5 43 280.5 44 290.0 45 275.0 46 275.5 47 262.5 48 230.5 49 196.5 50 157.5 51 136.5 52 117.5 53 92.0 54 72.5 55 54.5 56 40.5 57 31.0 58 17.5 59 16.5 60 16.0 61 9.0 62 7.0 63 5.0 64 3.0 65 3.5 66 2.0 67 0.5 68 1.0 69 0.5 70 0.0 71 0.5 72 1.0 73 0.5 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.4 2 0.125 3 0.1 4 0.075 5 0.075 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.005 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 1.525 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79959919839679 99.6 2 0.2004008016032064 0.4 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1125 0.0 0.0 0.0 0.0 72-73 0.1875 0.0 0.0 0.0 0.0 74-75 0.225 0.0 0.0 0.0 0.0 76-77 0.3375 0.0 0.0 0.0 0.0 78-79 0.3875 0.0 0.0 0.0 0.0 80-81 0.4 0.0 0.0 0.0 0.0 82-83 0.42500000000000004 0.0 0.0 0.0 0.0 84-85 0.5125 0.0 0.0 0.0 0.0 86-87 0.6875 0.0 0.0 0.0 0.0 88-89 0.7375 0.0 0.0 0.0 0.0 90-91 0.8625 0.0 0.0 0.0 0.0 92-93 1.025 0.0 0.0 0.0 0.0 94-95 1.1 0.0 0.0 0.0 0.0 96-97 1.275 0.0 0.0 0.0 0.0 98-99 1.575 0.0 0.0 0.0 0.0 100-101 1.7875 0.0 0.0 0.0 0.0 102-103 2.1125 0.0 0.0 0.0 0.0 104-105 2.75 0.0 0.0 0.0 0.0 106-107 3.0374999999999996 0.0 0.0 0.0 0.0 108-109 3.55 0.0 0.0 0.0 0.0 110-111 4.0625 0.0 0.0 0.0 0.0 112-113 4.3375 0.0 0.0 0.0 0.0 114-115 4.775 0.0 0.0 0.0 0.0 116-117 5.6125 0.0 0.0 0.0 0.0 118-119 5.987500000000001 0.0 0.0 0.0 0.0 120-121 6.75 0.0 0.0 0.0 0.0 122-123 7.7 0.0 0.0 0.0 0.0 124-125 8.1125 0.0 0.0 0.0 0.0 126-127 8.825 0.0 0.0 0.0 0.0 128-129 9.975000000000001 0.0 0.0 0.0 0.0 130-131 11.1625 0.0 0.0 0.0 0.0 132-133 12.600000000000001 0.0 0.0 0.0 0.0 134-135 14.4 0.0 0.0 0.0 0.0 136-137 16.0875 0.0 0.0 0.0 0.0 138 17.1 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1308069 spots for SRR1799540.sra Written 1308069 spots for SRR1799540.sra Read 1308069 spots for SRR1799540.sra Written 1308069 spots for SRR1799540.sra Read 1308069 spots for SRR1799540.sra Written 1308069 spots for SRR1799540.sra Read 1308069 spots for SRR1799540.sra Written 1308069 spots for SRR1799540.sra Read 1308069 spots for SRR1799540.sra Written 1308069 spots for SRR1799540.sra Read 1308069 spots for SRR1799540.sra Written 1308069 spots for SRR1799540.sra Read 1308069 spots for SRR1799540.sra Written 1308069 spots for SRR1799540.sra Read 1308069 spots for SRR1799540.sra Written 1308069 spots for SRR1799540.sra Read 1308069 spots for SRR1799540.sra Written 1308069 spots for SRR1799540.sra Read 1308069 spots for SRR1799540.sra Written 1308069 spots for SRR1799540.sra Read 1308069 spots for SRR1799540.sra Written 1308069 spots for SRR1799540.sra Read 1308069 spots for SRR1799540.sra Written 1308069 spots for SRR1799540.sra Read 1308069 spots for SRR1799540.sra Written 1308069 spots for SRR1799540.sra Read 1308069 spots for SRR1799540.sra Written 1308069 spots for SRR1799540.sra Read 1308069 spots for SRR1799540.sra Written 1308069 spots for SRR1799540.sra Read 1308073 spots for SRR1799540.sra Written 1308073 spots for SRR1799540.sra Read 1308069 spots for SRR1799540.sra Written 1308069 spots for SRR1799540.sra Read 1308069 spots for SRR1799540.sra Written 1308069 spots for SRR1799540.sra Read 1308069 spots for SRR1799540.sra Written 1308069 spots for SRR1799540.sra Read 1308069 spots for SRR1799540.sra Written 1308069 spots for SRR1799540.sra SRR ids: ['SRR1799540.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_u4rnbsbj SRR1799540.sra spots: 26161384 blocks: [[1, 1308069], [1308070, 2616138], [2616139, 3924207], [3924208, 5232276], [5232277, 6540345], [6540346, 7848414], [7848415, 9156483], [9156484, 10464552], [10464553, 11772621], [11772622, 13080690], [13080691, 14388759], [14388760, 15696828], [15696829, 17004897], [17004898, 18312966], [18312967, 19621035], [19621036, 20929104], [20929105, 22237173], [22237174, 23545242], [23545243, 24853311], [24853312, 26161384]] SRR1799540 file size 8792437 SRR1799540 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR1799540 SRR1799540_1.fastq SRR1799540_2.fastq Input file: SRR1799540_1.fastq Paired file: SRR1799540_2.fastq trimmed: SRR1799540-trimmed-pair1.fastq, SRR1799540-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 21:34:31 2025 >> started Thu Feb 13 21:34:59 2025 >> done (28.337s) 26161384 read pairs processed; of these: 60280 ( 0.23%) short read pairs filtered out after trimming by size control 150356 ( 0.57%) empty read pairs filtered out after trimming by size control 25950748 (99.19%) read pairs available; of these: 10989997 (42.35%) trimmed read pairs available after processing 14960751 (57.65%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 4 0.00% 20 7 0.00% 21 8 0.00% 22 14 0.00% 23 27 0.00% 24 35 0.00% 25 45 0.00% 26 45 0.00% 27 54 0.00% 28 85 0.00% 29 109 0.00% 30 106 0.00% 31 134 0.00% 32 186 0.00% 33 205 0.00% 34 240 0.00% 35 289 0.00% 36 310 0.00% 37 377 0.00% 38 389 0.00% 39 445 0.00% 40 461 0.00% 41 567 0.00% 42 560 0.00% 43 560 0.00% 44 648 0.00% 45 673 0.00% 46 742 0.00% 47 771 0.00% 48 904 0.00% 49 948 0.00% 50 1042 0.00% 51 1086 0.00% 52 1179 0.00% 53 1254 0.00% 54 1307 0.01% 55 1486 0.01% 56 1598 0.01% 57 1775 0.01% 58 1960 0.01% 59 2170 0.01% 60 2487 0.01% 61 2731 0.01% 62 2971 0.01% 63 3201 0.01% 64 3666 0.01% 65 3968 0.02% 66 4478 0.02% 67 4836 0.02% 68 5358 0.02% 69 6030 0.02% 70 6730 0.03% 71 7603 0.03% 72 8498 0.03% 73 9618 0.04% 74 10187 0.04% 75 10873 0.04% 76 10150 0.04% 77 9255 0.04% 78 8379 0.03% 79 8058 0.03% 80 6884 0.03% 81 7874 0.03% 82 8465 0.03% 83 9810 0.04% 84 16412 0.06% 85 26621 0.10% 86 33024 0.13% 87 15474 0.06% 88 16091 0.06% 89 19520 0.08% 90 25577 0.10% 91 19369 0.07% 92 21425 0.08% 93 18859 0.07% 94 21431 0.08% 95 26493 0.10% 96 40833 0.16% 97 73406 0.28% 98 28983 0.11% 99 29348 0.11% 100 50280 0.19% 101 38884 0.15% 102 71753 0.28% 103 87806 0.34% 104 131344 0.51% 105 39111 0.15% 106 50956 0.20% 107 72080 0.28% 108 97914 0.38% 109 89315 0.34% 110 33140 0.13% 111 37835 0.15% 112 60540 0.23% 113 48059 0.19% 114 94883 0.37% 115 184317 0.71% 116 60027 0.23% 117 104672 0.40% 118 61297 0.24% 119 134140 0.52% 120 193880 0.75% 121 167829 0.65% 122 47469 0.18% 123 50935 0.20% 124 86300 0.33% 125 100508 0.39% 126 138179 0.53% 127 188454 0.73% 128 218767 0.84% 129 155321 0.60% 130 128971 0.50% 131 194942 0.75% 132 221286 0.85% 133 202959 0.78% 134 225866 0.87% 135 221017 0.85% 136 235819 0.91% 137 234543 0.90% 138 244417 0.94% 139 249849 0.96% 140 251945 0.97% 141 258341 1.00% 142 265442 1.02% 143 272983 1.05% 144 293489 1.13% 145 307843 1.19% 146 353206 1.36% 147 428462 1.65% 148 590647 2.28% 149 2292189 8.83% 150 14960751 57.65% 25950748 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=2.29 fanout-score-rank=37 prefix-density=0.17 prefix-fanout=2.2 sequence=GCTAGACATGCAAGATTC criterion=fanout-score sequence-density=0.02 sequence-density-rank=40 fanout-score=314.56 fanout-score-rank=1 prefix-density=0.30 prefix-fanout=18.9 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCCCTGGGAGATTTTGTCCCAGTAACTGGGATCAGCCTTGCACTTCTCAAAGAAGTCAA criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=6.27 fanout-score-rank=25 prefix-density=0.22 prefix-fanout=3.9 sequence=ATCCAGAAGGAGTCCACCCTCCACTTGGT criterion=fanout-score sequence-density=0.01 sequence-density-rank=46 fanout-score=1996.97 fanout-score-rank=1 prefix-density=0.86 prefix-fanout=30.0 sequence=AAGAAGAAGTAAAGGAAGAACAGAAGCCTGTTGAAACAGAGGAGAAGGTTGAAACAGAAACCCCAGTAGAAAAGACTGAGTAATGAGGTCATCACGGGAGAATGCTGCATGGTTCCAGTGGAAGTCTATCTAGTGGGTTCTTGTGTGTAGGTTGAATCTTGCA SRR1799540 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 21:35:38 Started mapping on | Feb 13 21:35:38 Finished on | Feb 13 21:37:43 Mapping speed, Million of reads per hour | 747.38 Number of input reads | 25950748 Average input read length | 285 UNIQUE READS: Uniquely mapped reads number | 25054956 Uniquely mapped reads % | 96.55% Average mapped length | 285.09 Number of splices: Total | 20998550 Number of splices: Annotated (sjdb) | 20624122 Number of splices: GT/AG | 20668624 Number of splices: GC/AG | 254414 Number of splices: AT/AC | 18551 Number of splices: Non-canonical | 56961 Mismatch rate per base, % | 0.30% Deletion rate per base | 0.03% Deletion average length | 2.50 Insertion rate per base | 0.02% Insertion average length | 2.27 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 496819 % of reads mapped to multiple loci | 1.91% Number of reads mapped to too many loci | 48303 % of reads mapped to too many loci | 0.19% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.32% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 418461 418461 418461 N_multimapping 496819 496819 496819 N_noFeature 740430 24740520 906048 N_ambiguous 248575 1627 98630 UnstrandedReadsAssigned:24065951 PositiveStrandReadsAssigned:312809 NegativeStrandReadsAssigned:24050278 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=139 echo kmer=135 SRR1799540 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR1799540-trimmed-pair1.fastq SRR1799540-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 25,950,748 reads, 23,996,604 reads pseudoaligned [quant] estimated average fragment length: 185.869 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,267 rounds 52401 SRR1799540.ke.tsv 34699 SRR1799540.se.tsv 87100 total ==> SRR1799540.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1833.13 545 13.484 Potri.005G024800.1.v4.1 1035 850.131 80 4.26795 Potri.004G059700.1.v4.1 961 776.131 58 3.38928 Potri.007G009000.2.v4.1 1416 1231.13 0 0 Potri.003G141000.2.v4.1 2943 2758.13 311.031 5.11451 Potri.016G087400.1.v4.1 270 102.353 3017.11 1336.91 Potri.015G069301.1.v4.1 564 379.713 0 0 Potri.010G195200.1.v4.1 1773 1588.13 109 3.11283 Potri.012G127500.1.v4.1 977 792.131 7972 456.441 ==> SRR1799540.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 3681 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 566 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR1799540 completed mapping pipeline successfully