Starting /dee2/code/volunteer_pipeline.sh SRR1799541 current disk space = 3088187817984 free memory = 1402927148 SRR1799541 SRAfilesize b990213378c5eea6e078f9f74f2d5890 SRR1799541.sra SRR1799541.sra file validated SRR1799541 is paired end SRR1799541 is conventional basespace SRR1799541 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR1799541_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.32075 34.0 33.0 34.0 31.0 34.0 2 32.88425 34.0 34.0 34.0 31.0 34.0 3 33.31675 34.0 34.0 34.0 31.0 34.0 4 36.639 37.0 37.0 37.0 35.0 37.0 5 36.622 37.0 37.0 37.0 35.0 37.0 6 36.637 37.0 37.0 37.0 35.0 37.0 7 36.6825 37.0 37.0 37.0 35.0 37.0 8 36.6525 37.0 37.0 37.0 35.0 37.0 9 38.55025 39.0 39.0 39.0 38.0 39.0 10-14 38.87755 39.4 39.2 39.4 38.0 39.4 15-19 40.161500000000004 41.0 40.0 41.0 38.2 41.0 20-24 40.1558 41.0 40.0 41.0 38.2 41.0 25-29 40.0866 41.0 40.0 41.0 38.0 41.0 30-34 39.92695 41.0 40.0 41.0 38.0 41.0 35-39 39.789300000000004 41.0 40.0 41.0 38.0 41.0 40-44 39.646950000000004 41.0 40.0 41.0 37.6 41.0 45-49 39.45125 41.0 39.8 41.0 36.8 41.0 50-54 39.1489 40.6 39.0 41.0 35.6 41.0 55-59 38.8657 40.0 38.4 41.0 35.0 41.0 60-64 38.69515 40.0 37.6 41.0 35.0 41.0 65-69 38.1211 39.2 36.6 41.0 35.0 41.0 70-74 37.0312 37.6 35.4 39.4 34.2 41.0 75-79 35.80174999999999 36.2 34.8 37.4 33.4 39.4 80-84 35.140249999999995 35.2 35.0 36.6 33.4 37.8 85-89 34.528749999999995 35.0 35.0 35.6 33.0 36.6 90-94 34.21835 35.0 35.0 35.0 33.0 36.0 95-99 34.042 35.0 35.0 35.0 33.0 35.2 100-104 33.687 35.0 34.2 35.0 31.4 35.0 105-109 33.7635 35.0 34.0 35.0 31.8 35.0 110-114 33.652100000000004 35.0 34.0 35.0 32.0 35.0 115-119 33.5191 35.0 34.0 35.0 31.4 35.0 120-124 33.32895 35.0 34.0 35.0 31.0 35.0 125-129 33.1927 35.0 34.0 35.0 31.0 35.0 130-134 33.041999999999994 35.0 34.0 35.0 30.2 35.0 135-139 32.7307 35.0 34.0 35.0 29.4 35.0 140-144 32.411699999999996 35.0 33.2 35.0 29.0 35.0 145-149 31.811199999999996 35.0 33.0 35.0 27.0 35.0 150 26.7105 33.0 23.0 35.0 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 2.0 10 0.0 11 3.0 12 2.0 13 1.0 14 5.0 15 2.0 16 2.0 17 6.0 18 5.0 19 1.0 20 6.0 21 7.0 22 9.0 23 5.0 24 10.0 25 8.0 26 19.0 27 20.0 28 20.0 29 31.0 30 31.0 31 34.0 32 61.0 33 95.0 34 157.0 35 313.0 36 1090.0 37 2021.0 38 33.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.50931677018634 10.093167701863354 8.229813664596273 43.16770186335403 2 22.566925193895422 13.910432824618463 34.22566925193895 29.29697272954716 3 19.325 16.85 26.6 37.225 4 23.305826456614152 25.78144536134033 22.155538884721178 28.75718929732433 5 23.425 31.2 24.6 20.775 6 20.05 34.449999999999996 24.4 21.099999999999998 7 15.174999999999999 28.849999999999998 38.65 17.325 8 16.400000000000002 27.3 32.675 23.625 9 16.5 25.275 34.9 23.325000000000003 10-14 19.34 30.415 27.315 22.93 15-19 19.525000000000002 29.29 27.295 23.89 20-24 19.705000000000002 29.37 27.63 23.294999999999998 25-29 19.259999999999998 30.04 26.97 23.73 30-34 19.73 29.385 27.165 23.72 35-39 19.095000000000002 29.49 27.145000000000003 24.27 40-44 20.025000000000002 29.439999999999998 26.974999999999998 23.56 45-49 19.655 28.89 27.744999999999997 23.71 50-54 20.65 28.82 27.345000000000002 23.185 55-59 20.080000000000002 29.044999999999998 26.924999999999997 23.95 60-64 20.24 28.935 26.974999999999998 23.849999999999998 65-69 20.255000000000003 29.720000000000002 26.55 23.474999999999998 70-74 19.765 29.375 27.284999999999997 23.575 75-79 20.73 28.34 27.12 23.810000000000002 80-84 20.72 29.425 26.515 23.34 85-89 20.815 29.365000000000002 26.729999999999997 23.09 90-94 19.955000000000002 29.24 26.83 23.974999999999998 95-99 20.169999999999998 29.38 27.084999999999997 23.365 100-104 20.4 29.104999999999997 26.85 23.645 105-109 20.560000000000002 28.860000000000003 26.82 23.76 110-114 20.62 30.080000000000002 26.590000000000003 22.71 115-119 20.355 28.58 27.089999999999996 23.974999999999998 120-124 21.060000000000002 29.45 25.855 23.635 125-129 20.435 28.835 26.55 24.18 130-134 21.05 29.235 25.919999999999998 23.794999999999998 135-139 21.525 29.299999999999997 26.075 23.1 140-144 21.615000000000002 29.565 25.19 23.630000000000003 145-149 21.965 29.959999999999997 24.505 23.57 150 17.13497240341194 31.71098845960863 23.98394380331159 27.170095333667838 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.0 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.5 24 2.0 25 3.0 26 4.5 27 7.5 28 9.5 29 13.0 30 20.0 31 23.5 32 36.5 33 51.5 34 59.0 35 72.5 36 99.5 37 122.5 38 133.0 39 156.5 40 187.5 41 213.0 42 232.5 43 254.0 44 259.0 45 261.5 46 274.5 47 252.0 48 216.5 49 207.5 50 185.5 51 148.5 52 119.0 53 89.5 54 71.5 55 54.5 56 36.5 57 24.5 58 23.0 59 20.5 60 11.0 61 8.5 62 7.0 63 6.0 64 6.0 65 5.0 66 3.0 67 1.5 68 1.0 69 1.0 70 0.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.4000000000000004 2 0.075 3 0.0 4 0.025 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.35000000000000003 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74937343358395 99.5 2 0.2506265664160401 0.5 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.037500000000000006 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.0875 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.1375 0.0125 0.0 0.0 0.0 74-75 0.1875 0.025 0.0 0.0 0.0 76-77 0.275 0.025 0.0 0.0 0.0 78-79 0.4375 0.025 0.0 0.0 0.0 80-81 0.575 0.025 0.0 0.0 0.0 82-83 0.6625000000000001 0.025 0.0 0.0 0.0 84-85 0.675 0.025 0.0 0.0 0.0 86-87 0.7124999999999999 0.025 0.0 0.0 0.0 88-89 0.75 0.025 0.0 0.0 0.0 90-91 0.7875000000000001 0.025 0.0 0.0 0.0 92-93 0.85 0.025 0.0 0.0 0.0 94-95 0.9 0.025 0.0 0.0 0.0 96-97 0.9624999999999999 0.025 0.0 0.0 0.0 98-99 1.125 0.025 0.0 0.0 0.0 100-101 1.325 0.025 0.0 0.0 0.0 102-103 1.65 0.025 0.0 0.0 0.0 104-105 2.1375 0.025 0.0 0.0 0.0 106-107 2.9125 0.025 0.0 0.0 0.0 108-109 3.3875 0.025 0.0 0.0 0.0 110-111 3.975 0.025 0.0 0.0 0.0 112-113 4.4875 0.025 0.0 0.0 0.0 114-115 5.0375 0.025 0.0 0.0 0.0 116-117 6.0125 0.025 0.0 0.0 0.0 118-119 6.4 0.025 0.0 0.0 0.0 120-121 6.7125 0.025 0.0 0.0 0.0 122-123 7.6375 0.025 0.0 0.0 0.0 124-125 8.2875 0.025 0.0 0.0 0.0 126-127 8.575 0.025 0.0 0.0 0.0 128-129 9.087499999999999 0.025 0.0 0.0 0.0 130-131 10.5625 0.025 0.0 0.0 0.0 132-133 11.787500000000001 0.025 0.0 0.0 0.0 134-135 13.2 0.025 0.0 0.0 0.0 136-137 14.7 0.025 0.0 0.0 0.0 138 15.95 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAAGAGC 120 3.1230284E-4 10.797188 140-144 GGAAGAG 135 7.6490396E-5 10.663888 140-144 AGATCGG 140 1.1065038E-4 10.283035 135-139 GATCGGA 140 0.0012907274 9.254732 135-139 >>END_MODULE SRR1799541 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR1799541_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.709 34.0 33.0 34.0 31.0 34.0 2 32.6835 34.0 33.0 34.0 31.0 34.0 3 32.89375 34.0 33.0 34.0 31.0 34.0 4 36.2555 37.0 37.0 37.0 35.0 37.0 5 36.283 37.0 37.0 37.0 35.0 37.0 6 36.30575 37.0 37.0 37.0 35.0 37.0 7 36.2685 37.0 37.0 37.0 35.0 37.0 8 36.26975 37.0 37.0 37.0 35.0 37.0 9 38.0955 39.0 39.0 39.0 37.0 39.0 10-14 38.433350000000004 39.4 39.2 39.4 37.2 39.4 15-19 39.69445 41.0 40.0 41.0 38.0 41.0 20-24 39.639599999999994 41.0 40.0 41.0 38.0 41.0 25-29 39.5814 41.0 40.0 41.0 38.0 41.0 30-34 39.48055 41.0 40.0 41.0 37.8 41.0 35-39 39.227250000000005 41.0 40.0 41.0 37.0 41.0 40-44 39.0443 41.0 39.8 41.0 36.4 41.0 45-49 38.89020000000001 40.6 39.0 41.0 35.8 41.0 50-54 38.10164999999999 39.6 38.0 40.6 34.6 40.8 55-59 38.1015 40.0 37.8 41.0 34.0 41.0 60-64 37.9671 39.8 37.2 41.0 34.0 41.0 65-69 37.377599999999994 39.0 36.2 40.8 34.0 41.0 70-74 36.39275 37.0 35.0 39.2 34.0 41.0 75-79 35.2618 35.8 35.0 37.4 33.0 39.2 80-84 34.40335 35.0 35.0 36.2 32.2 37.4 85-89 33.853750000000005 35.0 35.0 35.4 32.0 36.4 90-94 33.5433 35.0 34.2 35.0 31.6 36.0 95-99 33.35295 35.0 34.0 35.0 31.0 35.2 100-104 33.24295000000001 35.0 34.0 35.0 31.0 35.0 105-109 33.15015 35.0 34.0 35.0 31.0 35.0 110-114 33.00195 35.0 34.0 35.0 30.2 35.0 115-119 32.78075 35.0 34.0 35.0 29.4 35.0 120-124 32.6035 35.0 34.0 35.0 29.2 35.0 125-129 32.46715 35.0 33.8 35.0 29.0 35.0 130-134 32.197449999999996 35.0 33.0 35.0 28.2 35.0 135-139 31.7673 35.0 33.0 35.0 25.8 35.0 140-144 31.393099999999997 35.0 32.6 35.0 24.8 35.0 145-149 30.994300000000003 34.6 32.0 35.0 23.4 35.0 150 28.9395 33.0 29.0 35.0 15.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 26.0 3 3.0 4 3.0 5 2.0 6 3.0 7 3.0 8 2.0 9 4.0 10 4.0 11 4.0 12 5.0 13 6.0 14 6.0 15 6.0 16 3.0 17 1.0 18 2.0 19 8.0 20 7.0 21 12.0 22 9.0 23 3.0 24 10.0 25 17.0 26 13.0 27 17.0 28 26.0 29 32.0 30 37.0 31 60.0 32 61.0 33 105.0 34 158.0 35 372.0 36 1224.0 37 1706.0 38 40.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.75715002508781 18.590065228299046 12.920220772704466 30.732563973908682 2 24.4994994994995 26.05105105105105 33.633633633633636 15.815815815815814 3 21.03551775887944 27.188594297148573 30.7903951975988 20.985492746373186 4 25.894420815611706 32.34926194645985 23.867900925694272 17.888416312234177 5 24.88744372186093 35.71785892946473 23.06153076538269 16.333166583291643 6 20.775 36.6 24.224999999999998 18.4 7 20.9 21.15 39.050000000000004 18.9 8 22.125 24.3 28.549999999999997 25.025 9 21.75 24.875 31.075000000000003 22.3 10-14 24.395 28.63 27.029999999999998 19.945 15-19 23.474999999999998 28.060000000000002 27.96 20.505000000000003 20-24 23.7 27.544999999999998 28.255000000000003 20.5 25-29 23.41 27.725 27.955000000000002 20.91 30-34 23.145 27.74 28.395 20.72 35-39 23.549999999999997 27.860000000000003 27.87 20.72 40-44 23.765 27.175 28.349999999999998 20.71 45-49 23.595 27.439999999999998 28.785 20.18 50-54 24.43 27.634999999999998 27.845 20.09 55-59 23.549999999999997 27.279999999999998 28.854999999999997 20.315 60-64 23.3 26.97 29.265 20.465 65-69 23.580000000000002 27.345000000000002 28.904999999999998 20.169999999999998 70-74 23.89 27.1 28.7 20.31 75-79 23.68 27.355 28.09 20.875 80-84 23.555 27.305 28.749999999999996 20.39 85-89 24.05 26.884999999999998 28.810000000000002 20.255000000000003 90-94 23.915 26.215 29.175 20.695 95-99 23.965 27.215 29.205 19.615 100-104 23.51 27.07 29.005 20.415 105-109 23.895 27.42 28.310000000000002 20.375 110-114 24.305 27.705000000000002 27.87 20.119999999999997 115-119 24.83 27.98 27.689999999999998 19.5 120-124 25.34 27.139999999999997 27.855 19.665 125-129 25.2 27.38 27.465 19.955000000000002 130-134 25.77 28.535 26.889999999999997 18.805 135-139 25.95 28.68 26.76 18.61 140-144 27.115000000000002 29.065 25.635 18.185000000000002 145-149 27.465 27.85 25.935000000000002 18.75 150 28.822495606326886 27.592267135325134 24.8807431584233 18.70449409992468 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.0 23 1.5 24 2.0 25 3.0 26 3.5 27 8.5 28 11.0 29 11.0 30 14.0 31 19.0 32 26.0 33 36.0 34 46.5 35 66.5 36 96.5 37 116.0 38 127.5 39 150.5 40 182.5 41 212.0 42 242.5 43 273.0 44 271.5 45 275.0 46 282.5 47 264.5 48 244.0 49 215.0 50 176.0 51 140.5 52 119.0 53 89.5 54 71.0 55 56.5 56 34.0 57 23.0 58 17.5 59 13.5 60 12.5 61 10.5 62 7.5 63 5.5 64 3.5 65 2.5 66 3.0 67 2.5 68 2.5 69 2.5 70 0.5 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.5 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.35000000000000003 2 0.1 3 0.05 4 0.075 5 0.05 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.42500000000000004 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64877069744105 99.3 2 0.35122930255895635 0.7000000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.037500000000000006 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.0875 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.1375 0.0 0.0 0.0 0.0 74-75 0.1875 0.0 0.0 0.0 0.0 76-77 0.275 0.0 0.0 0.0 0.0 78-79 0.4375 0.0 0.0 0.0 0.0 80-81 0.5625 0.0 0.0 0.0 0.0 82-83 0.6375 0.0 0.0 0.0 0.0 84-85 0.65 0.0 0.0 0.0 0.0 86-87 0.6875 0.0 0.0 0.0 0.0 88-89 0.725 0.0 0.0 0.0 0.0 90-91 0.7625 0.0 0.0 0.0 0.0 92-93 0.85 0.0 0.0 0.0 0.0 94-95 0.9 0.0 0.0 0.0 0.0 96-97 0.9624999999999999 0.0 0.0 0.0 0.0 98-99 1.125 0.0 0.0 0.0 0.0 100-101 1.325 0.0 0.0 0.0 0.0 102-103 1.6375 0.0 0.0 0.0 0.0 104-105 2.1125 0.0 0.0 0.0 0.0 106-107 2.8875 0.0 0.0 0.0 0.0 108-109 3.3625 0.0 0.0 0.0 0.0 110-111 3.95 0.0 0.0 0.0 0.0 112-113 4.4625 0.0 0.0 0.0 0.0 114-115 5.025 0.0 0.0 0.0 0.0 116-117 6.0125 0.0 0.0 0.0 0.0 118-119 6.4125 0.0 0.0 0.0 0.0 120-121 6.7375 0.0 0.0 0.0 0.0 122-123 7.675000000000001 0.0 0.0 0.0 0.0 124-125 8.3875 0.0 0.0 0.0 0.0 126-127 8.775 0.0 0.0 0.0 0.0 128-129 9.287500000000001 0.0 0.0 0.0 0.0 130-131 10.7 0.0 0.0 0.0 0.0 132-133 11.912500000000001 0.0 0.0 0.0 0.0 134-135 13.337499999999999 0.0 0.0 0.0 0.0 136-137 14.8875 0.0 0.0 0.0 0.0 138 16.175 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGAAGAG 145 1.2789986E-5 10.924138 140-144 AGATCGG 140 1.10358655E-4 10.285714 135-139 GAAGAGC 135 9.2289544E-4 9.599999 140-144 GATCGGA 140 0.0012876578 9.257142 135-139 CGGAAGA 130 0.007441913 8.861538 140-144 >>END_MODULE Read 1198109 spots for SRR1799541.sra Written 1198109 spots for SRR1799541.sra Read 1198109 spots for SRR1799541.sra Written 1198109 spots for SRR1799541.sra Read 1198109 spots for SRR1799541.sra Written 1198109 spots for SRR1799541.sra Read 1198109 spots for SRR1799541.sra Written 1198109 spots for SRR1799541.sra Read 1198109 spots for SRR1799541.sra Written 1198109 spots for SRR1799541.sra Read 1198109 spots for SRR1799541.sra Written 1198109 spots for SRR1799541.sra Read 1198109 spots for SRR1799541.sra Written 1198109 spots for SRR1799541.sra Read 1198109 spots for SRR1799541.sra Written 1198109 spots for SRR1799541.sra Read 1198111 spots for SRR1799541.sra Written 1198111 spots for SRR1799541.sra Read 1198109 spots for SRR1799541.sra Written 1198109 spots for SRR1799541.sra Read 1198109 spots for SRR1799541.sra Written 1198109 spots for SRR1799541.sra Read 1198109 spots for SRR1799541.sra Written 1198109 spots for SRR1799541.sra Read 1198109 spots for SRR1799541.sra Written 1198109 spots for SRR1799541.sra Read 1198109 spots for SRR1799541.sra Written 1198109 spots for SRR1799541.sra Read 1198109 spots for SRR1799541.sra Written 1198109 spots for SRR1799541.sra Read 1198109 spots for SRR1799541.sra Written 1198109 spots for SRR1799541.sra Read 1198109 spots for SRR1799541.sra Written 1198109 spots for SRR1799541.sra Read 1198109 spots for SRR1799541.sra Written 1198109 spots for SRR1799541.sra Read 1198109 spots for SRR1799541.sra Written 1198109 spots for SRR1799541.sra Read 1198109 spots for SRR1799541.sra Written 1198109 spots for SRR1799541.sra SRR ids: ['SRR1799541.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_w_tud5c5 SRR1799541.sra spots: 23962182 blocks: [[1, 1198109], [1198110, 2396218], [2396219, 3594327], [3594328, 4792436], [4792437, 5990545], [5990546, 7188654], [7188655, 8386763], [8386764, 9584872], [9584873, 10782981], [10782982, 11981090], [11981091, 13179199], [13179200, 14377308], [14377309, 15575417], [15575418, 16773526], [16773527, 17971635], [17971636, 19169744], [19169745, 20367853], [20367854, 21565962], [21565963, 22764071], [22764072, 23962182]] SRR1799541 file size 8051495 SRR1799541 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR1799541 SRR1799541_1.fastq SRR1799541_2.fastq Input file: SRR1799541_1.fastq Paired file: SRR1799541_2.fastq trimmed: SRR1799541-trimmed-pair1.fastq, SRR1799541-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 21:22:19 2025 >> started Thu Feb 13 21:22:47 2025 >> done (27.685s) 23962182 read pairs processed; of these: 59245 ( 0.25%) short read pairs filtered out after trimming by size control 123754 ( 0.52%) empty read pairs filtered out after trimming by size control 23779183 (99.24%) read pairs available; of these: 9827039 (41.33%) trimmed read pairs available after processing 13952144 (58.67%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 2 0.00% 20 3 0.00% 21 8 0.00% 22 13 0.00% 23 24 0.00% 24 26 0.00% 25 46 0.00% 26 47 0.00% 27 66 0.00% 28 78 0.00% 29 96 0.00% 30 109 0.00% 31 120 0.00% 32 172 0.00% 33 211 0.00% 34 231 0.00% 35 264 0.00% 36 310 0.00% 37 331 0.00% 38 371 0.00% 39 413 0.00% 40 443 0.00% 41 474 0.00% 42 530 0.00% 43 571 0.00% 44 578 0.00% 45 636 0.00% 46 693 0.00% 47 719 0.00% 48 853 0.00% 49 879 0.00% 50 986 0.00% 51 1023 0.00% 52 1096 0.00% 53 1164 0.00% 54 1224 0.01% 55 1400 0.01% 56 1566 0.01% 57 1692 0.01% 58 1873 0.01% 59 2009 0.01% 60 2140 0.01% 61 2373 0.01% 62 2666 0.01% 63 3063 0.01% 64 3285 0.01% 65 3720 0.02% 66 4013 0.02% 67 4380 0.02% 68 4849 0.02% 69 5497 0.02% 70 6114 0.03% 71 6931 0.03% 72 7990 0.03% 73 9005 0.04% 74 10394 0.04% 75 11797 0.05% 76 12846 0.05% 77 14082 0.06% 78 14901 0.06% 79 14753 0.06% 80 13410 0.06% 81 11267 0.05% 82 7936 0.03% 83 7935 0.03% 84 12405 0.05% 85 12910 0.05% 86 15647 0.07% 87 20985 0.09% 88 21534 0.09% 89 16397 0.07% 90 16900 0.07% 91 21004 0.09% 92 27775 0.12% 93 21009 0.09% 94 21286 0.09% 95 20344 0.09% 96 22975 0.10% 97 28316 0.12% 98 38634 0.16% 99 39407 0.17% 100 23436 0.10% 101 26971 0.11% 102 80190 0.34% 103 54138 0.23% 104 57394 0.24% 105 72152 0.30% 106 74916 0.32% 107 44126 0.19% 108 56563 0.24% 109 82139 0.35% 110 96881 0.41% 111 65821 0.28% 112 85037 0.36% 113 42771 0.18% 114 112572 0.47% 115 189183 0.80% 116 51009 0.21% 117 39656 0.17% 118 55713 0.23% 119 62065 0.26% 120 57979 0.24% 121 162960 0.69% 122 170061 0.72% 123 100507 0.42% 124 43445 0.18% 125 45387 0.19% 126 104310 0.44% 127 109321 0.46% 128 83217 0.35% 129 134760 0.57% 130 208303 0.88% 131 126491 0.53% 132 105906 0.45% 133 203150 0.85% 134 224141 0.94% 135 176457 0.74% 136 225275 0.95% 137 220347 0.93% 138 240144 1.01% 139 242238 1.02% 140 251580 1.06% 141 255041 1.07% 142 262841 1.11% 143 267199 1.12% 144 284751 1.20% 145 309930 1.30% 146 340456 1.43% 147 398547 1.68% 148 544775 2.29% 149 1988558 8.36% 150 13952144 58.67% 23779183 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=2.44 fanout-score-rank=36 prefix-density=0.17 prefix-fanout=2.3 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACAAACTG criterion=fanout-score sequence-density=0.09 sequence-density-rank=15 fanout-score=131.19 fanout-score-rank=1 prefix-density=0.65 prefix-fanout=18.7 sequence=CCACCACCATGGGCTCCCCAGCCACC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=1.95 fanout-score-rank=43 prefix-density=0.16 prefix-fanout=2.0 sequence=TTCTCTCGCATTGACCACAAGTTTGATCTCATGTATGCCAAGCGTGCGTTTGTGCACTGGTATGTTGG criterion=fanout-score sequence-density=0.02 sequence-density-rank=44 fanout-score=1126.27 fanout-score-rank=1 prefix-density=0.79 prefix-fanout=27.4 sequence=GAAGAAGAAGTAAAGGAAGAACAGAAGCCTGTTGAAACAGAGGAGAAGGTTGAAACAGAAACCCCAGTAGAAAAGACTGAGTAATGAGGTCATCACGGGAGAATGCTGCATGGTTCCAGTGGAAGTCTATCTAGTGGGTTCTTGTGTGTAGGTTGAATCTTGCACGTCTAGCTAGTGGTTTAATAAAGGATTGTTATGCTAATGGGGGTGTAGGTATGGAAATGTTCCACTTGGATCAAACCAATGCGAACTCACCGCATGGATGCATTTGATCT SRR1799541 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 21:23:27 Started mapping on | Feb 13 21:23:27 Finished on | Feb 13 21:25:13 Mapping speed, Million of reads per hour | 807.59 Number of input reads | 23779183 Average input read length | 286 UNIQUE READS: Uniquely mapped reads number | 23060891 Uniquely mapped reads % | 96.98% Average mapped length | 285.61 Number of splices: Total | 20153974 Number of splices: Annotated (sjdb) | 19805701 Number of splices: GT/AG | 19848285 Number of splices: GC/AG | 239703 Number of splices: AT/AC | 17384 Number of splices: Non-canonical | 48602 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.03% Deletion average length | 2.53 Insertion rate per base | 0.02% Insertion average length | 2.32 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 466972 % of reads mapped to multiple loci | 1.96% Number of reads mapped to too many loci | 39261 % of reads mapped to too many loci | 0.17% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.85% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 269108 269108 269108 N_multimapping 466972 466972 466972 N_noFeature 676176 22802994 810929 N_ambiguous 211421 1197 87425 UnstrandedReadsAssigned:22173294 PositiveStrandReadsAssigned:256700 NegativeStrandReadsAssigned:22162537 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=140 echo kmer=135 SRR1799541 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR1799541-trimmed-pair1.fastq SRR1799541-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,779,183 reads, 22,048,060 reads pseudoaligned [quant] estimated average fragment length: 186.418 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,200 rounds 52401 SRR1799541.ke.tsv 34699 SRR1799541.se.tsv 87100 total ==> SRR1799541.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1832.58 529 14.3708 Potri.005G024800.1.v4.1 1035 849.582 47 2.75411 Potri.004G059700.1.v4.1 961 775.582 18 1.1554 Potri.007G009000.2.v4.1 1416 1230.58 0 0 Potri.003G141000.2.v4.1 2943 2757.58 363.172 6.55651 Potri.016G087400.1.v4.1 270 101.949 2157.18 1053.39 Potri.015G069301.1.v4.1 564 379.097 0 0 Potri.010G195200.1.v4.1 1773 1587.58 61 1.91286 Potri.012G127500.1.v4.1 977 791.582 6518 409.927 ==> SRR1799541.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1852 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 331 Potri.001G212900.v4.1 3 Potri.001G182400.v4.1 15 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR1799541 completed mapping pipeline successfully